diff --git a/.devcontainer/devcontainer.json b/.devcontainer/devcontainer.json new file mode 100644 index 000000000..b290e0901 --- /dev/null +++ b/.devcontainer/devcontainer.json @@ -0,0 +1,20 @@ +{ + "name": "nfcore", + "image": "nfcore/gitpod:latest", + "remoteUser": "gitpod", + "runArgs": ["--privileged"], + + // Configure tool-specific properties. + "customizations": { + // Configure properties specific to VS Code. + "vscode": { + // Set *default* container specific settings.json values on container create. + "settings": { + "python.defaultInterpreterPath": "/opt/conda/bin/python" + }, + + // Add the IDs of extensions you want installed when the container is created. + "extensions": ["ms-python.python", "ms-python.vscode-pylance", "nf-core.nf-core-extensionpack"] + } + } +} diff --git a/.editorconfig b/.editorconfig new file mode 100644 index 000000000..6d9b74cc0 --- /dev/null +++ b/.editorconfig @@ -0,0 +1,37 @@ +root = true + +[*] +charset = utf-8 +end_of_line = lf +insert_final_newline = true +trim_trailing_whitespace = true +indent_size = 4 +indent_style = space + +[*.{md,yml,yaml,html,css,scss,js}] +indent_size = 2 + +# These files are edited and tested upstream in nf-core/modules +[/modules/nf-core/**] +charset = unset +end_of_line = unset +insert_final_newline = unset +trim_trailing_whitespace = unset +indent_style = unset +[/subworkflows/nf-core/**] +charset = unset +end_of_line = unset +insert_final_newline = unset +trim_trailing_whitespace = unset +indent_style = unset + +[/assets/email*] +indent_size = unset + +# ignore python and markdown +[*.{py,md}] +indent_style = unset + +# ignore ro-crate metadata files +[**/ro-crate-metadata.json] +insert_final_newline = unset diff --git a/.gitattributes b/.gitattributes index 7fe55006f..7a2dabc29 100644 --- a/.gitattributes +++ b/.gitattributes @@ -1 +1,4 @@ *.config linguist-language=nextflow +*.nf.test linguist-language=nextflow +modules/nf-core/** linguist-generated +subworkflows/nf-core/** linguist-generated diff --git a/.github/.dockstore.yml b/.github/.dockstore.yml index 030138a0c..191fabd22 100644 --- a/.github/.dockstore.yml +++ b/.github/.dockstore.yml @@ -3,3 +3,4 @@ version: 1.2 workflows: - subclass: nfl primaryDescriptorPath: /nextflow.config + publish: True diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index b46a4c292..4e3b54022 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -1,4 +1,4 @@ -# nf-core/circrna: Contributing Guidelines +# `nf-core/circrna`: Contributing Guidelines Hi there! Many thanks for taking an interest in improving nf-core/circrna. @@ -9,35 +9,42 @@ Please use the pre-filled template to save time. However, don't be put off by this template - other more general issues and suggestions are welcome! Contributions to the code are even more welcome ;) +> [!NOTE] > If you need help using or modifying nf-core/circrna then the best place to ask is on the nf-core Slack [#circrna](https://nfcore.slack.com/channels/circrna) channel ([join our Slack here](https://nf-co.re/join/slack)). ## Contribution workflow If you'd like to write some code for nf-core/circrna, the standard workflow is as follows: -1. Check that there isn't already an issue about your idea in the [nf-core/circrna issues](https://github.com/nf-core/circrna/issues) to avoid duplicating work - * If there isn't one already, please create one so that others know you're working on this +1. Check that there isn't already an issue about your idea in the [nf-core/circrna issues](https://github.com/nf-core/circrna/issues) to avoid duplicating work. If there isn't one already, please create one so that others know you're working on this 2. [Fork](https://help.github.com/en/github/getting-started-with-github/fork-a-repo) the [nf-core/circrna repository](https://github.com/nf-core/circrna) to your GitHub account -3. Make the necessary changes / additions within your forked repository -4. Submit a Pull Request against the `dev` branch and wait for the code to be reviewed and merged +3. Make the necessary changes / additions within your forked repository following [Pipeline conventions](#pipeline-contribution-conventions) +4. Use `nf-core pipelines schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). +5. Submit a Pull Request against the `dev` branch and wait for the code to be reviewed and merged If you're not used to this workflow with git, you can start with some [docs from GitHub](https://help.github.com/en/github/collaborating-with-issues-and-pull-requests) or even their [excellent `git` resources](https://try.github.io/). ## Tests +You have the option to test your changes locally by running the pipeline. For receiving warnings about process selectors and other `debug` information, it is recommended to use the debug profile. Execute all the tests with the following command: + +```bash +nf-test test --profile debug,test,docker --verbose +``` + When you create a pull request with changes, [GitHub Actions](https://github.com/features/actions) will run automatic tests. Typically, pull-requests are only fully reviewed when these tests are passing, though of course we can help out before then. There are typically two types of tests that run: -### Lint Tests +### Lint tests `nf-core` has a [set of guidelines](https://nf-co.re/developers/guidelines) which all pipelines must adhere to. -To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core lint ` command. +To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core pipelines lint ` command. If any failures or warnings are encountered, please follow the listed URL for more documentation. -### Pipeline Tests +### Pipeline tests Each `nf-core` pipeline should be set up with a minimal set of test-data. `GitHub Actions` then runs the pipeline on this data to ensure that it exits successfully. @@ -48,10 +55,71 @@ These tests are run both with the latest available version of `Nextflow` and als :warning: Only in the unlikely and regretful event of a release happening with a bug. -* On your own fork, make a new branch `patch` based on `upstream/master`. -* Fix the bug, and bump version (X.Y.Z+1). -* A PR should be made on `master` from patch to directly this particular bug. +- On your own fork, make a new branch `patch` based on `upstream/main` or `upstream/master`. +- Fix the bug, and bump version (X.Y.Z+1). +- Open a pull-request from `patch` to `main`/`master` with the changes. ## Getting help For further information/help, please consult the [nf-core/circrna documentation](https://nf-co.re/circrna/usage) and don't hesitate to get in touch on the nf-core Slack [#circrna](https://nfcore.slack.com/channels/circrna) channel ([join our Slack here](https://nf-co.re/join/slack)). + +## Pipeline contribution conventions + +To make the `nf-core/circrna` code and processing logic more understandable for new contributors and to ensure quality, we semi-standardise the way the code and other contributions are written. + +### Adding a new step + +If you wish to contribute a new step, please use the following coding standards: + +1. Define the corresponding input channel into your new process from the expected previous process channel. +2. Write the process block (see below). +3. Define the output channel if needed (see below). +4. Add any new parameters to `nextflow.config` with a default (see below). +5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core pipelines schema build` tool). +6. Add sanity checks and validation for all relevant parameters. +7. Perform local tests to validate that the new code works as expected. +8. If applicable, add a new test command in `.github/workflow/ci.yml`. +9. Update MultiQC config `assets/multiqc_config.yml` so relevant suffixes, file name clean up and module plots are in the appropriate order. If applicable, add a [MultiQC](https://https://multiqc.info/) module. +10. Add a description of the output files and if relevant any appropriate images from the MultiQC report to `docs/output.md`. + +### Default values + +Parameters should be initialised / defined with default values within the `params` scope in `nextflow.config`. + +Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json`. + +### Default processes resource requirements + +Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/main/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. + +The process resources can be passed on to the tool dynamically within the process with the `${task.cpus}` and `${task.memory}` variables in the `script:` block. + +### Naming schemes + +Please use the following naming schemes, to make it easy to understand what is going where. + +- initial process channel: `ch_output_from_` +- intermediate and terminal channels: `ch__for_` + +### Nextflow version bumping + +If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core pipelines bump-version --nextflow . [min-nf-version]` + +### Images and figures + +For overview images and other documents we follow the nf-core [style guidelines and examples](https://nf-co.re/developers/design_guidelines). + +## GitHub Codespaces + +This repo includes a devcontainer configuration which will create a GitHub Codespaces for Nextflow development! This is an online developer environment that runs in your browser, complete with VSCode and a terminal. + +To get started: + +- Open the repo in [Codespaces](https://github.com/nf-core/circrna/codespaces) +- Tools installed + - nf-core + - Nextflow + +Devcontainer specs: + +- [DevContainer config](.devcontainer/devcontainer.json) diff --git a/.github/ISSUE_TEMPLATE/bug_report.md b/.github/ISSUE_TEMPLATE/bug_report.md deleted file mode 100644 index 9b7e39ee2..000000000 --- a/.github/ISSUE_TEMPLATE/bug_report.md +++ /dev/null @@ -1,50 +0,0 @@ ---- -name: Bug report -about: Report something that is broken or incorrect -labels: bug ---- - - - -## Description of the bug - - - -## Steps to reproduce - -Steps to reproduce the behaviour: - -1. Command line: -2. See error: - -## Expected behaviour - - - -## System - -- Hardware: -- Executor: -- OS: -- Version - -## Nextflow Installation - -- Version: - -## Container engine - -- Engine: -- version: -- Image tag: - -## Additional context - - diff --git a/.github/ISSUE_TEMPLATE/bug_report.yml b/.github/ISSUE_TEMPLATE/bug_report.yml new file mode 100644 index 000000000..430aa39cf --- /dev/null +++ b/.github/ISSUE_TEMPLATE/bug_report.yml @@ -0,0 +1,49 @@ +name: Bug report +description: Report something that is broken or incorrect +labels: bug +body: + - type: markdown + attributes: + value: | + Before you post this issue, please check the documentation: + + - [nf-core website: troubleshooting](https://nf-co.re/usage/troubleshooting) + - [nf-core/circrna pipeline documentation](https://nf-co.re/circrna/usage) + - type: textarea + id: description + attributes: + label: Description of the bug + description: A clear and concise description of what the bug is. + validations: + required: true + + - type: textarea + id: command_used + attributes: + label: Command used and terminal output + description: Steps to reproduce the behaviour. Please paste the command you used to launch the pipeline and the output from your terminal. + render: console + placeholder: | + $ nextflow run ... + + Some output where something broke + + - type: textarea + id: files + attributes: + label: Relevant files + description: | + Please drag and drop the relevant files here. Create a `.zip` archive if the extension is not allowed. + Your verbose log file `.nextflow.log` is often useful _(this is a hidden file in the directory where you launched the pipeline)_ as well as custom Nextflow configuration files. + + - type: textarea + id: system + attributes: + label: System information + description: | + * Nextflow version _(eg. 23.04.0)_ + * Hardware _(eg. HPC, Desktop, Cloud)_ + * Executor _(eg. slurm, local, awsbatch)_ + * Container engine: _(e.g. Docker, Singularity, Conda, Podman, Shifter, Charliecloud, or Apptainer)_ + * OS _(eg. CentOS Linux, macOS, Linux Mint)_ + * Version of nf-core/circrna _(eg. 1.1, 1.5, 1.8.2)_ diff --git a/.github/ISSUE_TEMPLATE/config.yml b/.github/ISSUE_TEMPLATE/config.yml index 809e7032a..58b2afbc6 100644 --- a/.github/ISSUE_TEMPLATE/config.yml +++ b/.github/ISSUE_TEMPLATE/config.yml @@ -1,4 +1,3 @@ -blank_issues_enabled: false contact_links: - name: Join nf-core url: https://nf-co.re/join diff --git a/.github/ISSUE_TEMPLATE/feature_request.md b/.github/ISSUE_TEMPLATE/feature_request.md deleted file mode 100644 index 7c173d5c7..000000000 --- a/.github/ISSUE_TEMPLATE/feature_request.md +++ /dev/null @@ -1,32 +0,0 @@ ---- -name: Feature request -about: Suggest an idea for the nf-core website -labels: enhancement ---- - - - -## Is your feature request related to a problem? Please describe - - - - - -## Describe the solution you'd like - - - -## Describe alternatives you've considered - - - -## Additional context - - diff --git a/.github/ISSUE_TEMPLATE/feature_request.yml b/.github/ISSUE_TEMPLATE/feature_request.yml new file mode 100644 index 000000000..82c4e3f26 --- /dev/null +++ b/.github/ISSUE_TEMPLATE/feature_request.yml @@ -0,0 +1,11 @@ +name: Feature request +description: Suggest an idea for the nf-core/circrna pipeline +labels: enhancement +body: + - type: textarea + id: description + attributes: + label: Description of feature + description: Please describe your suggestion for a new feature. It might help to describe a problem or use case, plus any alternatives that you have considered. + validations: + required: true diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 62667f246..187fef977 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -13,8 +13,14 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/circ ## PR checklist -- [ ] This comment contains a description of changes (with reason) -- [ ] `CHANGELOG.md` is updated +- [ ] This comment contains a description of changes (with reason). - [ ] If you've fixed a bug or added code that should be tested, add tests! -- [ ] Documentation in `docs` is updated -- [ ] If necessary, also make a PR on the [nf-core/circrna branch on the nf-core/test-datasets repo](https://github.com/nf-core/test-datasets/pull/new/nf-core/circrna) +- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/circrna/tree/master/.github/CONTRIBUTING.md) +- [ ] If necessary, also make a PR on the nf-core/circrna _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. +- [ ] Make sure your code lints (`nf-core pipelines lint`). +- [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). +- [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). +- [ ] Usage Documentation in `docs/usage.md` is updated. +- [ ] Output Documentation in `docs/output.md` is updated. +- [ ] `CHANGELOG.md` is updated. +- [ ] `README.md` is updated (including new tool citations and authors/contributors). diff --git a/.github/markdownlint.yml b/.github/markdownlint.yml deleted file mode 100644 index 96b12a703..000000000 --- a/.github/markdownlint.yml +++ /dev/null @@ -1,5 +0,0 @@ -# Markdownlint configuration file -default: true, -line-length: false -no-duplicate-header: - siblings_only: true diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index dd89fcd1a..af1593622 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -1,43 +1,69 @@ name: nf-core AWS full size tests -# This workflow is triggered on published releases. -# It can be additionally triggered manually with GitHub actions workflow dispatch. +# This workflow is triggered on PRs opened against the main/master branch. +# It can be additionally triggered manually with GitHub actions workflow dispatch button. # It runs the -profile 'test_full' on AWS batch on: - workflow_run: - workflows: ["nf-core Docker push (release)"] - types: [completed] + pull_request: + branches: + - main + - master workflow_dispatch: + pull_request_review: + types: [submitted] jobs: - run-awstest: + run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/circrna' + # run only if the PR is approved by at least 2 reviewers and against the master branch or manually triggered + if: github.repository == 'nf-core/circrna' && github.event.review.state == 'approved' && github.event.pull_request.base.ref == 'master' || github.event_name == 'workflow_dispatch' runs-on: ubuntu-latest steps: - - name: Setup Miniconda - uses: conda-incubator/setup-miniconda@v2 + - name: Get PR reviews + uses: octokit/request-action@v2.x + if: github.event_name != 'workflow_dispatch' + id: check_approvals + continue-on-error: true with: - auto-update-conda: true - python-version: 3.7 - - name: Install awscli - run: conda install -c conda-forge awscli - - name: Start AWS batch job + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews?per_page=100 + env: + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + + - name: Check for approvals + if: ${{ failure() && github.event_name != 'workflow_dispatch' }} + run: | + echo "No review approvals found. At least 2 approvals are required to run this action automatically." + exit 1 + + - name: Check for enough approvals (>=2) + id: test_variables + if: github.event_name != 'workflow_dispatch' + run: | + JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' + CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') + test $CURRENT_APPROVALS_COUNT -ge 2 || exit 1 # At least 2 approvals are required + + - name: Launch workflow via Seqera Platform + uses: seqeralabs/action-tower-launch@v2 # TODO nf-core: You can customise AWS full pipeline tests as required # Add full size test data (but still relatively small datasets for few samples) # on the `test_full.config` test runs with only one set of parameters - # Then specify `-profile test_full` instead of `-profile test` on the AWS batch command - env: - AWS_ACCESS_KEY_ID: ${{ secrets.AWS_ACCESS_KEY_ID }} - AWS_SECRET_ACCESS_KEY: ${{ secrets.AWS_SECRET_ACCESS_KEY }} - TOWER_ACCESS_TOKEN: ${{ secrets.AWS_TOWER_TOKEN }} - AWS_JOB_DEFINITION: ${{ secrets.AWS_JOB_DEFINITION }} - AWS_JOB_QUEUE: ${{ secrets.AWS_JOB_QUEUE }} - AWS_S3_BUCKET: ${{ secrets.AWS_S3_BUCKET }} - run: | - aws batch submit-job \ - --region eu-west-1 \ - --job-name nf-core-circrna \ - --job-queue $AWS_JOB_QUEUE \ - --job-definition $AWS_JOB_DEFINITION \ - --container-overrides '{"command": ["nf-core/circrna", "-r '"${GITHUB_SHA}"' -profile test --outdir s3://'"${AWS_S3_BUCKET}"'/circrna/results-'"${GITHUB_SHA}"' -w s3://'"${AWS_S3_BUCKET}"'/circrna/work-'"${GITHUB_SHA}"' -with-tower"], "environment": [{"name": "TOWER_ACCESS_TOKEN", "value": "'"$TOWER_ACCESS_TOKEN"'"}]}' + with: + workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} + access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} + compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} + revision: ${{ github.sha }} + workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/circrna/work-${{ github.sha }} + parameters: | + { + "hook_url": "${{ secrets.MEGATESTS_ALERTS_SLACK_HOOK_URL }}", + "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/circrna/results-${{ github.sha }}" + } + profiles: test_full + + - uses: actions/upload-artifact@v4 + with: + name: Seqera Platform debug log file + path: | + seqera_platform_action_*.log + seqera_platform_action_*.json diff --git a/.github/workflows/awstest.yml b/.github/workflows/awstest.yml index 88d9fc6b5..cbea731e1 100644 --- a/.github/workflows/awstest.yml +++ b/.github/workflows/awstest.yml @@ -1,39 +1,33 @@ name: nf-core AWS test -# This workflow is triggered on push to the master branch. -# It can be additionally triggered manually with GitHub actions workflow dispatch. -# It runs the -profile 'test' on AWS batch. +# This workflow can be triggered manually with the GitHub actions workflow dispatch button. +# It runs the -profile 'test' on AWS batch on: workflow_dispatch: - jobs: - run-awstest: + run-platform: name: Run AWS tests if: github.repository == 'nf-core/circrna' runs-on: ubuntu-latest steps: - - name: Setup Miniconda - uses: conda-incubator/setup-miniconda@v2 + # Launch workflow using Seqera Platform CLI tool action + - name: Launch workflow via Seqera Platform + uses: seqeralabs/action-tower-launch@v2 + with: + workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} + access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} + compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} + revision: ${{ github.sha }} + workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/circrna/work-${{ github.sha }} + parameters: | + { + "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/circrna/results-test-${{ github.sha }}" + } + profiles: test + + - uses: actions/upload-artifact@v4 with: - auto-update-conda: true - python-version: 3.7 - - name: Install awscli - run: conda install -c conda-forge awscli - - name: Start AWS batch job - # TODO nf-core: You can customise CI pipeline run tests as required - # For example: adding multiple test runs with different parameters - # Remember that you can parallelise this by using strategy.matrix - env: - AWS_ACCESS_KEY_ID: ${{ secrets.AWS_ACCESS_KEY_ID }} - AWS_SECRET_ACCESS_KEY: ${{ secrets.AWS_SECRET_ACCESS_KEY }} - TOWER_ACCESS_TOKEN: ${{ secrets.AWS_TOWER_TOKEN }} - AWS_JOB_DEFINITION: ${{ secrets.AWS_JOB_DEFINITION }} - AWS_JOB_QUEUE: ${{ secrets.AWS_JOB_QUEUE }} - AWS_S3_BUCKET: ${{ secrets.AWS_S3_BUCKET }} - run: | - aws batch submit-job \ - --region eu-west-1 \ - --job-name nf-core-circrna \ - --job-queue $AWS_JOB_QUEUE \ - --job-definition $AWS_JOB_DEFINITION \ - --container-overrides '{"command": ["nf-core/circrna", "-r '"${GITHUB_SHA}"' -profile test --outdir s3://'"${AWS_S3_BUCKET}"'/circrna/results-'"${GITHUB_SHA}"' -w s3://'"${AWS_S3_BUCKET}"'/circrna/work-'"${GITHUB_SHA}"' -with-tower"], "environment": [{"name": "TOWER_ACCESS_TOKEN", "value": "'"$TOWER_ACCESS_TOKEN"'"}]}' + name: Seqera Platform debug log file + path: | + seqera_platform_action_*.log + seqera_platform_action_*.json diff --git a/.github/workflows/branch.yml b/.github/workflows/branch.yml index 240922349..0d9eb7e21 100644 --- a/.github/workflows/branch.yml +++ b/.github/workflows/branch.yml @@ -1,37 +1,46 @@ name: nf-core branch protection -# This workflow is triggered on PRs to master branch on the repository -# It fails when someone tries to make a PR against the nf-core `master` branch instead of `dev` +# This workflow is triggered on PRs to `main`/`master` branch on the repository +# It fails when someone tries to make a PR against the nf-core `main`/`master` branch instead of `dev` on: pull_request_target: - branches: [master] + branches: + - main + - master jobs: test: runs-on: ubuntu-latest steps: - # PRs to the nf-core repo master branch are only ok if coming from the nf-core repo `dev` or any `patch` branches + # PRs to the nf-core repo main/master branch are only ok if coming from the nf-core repo `dev` or any `patch` branches - name: Check PRs if: github.repository == 'nf-core/circrna' run: | - { [[ ${{github.event.pull_request.head.repo.full_name}} == nf-core/circrna ]] && [[ $GITHUB_HEAD_REF = "dev" ]]; } || [[ $GITHUB_HEAD_REF == "patch" ]] - + { [[ ${{github.event.pull_request.head.repo.full_name }} == nf-core/circrna ]] && [[ $GITHUB_HEAD_REF == "dev" ]]; } || [[ $GITHUB_HEAD_REF == "patch" ]] # If the above check failed, post a comment on the PR explaining the failure # NOTE - this doesn't currently work if the PR is coming from a fork, due to limitations in GitHub actions secrets - name: Post PR comment if: failure() - uses: mshick/add-pr-comment@v1 + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 with: message: | + ## This PR is against the `${{github.event.pull_request.base.ref}}` branch :x: + + * Do not close this PR + * Click _Edit_ and change the `base` to `dev` + * This CI test will remain failed until you push a new commit + + --- + Hi @${{ github.event.pull_request.user.login }}, - It looks like this pull-request is has been made against the ${{github.event.pull_request.head.repo.full_name}} `master` branch. - The `master` branch on nf-core repositories should always contain code from the latest release. - Because of this, PRs to `master` are only allowed if they come from the ${{github.event.pull_request.head.repo.full_name}} `dev` branch. + It looks like this pull-request is has been made against the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) ${{github.event.pull_request.base.ref}} branch. + The ${{github.event.pull_request.base.ref}} branch on nf-core repositories should always contain code from the latest release. + Because of this, PRs to ${{github.event.pull_request.base.ref}} are only allowed if they come from the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) `dev` branch. You do not need to close this PR, you can change the target branch to `dev` by clicking the _"Edit"_ button at the top of this page. + Note that even after this, the test will continue to show as failing until you push a new commit. Thanks again for your contribution! repo-token: ${{ secrets.GITHUB_TOKEN }} allow-repeats: false - diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index e8fd4afe5..664fd5e94 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -7,51 +7,81 @@ on: pull_request: release: types: [published] + workflow_dispatch: + +env: + NXF_ANSI_LOG: false + NXF_SINGULARITY_CACHEDIR: ${{ github.workspace }}/.singularity + NXF_SINGULARITY_LIBRARYDIR: ${{ github.workspace }}/.singularity + +concurrency: + group: "${{ github.workflow }}-${{ github.event.pull_request.number || github.ref }}" + cancel-in-progress: true jobs: test: - name: Run workflow tests + name: "Run pipeline with test data (${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }})" # Only run on push if this is the nf-core dev branch (merged PRs) - if: ${{ github.event_name != 'push' || (github.event_name == 'push' && github.repository == 'nf-core/circrna') }} + if: "${{ github.event_name != 'push' || (github.event_name == 'push' && github.repository == 'nf-core/circrna') }}" runs-on: ubuntu-latest - env: - NXF_VER: ${{ matrix.nxf_ver }} - NXF_ANSI_LOG: false strategy: matrix: - # Nextflow versions: check pipeline minimum and current latest - nxf_ver: ['20.04.0', ''] + NXF_VER: + - "24.04.2" + - "latest-everything" + profile: + - "conda" + - "docker" + - "singularity" + test_name: + - "test" + isMaster: + - ${{ github.base_ref == 'master' }} + # Exclude conda and singularity on dev + exclude: + - isMaster: false + profile: "conda" + - isMaster: false + profile: "singularity" steps: - name: Check out pipeline code - uses: actions/checkout@v2 + uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 + with: + fetch-depth: 0 - - name: Check if Dockerfile or Conda environment changed - uses: technote-space/get-diff-action@v4 + - name: Set up Nextflow + uses: nf-core/setup-nextflow@v2 with: - FILES: | - Dockerfile - environment.yml + version: "${{ matrix.NXF_VER }}" - - name: Build new docker image - if: env.MATCHED_FILES - run: docker build --no-cache . -t nfcore/circrna:dev + - name: Set up Apptainer + if: matrix.profile == 'singularity' + uses: eWaterCycle/setup-apptainer@main - - name: Pull docker image - if: ${{ !env.MATCHED_FILES }} + - name: Set up Singularity + if: matrix.profile == 'singularity' run: | - docker pull nfcore/circrna:dev - docker tag nfcore/circrna:dev nfcore/circrna:dev + mkdir -p $NXF_SINGULARITY_CACHEDIR + mkdir -p $NXF_SINGULARITY_LIBRARYDIR - - name: Install Nextflow - env: - CAPSULE_LOG: none + - name: Set up Miniconda + if: matrix.profile == 'conda' + uses: conda-incubator/setup-miniconda@a4260408e20b96e80095f42ff7f1a15b27dd94ca # v3 + with: + miniconda-version: "latest" + auto-update-conda: true + conda-solver: libmamba + channels: conda-forge,bioconda + + - name: Set up Conda + if: matrix.profile == 'conda' run: | - wget -qO- get.nextflow.io | bash - sudo mv nextflow /usr/local/bin/ + echo $(realpath $CONDA)/condabin >> $GITHUB_PATH + echo $(realpath python) >> $GITHUB_PATH + + - name: Clean up Disk space + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - name: Run pipeline with test data - # TODO nf-core: You can customise CI pipeline run tests as required - # For example: adding multiple test runs with different parameters - # Remember that you can parallelise this by using strategy.matrix + - name: "Run pipeline with test data ${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }}" run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker + nextflow run ${GITHUB_WORKSPACE} -profile ${{ matrix.test_name }},${{ matrix.profile }} --outdir ./results diff --git a/.github/workflows/clean-up.yml b/.github/workflows/clean-up.yml new file mode 100644 index 000000000..0b6b1f272 --- /dev/null +++ b/.github/workflows/clean-up.yml @@ -0,0 +1,24 @@ +name: "Close user-tagged issues and PRs" +on: + schedule: + - cron: "0 0 * * 0" # Once a week + +jobs: + clean-up: + runs-on: ubuntu-latest + permissions: + issues: write + pull-requests: write + steps: + - uses: actions/stale@28ca1036281a5e5922ead5184a1bbf96e5fc984e # v9 + with: + stale-issue-message: "This issue has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment otherwise this issue will be closed in 20 days." + stale-pr-message: "This PR has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment if it is still useful." + close-issue-message: "This issue was closed because it has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor and then staled for 20 days with no activity." + days-before-stale: 30 + days-before-close: 20 + days-before-pr-close: -1 + any-of-labels: "awaiting-changes,awaiting-feedback" + exempt-issue-labels: "WIP" + exempt-pr-labels: "WIP" + repo-token: "${{ secrets.GITHUB_TOKEN }}" diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml new file mode 100644 index 000000000..ab06316ea --- /dev/null +++ b/.github/workflows/download_pipeline.yml @@ -0,0 +1,134 @@ +name: Test successful pipeline download with 'nf-core pipelines download' + +# Run the workflow when: +# - dispatched manually +# - when a PR is opened or reopened to main/master branch +# - the head branch of the pull request is updated, i.e. if fixes for a release are pushed last minute to dev. +on: + workflow_dispatch: + inputs: + testbranch: + description: "The specific branch you wish to utilize for the test execution of nf-core pipelines download." + required: true + default: "dev" + pull_request: + types: + - opened + - edited + - synchronize + branches: + - main + - master + pull_request_target: + branches: + - main + - master + +env: + NXF_ANSI_LOG: false + +jobs: + configure: + runs-on: ubuntu-latest + outputs: + REPO_LOWERCASE: ${{ steps.get_repo_properties.outputs.REPO_LOWERCASE }} + REPOTITLE_LOWERCASE: ${{ steps.get_repo_properties.outputs.REPOTITLE_LOWERCASE }} + REPO_BRANCH: ${{ steps.get_repo_properties.outputs.REPO_BRANCH }} + steps: + - name: Get the repository name and current branch + id: get_repo_properties + run: | + echo "REPO_LOWERCASE=${GITHUB_REPOSITORY,,}" >> "$GITHUB_OUTPUT" + echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> "$GITHUB_OUTPUT" + echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> "$GITHUB_OUTPUT" + + download: + runs-on: ubuntu-latest + needs: configure + steps: + - name: Install Nextflow + uses: nf-core/setup-nextflow@v2 + + - name: Disk space cleanup + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 + + - uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 + with: + python-version: "3.12" + architecture: "x64" + + - name: Setup Apptainer + uses: eWaterCycle/setup-apptainer@4bb22c52d4f63406c49e94c804632975787312b3 # v2.0.0 + with: + apptainer-version: 1.3.4 + + - name: Install dependencies + run: | + python -m pip install --upgrade pip + pip install git+https://github.com/nf-core/tools.git@dev + + - name: Make a cache directory for the container images + run: | + mkdir -p ./singularity_container_images + + - name: Download the pipeline + env: + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images + run: | + nf-core pipelines download ${{ needs.configure.outputs.REPO_LOWERCASE }} \ + --revision ${{ needs.configure.outputs.REPO_BRANCH }} \ + --outdir ./${{ needs.configure.outputs.REPOTITLE_LOWERCASE }} \ + --compress "none" \ + --container-system 'singularity' \ + --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io/library/" \ + --container-cache-utilisation 'amend' \ + --download-configuration 'yes' + + - name: Inspect download + run: tree ./${{ needs.configure.outputs.REPOTITLE_LOWERCASE }} + + - name: Inspect container images + run: tree ./singularity_container_images | tee ./container_initial + + - name: Count the downloaded number of container images + id: count_initial + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Initial container image count: $image_count" + echo "IMAGE_COUNT_INITIAL=$image_count" >> "$GITHUB_OUTPUT" + + - name: Run the downloaded pipeline (stub) + id: stub_run_pipeline + continue-on-error: true + env: + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images + NXF_SINGULARITY_HOME_MOUNT: true + run: nextflow run ./${{needs.configure.outputs.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ needs.configure.outputs.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results + - name: Run the downloaded pipeline (stub run not supported) + id: run_pipeline + if: ${{ steps.stub_run_pipeline.outcome == 'failure' }} + env: + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images + NXF_SINGULARITY_HOME_MOUNT: true + run: nextflow run ./${{ needs.configure.outputs.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ needs.configure.outputs.REPO_BRANCH }}) -profile test,singularity --outdir ./results + + - name: Count the downloaded number of container images + id: count_afterwards + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Post-pipeline run container image count: $image_count" + echo "IMAGE_COUNT_AFTER=$image_count" >> "$GITHUB_OUTPUT" + + - name: Compare container image counts + run: | + if [ "${{ steps.count_initial.outputs.IMAGE_COUNT_INITIAL }}" -ne "${{ steps.count_afterwards.outputs.IMAGE_COUNT_AFTER }}" ]; then + initial_count=${{ steps.count_initial.outputs.IMAGE_COUNT_INITIAL }} + final_count=${{ steps.count_afterwards.outputs.IMAGE_COUNT_AFTER }} + difference=$((final_count - initial_count)) + echo "$difference additional container images were \n downloaded at runtime . The pipeline has no support for offline runs!" + tree ./singularity_container_images > ./container_afterwards + diff ./container_initial ./container_afterwards + exit 1 + else + echo "The pipeline can be downloaded successfully!" + fi diff --git a/.github/workflows/fix-linting.yml b/.github/workflows/fix-linting.yml new file mode 100644 index 000000000..97169146d --- /dev/null +++ b/.github/workflows/fix-linting.yml @@ -0,0 +1,89 @@ +name: Fix linting from a comment +on: + issue_comment: + types: [created] + +jobs: + fix-linting: + # Only run if comment is on a PR with the main repo, and if it contains the magic keywords + if: > + contains(github.event.comment.html_url, '/pull/') && + contains(github.event.comment.body, '@nf-core-bot fix linting') && + github.repository == 'nf-core/circrna' + runs-on: ubuntu-latest + steps: + # Use the @nf-core-bot token to check out so we can push later + - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 + with: + token: ${{ secrets.nf_core_bot_auth_token }} + + # indication that the linting is being fixed + - name: React on comment + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + comment-id: ${{ github.event.comment.id }} + reactions: eyes + + # Action runs on the issue comment, so we don't get the PR by default + # Use the gh cli to check out the PR + - name: Checkout Pull Request + run: gh pr checkout ${{ github.event.issue.number }} + env: + GITHUB_TOKEN: ${{ secrets.nf_core_bot_auth_token }} + + # Install and run pre-commit + - uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 + with: + python-version: "3.12" + + - name: Install pre-commit + run: pip install pre-commit + + - name: Run pre-commit + id: pre-commit + run: pre-commit run --all-files + continue-on-error: true + + # indication that the linting has finished + - name: react if linting finished succesfully + if: steps.pre-commit.outcome == 'success' + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + comment-id: ${{ github.event.comment.id }} + reactions: "+1" + + - name: Commit & push changes + id: commit-and-push + if: steps.pre-commit.outcome == 'failure' + run: | + git config user.email "core@nf-co.re" + git config user.name "nf-core-bot" + git config push.default upstream + git add . + git status + git commit -m "[automated] Fix code linting" + git push + + - name: react if linting errors were fixed + id: react-if-fixed + if: steps.commit-and-push.outcome == 'success' + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + comment-id: ${{ github.event.comment.id }} + reactions: hooray + + - name: react if linting errors were not fixed + if: steps.commit-and-push.outcome == 'failure' + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + comment-id: ${{ github.event.comment.id }} + reactions: confused + + - name: react if linting errors were not fixed + if: steps.commit-and-push.outcome == 'failure' + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + issue-number: ${{ github.event.issue.number }} + body: | + @${{ github.actor }} I tried to fix the linting errors, but it didn't work. Please fix them manually. + See [CI log](https://github.com/nf-core/circrna/actions/runs/${{ github.run_id }}) for more details. diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index bef81e619..dbd52d5a2 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -1,65 +1,72 @@ name: nf-core linting # This workflow is triggered on pushes and PRs to the repository. -# It runs the `nf-core lint` and markdown lint tests to ensure that the code meets the nf-core guidelines +# It runs the `nf-core pipelines lint` and markdown lint tests to ensure +# that the code meets the nf-core guidelines. on: push: + branches: + - dev pull_request: release: types: [published] jobs: - Markdown: + pre-commit: runs-on: ubuntu-latest steps: - - uses: actions/checkout@v2 - - uses: actions/setup-node@v1 - with: - node-version: '10' - - name: Install markdownlint - run: npm install -g markdownlint-cli - - name: Run Markdownlint - run: markdownlint ${GITHUB_WORKSPACE} -c ${GITHUB_WORKSPACE}/.github/markdownlint.yml - YAML: - runs-on: ubuntu-latest - steps: - - uses: actions/checkout@v1 - - uses: actions/setup-node@v1 + - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 + + - name: Set up Python 3.12 + uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 with: - node-version: '10' - - name: Install yaml-lint - run: npm install -g yaml-lint - - name: Run yaml-lint - run: yamllint $(find ${GITHUB_WORKSPACE} -type f -name "*.yml") + python-version: "3.12" + + - name: Install pre-commit + run: pip install pre-commit + + - name: Run pre-commit + run: pre-commit run --all-files + nf-core: runs-on: ubuntu-latest steps: - - name: Check out pipeline code - uses: actions/checkout@v2 + uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 - name: Install Nextflow - env: - CAPSULE_LOG: none - run: | - wget -qO- get.nextflow.io | bash - sudo mv nextflow /usr/local/bin/ + uses: nf-core/setup-nextflow@v2 + + - uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 + with: + python-version: "3.12" + architecture: "x64" - - uses: actions/setup-python@v1 + - name: read .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.1.0 + id: read_yml with: - python-version: '3.6' - architecture: 'x64' + config: ${{ github.workspace }}/.nf-core.yml - name: Install dependencies run: | python -m pip install --upgrade pip - pip install nf-core + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} - - name: Run nf-core lint + - name: Run nf-core pipelines lint + if: ${{ github.base_ref != 'master' }} env: GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} - run: nf-core -l lint_log.txt lint ${GITHUB_WORKSPACE} --markdown lint_results.md + run: nf-core -l lint_log.txt pipelines lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md + + - name: Run nf-core pipelines lint --release + if: ${{ github.base_ref == 'master' }} + env: + GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} + run: nf-core -l lint_log.txt pipelines lint --release --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - name: Save PR number if: ${{ always() }} @@ -67,11 +74,10 @@ jobs: - name: Upload linting log file artifact if: ${{ always() }} - uses: actions/upload-artifact@v2 + uses: actions/upload-artifact@b4b15b8c7c6ac21ea08fcf65892d2ee8f75cf882 # v4 with: - name: linting-log-file + name: linting-logs path: | lint_log.txt lint_results.md PR_number.txt - diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 90f03c6f9..95b6b6af8 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -1,4 +1,3 @@ - name: nf-core linting comment # This workflow is triggered after the linting action is complete # It posts an automated comment to the PR, even if the PR is coming from a fork @@ -12,18 +11,18 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@v2 + uses: dawidd6/action-download-artifact@20319c5641d495c8a52e688b7dc5fada6c3a9fbc # v8 with: workflow: linting.yml + workflow_conclusion: completed - name: Get PR number id: pr_number - run: echo "::set-output name=pr_number::$(cat linting-logs/PR_number.txt)" + run: echo "pr_number=$(cat linting-logs/PR_number.txt)" >> $GITHUB_OUTPUT - name: Post PR comment - uses: marocchino/sticky-pull-request-comment@v2 + uses: marocchino/sticky-pull-request-comment@331f8f5b4215f0445d3c07b4967662a32a2d3e31 # v2 with: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} number: ${{ steps.pr_number.outputs.pr_number }} path: linting-logs/lint_results.md - diff --git a/.github/workflows/push_dockerhub_dev.yml b/.github/workflows/push_dockerhub_dev.yml deleted file mode 100644 index 36dec20fd..000000000 --- a/.github/workflows/push_dockerhub_dev.yml +++ /dev/null @@ -1,28 +0,0 @@ -name: nf-core Docker push (dev) -# This builds the docker image and pushes it to DockerHub -# Runs on nf-core repo releases and push event to 'dev' branch (PR merges) -on: - push: - branches: - - dev - -jobs: - push_dockerhub: - name: Push new Docker image to Docker Hub (dev) - runs-on: ubuntu-latest - # Only run for the nf-core repo, for releases and merged PRs - if: ${{ github.repository == 'nf-core/circrna' }} - env: - DOCKERHUB_USERNAME: ${{ secrets.DOCKERHUB_USERNAME }} - DOCKERHUB_PASS: ${{ secrets.DOCKERHUB_PASS }} - steps: - - name: Check out pipeline code - uses: actions/checkout@v2 - - - name: Build new docker image - run: docker build --no-cache . -t nfcore/circrna:dev - - - name: Push Docker image to DockerHub (dev) - run: | - echo "$DOCKERHUB_PASS" | docker login -u "$DOCKERHUB_USERNAME" --password-stdin - docker push nfcore/circrna:dev diff --git a/.github/workflows/push_dockerhub_release.yml b/.github/workflows/push_dockerhub_release.yml deleted file mode 100644 index 665693368..000000000 --- a/.github/workflows/push_dockerhub_release.yml +++ /dev/null @@ -1,29 +0,0 @@ -name: nf-core Docker push (release) -# This builds the docker image and pushes it to DockerHub -# Runs on nf-core repo releases and push event to 'dev' branch (PR merges) -on: - release: - types: [published] - -jobs: - push_dockerhub: - name: Push new Docker image to Docker Hub (release) - runs-on: ubuntu-latest - # Only run for the nf-core repo, for releases and merged PRs - if: ${{ github.repository == 'nf-core/circrna' }} - env: - DOCKERHUB_USERNAME: ${{ secrets.DOCKERHUB_USERNAME }} - DOCKERHUB_PASS: ${{ secrets.DOCKERHUB_PASS }} - steps: - - name: Check out pipeline code - uses: actions/checkout@v2 - - - name: Build new docker image - run: docker build --no-cache . -t nfcore/circrna:latest - - - name: Push Docker image to DockerHub (release) - run: | - echo "$DOCKERHUB_PASS" | docker login -u "$DOCKERHUB_USERNAME" --password-stdin - docker push nfcore/circrna:latest - docker tag nfcore/circrna:latest nfcore/circrna:${{ github.event.release.tag_name }} - docker push nfcore/circrna:${{ github.event.release.tag_name }} diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml new file mode 100644 index 000000000..76a9e67ed --- /dev/null +++ b/.github/workflows/release-announcements.yml @@ -0,0 +1,42 @@ +name: release-announcements +# Automatic release toot and tweet anouncements +on: + release: + types: [published] + workflow_dispatch: + +jobs: + toot: + runs-on: ubuntu-latest + steps: + - name: get topics and convert to hashtags + id: get_topics + run: | + echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" | sed 's/-//g' >> $GITHUB_OUTPUT + + - uses: rzr/fediverse-action@master + with: + access-token: ${{ secrets.MASTODON_ACCESS_TOKEN }} + host: "mstdn.science" # custom host if not "mastodon.social" (default) + # GitHub event payload + # https://docs.github.com/en/developers/webhooks-and-events/webhooks/webhook-events-and-payloads#release + message: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + + ${{ steps.get_topics.outputs.topics }} #nfcore #openscience #nextflow #bioinformatics + + bsky-post: + runs-on: ubuntu-latest + steps: + - uses: zentered/bluesky-post-action@80dbe0a7697de18c15ad22f4619919ceb5ccf597 # v0.1.0 + with: + post: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + env: + BSKY_IDENTIFIER: ${{ secrets.BSKY_IDENTIFIER }} + BSKY_PASSWORD: ${{ secrets.BSKY_PASSWORD }} + # diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml new file mode 100644 index 000000000..537529bc1 --- /dev/null +++ b/.github/workflows/template_version_comment.yml @@ -0,0 +1,46 @@ +name: nf-core template version comment +# This workflow is triggered on PRs to check if the pipeline template version matches the latest nf-core version. +# It posts a comment to the PR, even if it comes from a fork. + +on: pull_request_target + +jobs: + template_version: + runs-on: ubuntu-latest + steps: + - name: Check out pipeline code + uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 + with: + ref: ${{ github.event.pull_request.head.sha }} + + - name: Read template version from .nf-core.yml + uses: nichmor/minimal-read-yaml@v0.0.2 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yml + + - name: Install nf-core + run: | + python -m pip install --upgrade pip + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Check nf-core outdated + id: nf_core_outdated + run: echo "OUTPUT=$(pip list --outdated | grep nf-core)" >> ${GITHUB_ENV} + + - name: Post nf-core template version comment + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 + if: | + contains(env.OUTPUT, 'nf-core') + with: + repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} + allow-repeats: false + message: | + > [!WARNING] + > Newer version of the nf-core template is available. + > + > Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + > Please update your pipeline to the latest version. + > + > For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + # diff --git a/.gitignore b/.gitignore index aa4bb5b37..a42ce0162 100644 --- a/.gitignore +++ b/.gitignore @@ -3,7 +3,7 @@ work/ data/ results/ .DS_Store -tests/ testing/ testing* *.pyc +null/ diff --git a/.gitpod.yml b/.gitpod.yml new file mode 100644 index 000000000..83599f633 --- /dev/null +++ b/.gitpod.yml @@ -0,0 +1,10 @@ +image: nfcore/gitpod:latest +tasks: + - name: Update Nextflow and setup pre-commit + command: | + pre-commit install --install-hooks + nextflow self-update + +vscode: + extensions: + - nf-core.nf-core-extensionpack # https://github.com/nf-core/vscode-extensionpack diff --git a/.nf-core.yml b/.nf-core.yml new file mode 100644 index 000000000..8b8ac5767 --- /dev/null +++ b/.nf-core.yml @@ -0,0 +1,12 @@ +nf_core_version: 3.2.0 +repository_type: pipeline +template: + author: Barry Digby, Nico Trummer + description: Quantification, miRNA target prediction and differential expression + analysis of circular RNAs + force: false + is_nfcore: true + name: circrna + org: nf-core + outdir: . + version: 0.0.1dev diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml new file mode 100644 index 000000000..1dec86502 --- /dev/null +++ b/.pre-commit-config.yaml @@ -0,0 +1,13 @@ +repos: + - repo: https://github.com/pre-commit/mirrors-prettier + rev: "v3.1.0" + hooks: + - id: prettier + additional_dependencies: + - prettier@3.2.5 + + - repo: https://github.com/editorconfig-checker/editorconfig-checker.python + rev: "3.1.2" + hooks: + - id: editorconfig-checker + alias: ec diff --git a/.prettierignore b/.prettierignore new file mode 100644 index 000000000..edd29f01e --- /dev/null +++ b/.prettierignore @@ -0,0 +1,13 @@ +email_template.html +adaptivecard.json +slackreport.json +.nextflow* +work/ +data/ +results/ +.DS_Store +testing/ +testing* +*.pyc +bin/ +ro-crate-metadata.json diff --git a/.prettierrc.yml b/.prettierrc.yml new file mode 100644 index 000000000..c81f9a766 --- /dev/null +++ b/.prettierrc.yml @@ -0,0 +1 @@ +printWidth: 120 diff --git a/.vscode/settings.json b/.vscode/settings.json new file mode 100644 index 000000000..a33b527cc --- /dev/null +++ b/.vscode/settings.json @@ -0,0 +1,3 @@ +{ + "markdown.styles": ["public/vscode_markdown.css"] +} diff --git a/CHANGELOG.md b/CHANGELOG.md index 9def43762..750e3e085 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,12 +3,18 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v1.0dev - [date] +## 0.0.1dev - [2024-10-16] Initial release of nf-core/circrna, created with the [nf-core](https://nf-co.re/) template. ### `Added` +- Multiple methods for BSJ detection (CIRIquant, find_circ, segemehl, mapsplice, circexplorer2, circrna_finder, DCC) +- Multiple methods for circRNA quantification (psirc-quant, CIRIquant, sum and max aggregations) +- DB and GTF-based circRNA annotation +- MiRNA target prediction (TargetScan, miRanda) and correlation analysis +- Basic statistical analyses (CircTest, CIRIquant differential expression) + ### `Fixed` ### `Dependencies` diff --git a/CITATIONS.md b/CITATIONS.md new file mode 100644 index 000000000..a4d226ee1 --- /dev/null +++ b/CITATIONS.md @@ -0,0 +1,185 @@ +# nf-core/circrna: Citations + +## [nf-core](https://pubmed.ncbi.nlm.nih.gov/32055031/) + +> Ewels PA, Peltzer A, Fillinger S, Patel H, Alneberg J, Wilm A, Garcia MU, Di Tommaso P, Nahnsen S. The nf-core framework for community-curated bioinformatics pipelines. Nat Biotechnol. 2020 Mar;38(3):276-278. doi: 10.1038/s41587-020-0439-x. PubMed PMID: 32055031. + +## [Nextflow](https://pubmed.ncbi.nlm.nih.gov/28398311/) + +> Di Tommaso P, Chatzou M, Floden EW, Barja PP, Palumbo E, Notredame C. Nextflow enables reproducible computational workflows. Nat Biotechnol. 2017 Apr 11;35(4):316-319. doi: 10.1038/nbt.3820. PubMed PMID: 28398311. + +## Pipeline tools + +- [BEDTools](https://pubmed.ncbi.nlm.nih.gov/20110278/) + + > Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010 Mar 15;26(6):841-2. doi: 10.1093/bioinformatics/btq033. Epub 2010 Jan 28. PubMed PMID: 20110278; PubMed Central PMCID: PMC2832824. + +- [Bowtie](https://doi.org/10.1186/gb-2009-10-3-r25) + + > Langmead, B., Trapnell, C., Pop, M. et al., 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25. doi: 10.1186/gb-2009-10-3-r25 + +- [Bowtie2](https:/dx.doi.org/10.1038/nmeth.1923) + + > Langmead, B. and Salzberg, S. L. 2012 Fast gapped-read alignment with Bowtie 2. Nature methods, 9(4), p. 357–359. doi: 10.1038/nmeth.1923. + +- [BWA](https://www.ncbi.nlm.nih.gov/pubmed/19451168/) + + > Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009 Jul 15;25(14):1754-60. doi: 10.1093/bioinformatics/btp324. Epub 2009 May 18. PubMed PMID: 19451168; PubMed Central PMCID: PMC2705234. + +- [CIRCexplorer2](https://doi.org/10.1101/gr.202895.115) + + > Zhang XO, Dong R, Zhang Y, Zhang JL, Luo Z, Zhang J, Chen LL, Yang L. (2016). Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Res. 2016 Sep;26(9):1277-87. + +- [circRNA finder](https://doi.org/10.1016/j.celrep.2014.10.062) + + > Westholm, J.O., Lai, E.C., et al. (2016). Genome-wide Analysis of Drosophila Circular RNAs Reveals Their Structural and Sequence Properties and Age-Dependent Neural Accumulation Westholm et al. Cell Reports. + +- [CIRIquant](https://doi.org/10.1038/s41467-019-13840-9) + + > Zhang, J., Chen, S., Yang, J. et al. (2020). Accurate quantification of circular RNAs identifies extensive circular isoform switching events. Nat Commun 11, 90. + +- [DCC](https://doi.org/10.1093/bioinformatics/btv656) + + > Jun Cheng, Franziska Metge, Christoph Dieterich, (2016). Specific identification and quantification of circular RNAs from sequencing data, Bioinformatics, 32(7), 1094–1096. + +- [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) + +> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. + +- [find circ](https://doi.org/10.1038/nature11928) + + > Memczak, S., Jens, M., Elefsinioti, A., Torti, F., Krueger, J., Rybak, A., Maier, L., Mackowiak, S. D., Gregersen, L. H., Munschauer, M., Loewer, A., Ziebold, U., Landthaler, M., Kocks, C., le Noble, F., & Rajewsky, N. (2013). Circular RNAs are a large class of animal RNAs with regulatory potency. Nature, 495(7441), 333–338. + +- [GATK](https://pubmed.ncbi.nlm.nih.gov/20644199/) + + > McKenna A, Hanna M, Banks E, et al.: The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010 Sep;20(9):1297-303. doi: 10.1101/gr.107524.110. Epub 2010 Jul 19. PubMed PMID: 20644199; PubMed Central PMCID: PMC2928508. + +- [HISAT2](https://pubmed.ncbi.nlm.nih.gov/31375807/) + + > Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019 Aug;37(8):907-915. doi: 10.1038/s41587-019-0201-4. Epub 2019 Aug 2. PubMed PMID: 31375807. + +- [MapSplice2](https://doi.org/10.1093/nar/gkq622) + + > Wang, K., Liu J., et al. (2010) MapSplice: Accurate mapping of RNA-seq reads for splice junction discovery, Nucleic Acids Research, 38(18), 178. + +- [miRanda](https://doi.org/10.1186/gb-2003-5-1-r1) + + > Enright, A.J., John, B., Gaul, U. et al. (2003). MicroRNA targets in Drosophila. Genome Biol 5, R1. + +- [find circ](https://doi.org/10.1038/nature11928) + + > Memczak, S., Jens, M., Elefsinioti, A., Torti, F., Krueger, J., Rybak, A., Maier, L., Mackowiak, S. D., Gregersen, L. H., Munschauer, M., Loewer, A., Ziebold, U., Landthaler, M., Kocks, C., le Noble, F., & Rajewsky, N. (2013). Circular RNAs are a large class of animal RNAs with regulatory potency. Nature, 495(7441), 333–338. + +- [GATK](https://pubmed.ncbi.nlm.nih.gov/20644199/) + + > McKenna A, Hanna M, Banks E, et al.: The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010 Sep;20(9):1297-303. doi: 10.1101/gr.107524.110. Epub 2010 Jul 19. PubMed PMID: 20644199; PubMed Central PMCID: PMC2928508. + +- [HISAT2](https://pubmed.ncbi.nlm.nih.gov/31375807/) + + > Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019 Aug;37(8):907-915. doi: 10.1038/s41587-019-0201-4. Epub 2019 Aug 2. PubMed PMID: 31375807. + +- [MapSplice2](https://doi.org/10.1093/nar/gkq622) + + > Wang, K., Liu J., et al. (2010) MapSplice: Accurate mapping of RNA-seq reads for splice junction discovery, Nucleic Acids Research, 38(18), 178. + +- [miRanda](https://doi.org/10.1186/gb-2003-5-1-r1) + + > Enright, A.J., John, B., Gaul, U. et al. (2003). MicroRNA targets in Drosophila. Genome Biol 5, R1. + +- [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) + +> Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. + +- [R](https://www.R-project.org/) + + > R Core Team (2020). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. + + - [biomaRt](https://doi.org/10.1038/nprot.2009.97) + + > Durinck S, Spellman PT, Birney E, Huber W. (2009). Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRt. Nat Protoc. 4(8):1184-91. + + - [circlize](https://doi.org/10.1093/bioinformatics/btu393) + + > Zuguang Gu, Lei Gu, Roland Eils, Matthias Schlesner, Benedikt Brors (2014). circlize implements and enhances circular visualization in R , Bioinformatics, 30,(19) 2811–2812. + + - [DESeq2](https://doi.org/10.1186/s13059-014-0550-8) + + > Love, M.I., Huber, W. & Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. + + - [EnhancedVolcano](https://bioconductor.org/packages/release/bioc/html/EnhancedVolcano.html) + + > Blighe K, Rana S, Lewis M (2020). EnhancedVolcano: Publication-ready volcano plots with enhanced colouring and labeling. + + - [ggplot2](https://ggplot2.tidyverse.org) + + > Wickham H (2016). ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York. ISBN 978-3-319-24277-4. + + - [ggpubr](https://rpkgs.datanovia.com/ggpubr/) + + > Kassambara A. (2020). ggpubr: 'ggplot2' Based Publication Ready Plots. + + - [ihw](https://doi.org/10.1038/nmeth.3885) + + > Ignatiadis, N., Klaus, B., Zaugg, J. et al. (2016). Data-driven hypothesis weighting increases detection power in genome-scale multiple testing. Nat Methods 13, 577–580. + + - [PCAtools](https://bioconductor.org/packages/release/bioc/html/PCAtools.html) + + > Blighe K, Lun A (2020). PCAtools: PCAtools: Everything Principal Components Analysis. + + - [pheatmap](https://cran.r-project.org/package=pheatmap) + + > Kolde, R. (2019) Pretty Heatmaps. + + - [pvclust](https://doi.org/10.1093/bioinformatics/btl117) + + > Suzuki R., Shimodaira H., (2006). Pvclust: an R package for assessing the uncertainty in hierarchical clustering, Bioinformatics, 22(12), 1540–1542. + +- [SAMtools](https://pubmed.ncbi.nlm.nih.gov/19505943/) + + > Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R; 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009 Aug 15;25(16):2078-9. doi: 10.1093/bioinformatics/btp352. Epub 2009 Jun 8. PubMed PMID: 19505943; PubMed Central PMCID: PMC2723002. + +- [Segemehl](https://doi.org/10.1371/journal.pcbi.1000502) + + > Hoffmann S, Otto C, Kurtz S, Sharma CM, Khaitovich P, Vogel J, Stadler PF, Hackermueller J: "Fast mapping of short sequences with mismatches, insertions and deletions using index structures", PLoS Comput Biol (2009) vol. 5 (9) pp. e1000502. + +- [STAR](https://pubmed.ncbi.nlm.nih.gov/23104886/) + + > Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. STAR: ultrafast universal RNA-seq aligner Bioinformatics. 2013 Jan 1;29(1):15-21. doi: 10.1093/bioinformatics/bts635. Epub 2012 Oct 25. PubMed PMID: 23104886; PubMed Central PMCID: PMC3530905. + +- [StringTie2](https://pubmed.ncbi.nlm.nih.gov/31842956/) + + > Kovaka S, Zimin AV, Pertea GM, Razaghi R, Salzberg SL, Pertea M. Transcriptome assembly from long-read RNA-seq alignments with StringTie2 Genome Biol. 2019 Dec 16;20(1):278. doi: 10.1186/s13059-019-1910-1. PubMed PMID: 31842956; PubMed Central PMCID: PMC6912988. + +- [TargetScan](https://doi.org/10.7554/elife.05005) + + > Agarwal V, Bell GW, Nam JW, Bartel DP. (2015). Predicting effective microRNA target sites in mammalian mRNAs. Elife, 4:e05005. + +- [ViennaRNA](https://doi.org/10.1186/1748-7188-6-26) + + > Lorenz, R., Bernhart, S.H., Höner zu Siederdissen, C. et al. (2011). ViennaRNA Package 2.0. Algorithms Mol Biol 6, 26. + +## Test data References + +> Cao D. An autoregulation loop in fust-1 for circular RNA regulation in Caenorhabditis elegans. Genetics. 2021 Nov 5;219(3):iyab145. doi: 10.1093/genetics/iyab145. PMID: 34740247; PMCID: PMC8570788. + +## Software packaging/containerisation tools + +- [Anaconda](https://anaconda.com) + + > Anaconda Software Distribution. Computer software. Vers. 2-2.4.0. Anaconda, Nov. 2016. Web. + +- [Bioconda](https://pubmed.ncbi.nlm.nih.gov/29967506/) + + > Grüning B, Dale R, Sjödin A, Chapman BA, Rowe J, Tomkins-Tinch CH, Valieris R, Köster J; Bioconda Team. Bioconda: sustainable and comprehensive software distribution for the life sciences. Nat Methods. 2018 Jul;15(7):475-476. doi: 10.1038/s41592-018-0046-7. PubMed PMID: 29967506. + +- [BioContainers](https://pubmed.ncbi.nlm.nih.gov/28379341/) + + > da Veiga Leprevost F, Grüning B, Aflitos SA, Röst HL, Uszkoreit J, Barsnes H, Vaudel M, Moreno P, Gatto L, Weber J, Bai M, Jimenez RC, Sachsenberg T, Pfeuffer J, Alvarez RV, Griss J, Nesvizhskii AI, Perez-Riverol Y. BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics. 2017 Aug 15;33(16):2580-2582. doi: 10.1093/bioinformatics/btx192. PubMed PMID: 28379341; PubMed Central PMCID: PMC5870671. + +- [Docker](https://dl.acm.org/doi/10.5555/2600239.2600241) + + > Merkel, D. (2014). Docker: lightweight linux containers for consistent development and deployment. Linux Journal, 2014(239), 2. doi: 10.5555/2600239.2600241. + +- [Singularity](https://pubmed.ncbi.nlm.nih.gov/28494014/) + + > Kurtzer GM, Sochat V, Bauer MW. Singularity: Scientific containers for mobility of compute. PLoS One. 2017 May 11;12(5):e0177459. doi: 10.1371/journal.pone.0177459. eCollection 2017. PubMed PMID: 28494014; PubMed Central PMCID: PMC5426675. diff --git a/CODE_OF_CONDUCT.md b/CODE_OF_CONDUCT.md index 405fb1bfd..c089ec78c 100644 --- a/CODE_OF_CONDUCT.md +++ b/CODE_OF_CONDUCT.md @@ -1,46 +1,182 @@ -# Contributor Covenant Code of Conduct +# Code of Conduct at nf-core (v1.4) ## Our Pledge -In the interest of fostering an open and welcoming environment, we as contributors and maintainers pledge to making participation in our project and our community a harassment-free experience for everyone, regardless of age, body size, disability, ethnicity, gender identity and expression, level of experience, nationality, personal appearance, race, religion, or sexual identity and orientation. +In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of: -## Our Standards +- Age +- Ability +- Body size +- Caste +- Familial status +- Gender identity and expression +- Geographical location +- Level of experience +- Nationality and national origins +- Native language +- Neurodiversity +- Race or ethnicity +- Religion +- Sexual identity and orientation +- Socioeconomic status -Examples of behavior that contributes to creating a positive environment include: +Please note that the list above is alphabetised and is therefore not ranked in any order of preference or importance. -* Using welcoming and inclusive language -* Being respectful of differing viewpoints and experiences -* Gracefully accepting constructive criticism -* Focusing on what is best for the community -* Showing empathy towards other community members +## Preamble -Examples of unacceptable behavior by participants include: +:::note +This Code of Conduct (CoC) has been drafted by Renuka Kudva, Cris Tuñí, and Michael Heuer, with input from the nf-core Core Team and Susanna Marquez from the nf-core community. "We", in this document, refers to the Safety Officers and members of the nf-core Core Team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will be amended periodically to keep it up-to-date. In case of any dispute, the most current version will apply. +::: -* The use of sexualized language or imagery and unwelcome sexual attention or advances -* Trolling, insulting/derogatory comments, and personal or political attacks -* Public or private harassment -* Publishing others' private information, such as a physical or electronic address, without explicit permission -* Other conduct which could reasonably be considered inappropriate in a professional setting +An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). + +Our Safety Officers are Saba Nafees, Cris Tuñí, and Michael Heuer. + +nf-core is a young and growing community that welcomes contributions from anyone with a shared vision for [Open Science Policies](https://www.fosteropenscience.eu/taxonomy/term/8). Open science policies encompass inclusive behaviours and we strive to build and maintain a safe and inclusive environment for all individuals. + +We have therefore adopted this CoC, which we require all members of our community and attendees of nf-core events to adhere to in all our workspaces at all times. Workspaces include, but are not limited to, Slack, meetings on Zoom, gather.town, YouTube live etc. + +Our CoC will be strictly enforced and the nf-core team reserves the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities. + +We ask all members of our community to help maintain supportive and productive workspaces and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC. + +Questions, concerns, or ideas on what we can include? Contact members of the Safety Team on Slack or email safety [at] nf-co [dot] re. ## Our Responsibilities -Project maintainers are responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behavior. +Members of the Safety Team (the Safety Officers) are responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour. + +The Safety Team, in consultation with the nf-core core team, have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this CoC, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful. + +Members of the core team or the Safety Team who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and will be subject to the same actions as others in violation of the CoC. + +## When and where does this Code of Conduct apply? + +Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events, such as hackathons, workshops, bytesize, and collaborative workspaces on gather.town. These guidelines include, but are not limited to, the following (listed alphabetically and therefore in no order of preference): + +- Communicating with an official project email address. +- Communicating with community members within the nf-core Slack channel. +- Participating in hackathons organised by nf-core (both online and in-person events). +- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence, and on the nf-core gather.town workspace. +- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, gather.town, Jitsi, YouTube live etc. +- Representing nf-core on social media. This includes both official and personal accounts. + +## nf-core cares 😊 + +nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include, but are not limited to, the following (listed in alphabetical order): + +- Ask for consent before sharing another community member’s personal information (including photographs) on social media. +- Be respectful of differing viewpoints and experiences. We are all here to learn from one another and a difference in opinion can present a good learning opportunity. +- Celebrate your accomplishments! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !) +- Demonstrate empathy towards other community members. (We don’t all have the same amount of time to dedicate to nf-core. If tasks are pending, don’t hesitate to gently remind members of your team. If you are leading a task, ask for help if you feel overwhelmed.) +- Engage with and enquire after others. (This is especially important given the geographically remote nature of the nf-core community, so let’s do this the best we can) +- Focus on what is best for the team and the community. (When in doubt, ask) +- Accept feedback, yet be unafraid to question, deliberate, and learn. +- Introduce yourself to members of the community. (We’ve all been outsiders and we know that talking to strangers can be hard for some, but remember we’re interested in getting to know you and your visions for open science!) +- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communication to be kind.**) +- Take breaks when you feel like you need them. +- Use welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack) + +## nf-core frowns on 😕 + +The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this CoC. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces: + +- Deliberate intimidation, stalking or following and sustained disruption of communication among participants of the community. This includes hijacking shared screens through actions such as using the annotate tool in conferencing software such as Zoom. +- “Doxing” i.e. posting (or threatening to post) another person’s personal identifying information online. +- Spamming or trolling of individuals on social media. +- Use of sexual or discriminatory imagery, comments, jokes, or unwelcome sexual attention. +- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion, or work experience. + +### Online Trolling + +The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the risk of online trolling. This is unacceptable — reports of such behaviour will be taken very seriously and perpetrators will be excluded from activities immediately. + +All community members are **required** to ask members of the group they are working with for explicit consent prior to taking screenshots of individuals during video calls. + +## Procedures for reporting CoC violations + +If someone makes you feel uncomfortable through their behaviours or actions, report it as soon as possible. + +You can reach out to members of the Safety Team (Saba Nafees, Cris Tuñí, and Michael Heuer) on Slack. Alternatively, contact a member of the nf-core core team [nf-core core team](https://nf-co.re/about), and they will forward your concerns to the Safety Team. + +Issues directly concerning members of the Core Team or the Safety Team will be dealt with by other members of the core team and the safety manager — possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson and details will be shared in due course. -Project maintainers have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this Code of Conduct, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful. +All reports will be handled with the utmost discretion and confidentiality. -## Scope +You can also report any CoC violations to safety [at] nf-co [dot] re. In your email report, please do your best to include: -This Code of Conduct applies both within project spaces and in public spaces when an individual is representing the project or its community. Examples of representing a project or community include using an official project e-mail address, posting via an official social media account, or acting as an appointed representative at an online or offline event. Representation of a project may be further defined and clarified by project maintainers. +- Your contact information. +- Identifying information (e.g. names, nicknames, pseudonyms) of the participant who has violated the Code of Conduct. +- The behaviour that was in violation and the circumstances surrounding the incident. +- The approximate time of the behaviour (if different than the time the report was made). +- Other people involved in the incident, if applicable. +- If you believe the incident is ongoing. +- If there is a publicly available record (e.g. mailing list record, a screenshot). +- Any additional information. + +After you file a report, one or more members of our Safety Team will contact you to follow up on your report. + +## Who will read and handle reports + +All reports will be read and handled by the members of the Safety Team at nf-core. + +If members of the Safety Team are deemed to have a conflict of interest with a report, they will be required to recuse themselves as per our Code of Conduct and will not have access to any follow-ups. + +To keep this first report confidential from any of the Safety Team members, please submit your first report by direct messaging on Slack/direct email to any of the nf-core members you are comfortable disclosing the information to, and be explicit about which member(s) you do not consent to sharing the information with. + +## Reviewing reports + +After receiving the report, members of the Safety Team will review the incident report to determine whether immediate action is required, for example, whether there is immediate threat to participants’ safety. + +The Safety Team, in consultation with members of the nf-core core team, will assess the information to determine whether the report constitutes a Code of Conduct violation, for them to decide on a course of action. + +In the case of insufficient information, one or more members of the Safety Team may contact the reporter, the reportee, or any other attendees to obtain more information. + +Once additional information is gathered, the Safety Team will collectively review and decide on the best course of action to take, if any. The Safety Team reserves the right to not act on a report. + +## Confidentiality + +All reports, and any additional information included, are only shared with the team of safety officers (and possibly members of the core team, in case the safety officer is in violation of the CoC). We will respect confidentiality requests for the purpose of protecting victims of abuse. + +We will not name harassment victims, beyond discussions between the safety officer and members of the nf-core team, without the explicit consent of the individuals involved. ## Enforcement -Instances of abusive, harassing, or otherwise unacceptable behavior may be reported by contacting the project team on [Slack](https://nf-co.re/join/slack). The project team will review and investigate all complaints, and will respond in a way that it deems appropriate to the circumstances. The project team is obligated to maintain confidentiality with regard to the reporter of an incident. Further details of specific enforcement policies may be posted separately. +Actions taken by the nf-core’s Safety Team may include, but are not limited to: + +- Asking anyone to stop a behaviour. +- Asking anyone to leave the event and online spaces either temporarily, for the remainder of the event, or permanently. +- Removing access to the gather.town and Slack, either temporarily or permanently. +- Communicating to all participants to reinforce our expectations for conduct and remind what is unacceptable behaviour; this may be public for practical reasons. +- Communicating to all participants that an incident has taken place and how we will act or have acted — this may be for the purpose of letting event participants know we are aware of and dealing with the incident. +- Banning anyone from participating in nf-core-managed spaces, future events, and activities, either temporarily or permanently. +- No action. + +## Attribution and Acknowledgements + +- The [Contributor Covenant, version 1.4](http://contributor-covenant.org/version/1/4) +- The [OpenCon 2017 Code of Conduct](http://www.opencon2017.org/code_of_conduct) (CC BY 4.0 OpenCon organisers, SPARC and Right to Research Coalition) +- The [eLife innovation sprint 2020 Code of Conduct](https://sprint.elifesciences.org/code-of-conduct/) +- The [Mozilla Community Participation Guidelines v3.1](https://www.mozilla.org/en-US/about/governance/policies/participation/) (version 3.1, CC BY-SA 3.0 Mozilla) + +## Changelog + +### v1.4 - February 8th, 2022 + +- Included a new member of the Safety Team. Corrected a typographical error in the text. + +### v1.3 - December 10th, 2021 + +- Added a statement that the CoC applies to nf-core gather.town workspaces. Corrected typographical errors in the text. + +### v1.2 - November 12th, 2021 + +- Removed information specific to reporting CoC violations at the Hackathon in October 2021. -Project maintainers who do not follow or enforce the Code of Conduct in good faith may face temporary or permanent repercussions as determined by other members of the project's leadership. +### v1.1 - October 14th, 2021 -## Attribution +- Updated with names of new Safety Officers and specific information for the hackathon in October 2021. -This Code of Conduct is adapted from the [Contributor Covenant][homepage], version 1.4, available at [https://www.contributor-covenant.org/version/1/4/code-of-conduct/][version] +### v1.0 - March 15th, 2021 -[homepage]: https://contributor-covenant.org -[version]: https://www.contributor-covenant.org/version/1/4/code-of-conduct/ +- Complete rewrite from original [Contributor Covenant](http://contributor-covenant.org/) CoC. diff --git a/Dockerfile b/Dockerfile deleted file mode 100644 index dc5a06ba1..000000000 --- a/Dockerfile +++ /dev/null @@ -1,17 +0,0 @@ -FROM nfcore/base:1.12 -LABEL authors="Barry Digby" \ - description="Docker image containing all software requirements for the nf-core/circrna pipeline" - -# Install the conda environment -COPY environment.yml / -RUN conda env create --quiet -f /environment.yml && conda clean -a - -# Add conda installation dir to PATH (instead of doing 'conda activate') -ENV PATH /opt/conda/envs/nf-core-circrna-1.0dev/bin:$PATH - -# Dump the details of the installed packages to a file for posterity -RUN conda env export --name nf-core-circrna-1.0dev > nf-core-circrna-1.0dev.yml - -# Instruct R processes to use these empty files instead of clashing with a local version -RUN touch .Rprofile -RUN touch .Renviron diff --git a/LICENSE b/LICENSE index cbdceadbf..dde382156 100644 --- a/LICENSE +++ b/LICENSE @@ -1,6 +1,6 @@ MIT License -Copyright (c) Barry Digby +Copyright (c) The nf-core/circrna team Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal diff --git a/README.md b/README.md index 9b4f851b5..756ce93dc 100644 --- a/README.md +++ b/README.md @@ -1,52 +1,140 @@ -# ![nf-core/circrna](docs/images/nf-core-circrna_logo.png) +

+ + + nf-core/circrna + +

[![GitHub Actions CI Status](https://github.com/nf-core/circrna/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/circrna/actions/workflows/ci.yml) +[![GitHub Actions Linting Status](https://github.com/nf-core/circrna/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/circrna/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/circrna/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) +[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com) + +[![GitHub Actions CI Status](https://github.com/nf-core/circrna/workflows/nf-core%20CI/badge.svg)](https://github.com/nf-core/circrna/actions?query=workflow%3A%22nf-core+CI%22) +[![GitHub Actions Linting Status](https://github.com/nf-core/circrna/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/circrna/actions?query=workflow%3A%22nf-core+linting%22)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/circrna/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) + +[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/) +[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) +[![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) +[![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) +[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/circrna) + +[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23circrna-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/circrna)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core) -**workflow for the quantification, differential expression analysis and miRNA target prediction analysis of circRNAs in RNA-Seq data**. +## Introduction -[![GitHub Actions CI Status](https://github.com/nf-core/circrna/workflows/nf-core%20CI/badge.svg)](https://github.com/nf-core/circrna/actions) -[![GitHub Actions Linting Status](https://github.com/nf-core/circrna/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/circrna/actions) -[![Nextflow](https://img.shields.io/badge/nextflow-%E2%89%A520.04.0-brightgreen.svg)](https://www.nextflow.io/) +**nf-core/circrna** is a bioinformatics pipeline to analyse total RNA sequencing data obtained from organisms with a reference genome and annotation. It takes a samplesheet and FASTQ files as input, performs quality control (QC), trimming, back-splice junction (BSJ) detection, annotation, quantification and miRNA target prediction of circular RNAs. -[![install with bioconda](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg)](https://bioconda.github.io/) -[![Docker](https://img.shields.io/docker/automated/nfcore/circrna.svg)](https://hub.docker.com/r/nfcore/circrna) -[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23circrna-4A154B?logo=slack)](https://nfcore.slack.com/channels/circrna) +The pipeline is still under development, but the BSJ detection and quantification steps are already implemented and functional. The following features are planned to be implemented soon: -## Introduction +- Isoform-level circRNA detection and quantification +- circRNA-miRNA interaction analysis using [SPONGE](https://doi.org/10.1093/bioinformatics/btz314) and [spongEffects](https://doi.org/10.1093/bioinformatics/btad276) +- Improved downstream analyses + +If you want to contribute, feel free to create an issue or pull request on the [GitHub repository](https://github.com/nf-core/circrna) or join the [Slack channel](https://nf-co.re/join/slack). + +## Pipeline summary + +![Metro Map](./docs/images/metro-map.png) + +- Raw read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/)) +- Adapter trimming ([`Trim Galore!`](https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/)) +- BSJ detection + - [`CIRIquant`](https://github.com/Kevinzjy/CIRIquant) + - [`STAR 2-Pass mode`](https://github.com/alexdobin/STAR) + - [`CIRCexplorer2`](https://circexplorer2.readthedocs.io/en/latest/) + - [`circRNA finder`](https://github.com/orzechoj/circRNA_finder) + - [`DCC`](https://github.com/dieterich-lab/DCC) + - [`find circ`](https://github.com/marvin-jens/find_circ) + - [`MapSplice`](http://www.netlab.uky.edu/p/bioinfo/MapSplice2) + - [`Segemehl`](https://www.bioinf.uni-leipzig.de/Software/segemehl/) +- circRNA annotation + - Based on a GTF file + - Based on database files (if provided) +- Extract circRNA sequences and build circular transcriptome +- Merge circular transcriptome with linear transcriptome derived from provided GTF +- Quantification of combined circular and linear transcriptome + - [`psirc-quant`](https://github.com/Christina-hshi/psirc) +- miRNA binding affinity analysis (only if the `mature` parameter is provided) + - Normalizes miRNA expression (only if the `mirna_expression` parameter is provided) + - Binding site prediction + - [`miRanda`](http://cbio.mskcc.org/miRNA2003/miranda.html) + - [`TargetScan`](http://www.targetscan.org/cgi-bin/targetscan/data_download.vert72.cgi) + - Perform majority vote on binding sites + - Compute correlations between miRNA and transcript expression levels (only if the `mirna_expression` parameter is provided) +- Statistical tests (only if the `phenotype` parameter is provided) + - [`CircTest`](https://github.com/dieterich-lab/CircTest) +- MultiQC report [`MultiQC`](http://multiqc.info/) + +## Usage + +> [!NOTE] +> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow.Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data. -The pipeline is built using [Nextflow](https://www.nextflow.io), a workflow tool to run tasks across multiple compute infrastructures in a very portable manner. It comes with docker containers making installation trivial and results highly reproducible. +First, prepare a samplesheet with your input data that looks as follows: -## Quick Start +```csv title="samplesheet.csv" +sample,fastq_1,fastq_2 +CONTROL,CONTROL_R1.fastq.gz,CONTROL_R2.fastq.gz +TREATMENT,TREATMENT_R1.fastq.gz,TREATMENT_R2.fastq.gz +``` -1. Install [`nextflow`](https://nf-co.re/usage/installation) +Each row represents a fastq file (single-end) or a pair of fastq files (paired end). -2. Install any of [`Docker`](https://docs.docker.com/engine/installation/), [`Singularity`](https://www.sylabs.io/guides/3.0/user-guide/) or [`Podman`](https://podman.io/) for full pipeline reproducibility _(please only use [`Conda`](https://conda.io/miniconda.html) as a last resort; see [docs](https://nf-co.re/usage/configuration#basic-configuration-profiles))_ +Now, you can run the pipeline using: -3. Download the pipeline and test it on a minimal dataset with a single command: +```bash +nextflow run nf-core/circrna \ + -profile \ + --input samplesheet.csv \ + --outdir +``` - ```bash - nextflow run nf-core/circrna -profile test, - ``` +> [!WARNING] +> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; +> see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). - > Please check [nf-core/configs](https://github.com/nf-core/configs#documentation) to see if a custom config file to run nf-core pipelines already exists for your Institute. If so, you can simply use `-profile ` in your command. This will enable either `docker` or `singularity` and set the appropriate execution settings for your local compute environment. +For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/circrna/usage) and the [parameter documentation](https://nf-co.re/circrna/parameters). -4. Start running your own analysis! +## Pipeline output - +To see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/circrna/results) tab on the nf-core website pipeline page. +For more details about the output files and reports, please refer to the +[output documentation](https://nf-co.re/circrna/output). - ```bash - nextflow run nf-core/circrna -profile --input '*_R{1,2}.fastq.gz' --genome GRCh37 - ``` +```bash +nextflow run nf-core/circrna \ + -profile \ + --input samplesheet.csv \ + --outdir +``` -See [usage docs](https://nf-co.re/circrna/usage) for all of the available options when running the pipeline. +> [!WARNING] +> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files). -## Documentation +For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/circrna/usage) and the [parameter documentation](https://nf-co.re/circrna/parameters). -The nf-core/circrna pipeline comes with documentation about the pipeline: [usage](https://nf-co.re/circrna/usage) and [output](https://nf-co.re/circrna/output). +## Pipeline output - +To see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/circrna/results) tab on the nf-core website pipeline page. +For more details about the output files and reports, please refer to the +[output documentation](https://nf-co.re/circrna/output). ## Credits -nf-core/circrna was originally written by Barry Digby. +nf-core/circrna was originally written by [Barry Digby](https://github.com/BarryDigby). +It was later refactored, extended and improved by [Nico Trummer](https://github.com/nictru). + +We thank the following people for their extensive assistance in the development of this pipeline (in alphabetical order): + +- [Alexander Peltzer](https://github.com/apeltzer) +- [Ben Whittle](https://github.com/bj-w) +- [Kevin Menden](https://github.com/KevinMenden) +- [Malte Weyrich](https://github.com/mweyrich28) +- [Marieke Vromman](https://github.com/MariekeVromman) +- [Maxime Garcia](https://github.com/maxulysse) +- [Phil Ewels](https://github.com/ewels) + +## Acknowledgements + +![SFI](./docs/images/Genomics-Data-Science-original.png) ## Contributions and Support @@ -54,10 +142,19 @@ If you would like to contribute to this pipeline, please see the [contributing g For further information or help, don't hesitate to get in touch on the [Slack `#circrna` channel](https://nfcore.slack.com/channels/circrna) (you can join with [this invite](https://nf-co.re/join/slack)). -## Citation +## Citations + + + + +> **nf-core/circrna: a portable workflow for the quantification, miRNA target prediction and differential expression analysis of circular RNAs.** +> +> Barry Digby, Stephen P. Finn, & Pilib Ó Broin +> +> [BMC Bioinformatics 24, 27 (2023)](https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-022-05125-8) +> doi: [10.1186/s12859-022-05125-8](https://doi.org/10.1186/s12859-022-05125-8) - - +An extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file. You can cite the `nf-core` publication as follows: @@ -66,4 +163,3 @@ You can cite the `nf-core` publication as follows: > Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen. > > _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x). -> ReadCube: [Full Access Link](https://rdcu.be/b1GjZ) diff --git a/assets/adaptivecard.json b/assets/adaptivecard.json new file mode 100644 index 000000000..6699adff5 --- /dev/null +++ b/assets/adaptivecard.json @@ -0,0 +1,67 @@ +{ + "type": "message", + "attachments": [ + { + "contentType": "application/vnd.microsoft.card.adaptive", + "contentUrl": null, + "content": { + "\$schema": "http://adaptivecards.io/schemas/adaptive-card.json", + "msteams": { + "width": "Full" + }, + "type": "AdaptiveCard", + "version": "1.2", + "body": [ + { + "type": "TextBlock", + "size": "Large", + "weight": "Bolder", + "color": "<% if (success) { %>Good<% } else { %>Attention<%} %>", + "text": "nf-core/circrna v${version} - ${runName}", + "wrap": true + }, + { + "type": "TextBlock", + "spacing": "None", + "text": "Completed at ${dateComplete} (duration: ${duration})", + "isSubtle": true, + "wrap": true + }, + { + "type": "TextBlock", + "text": "<% if (success) { %>Pipeline completed successfully!<% } else { %>Pipeline completed with errors. The full error message was: ${errorReport}.<% } %>", + "wrap": true + }, + { + "type": "TextBlock", + "text": "The command used to launch the workflow was as follows:", + "wrap": true + }, + { + "type": "TextBlock", + "text": "${commandLine}", + "isSubtle": true, + "wrap": true + } + ], + "actions": [ + { + "type": "Action.ShowCard", + "title": "Pipeline Configuration", + "card": { + "type": "AdaptiveCard", + "\$schema": "http://adaptivecards.io/schemas/adaptive-card.json", + "body": [ + { + "type": "FactSet", + "facts": [<% out << summary.collect{ k,v -> "{\"title\": \"$k\", \"value\" : \"$v\"}"}.join(",\n") %> + ] + } + ] + } + } + ] + } + } + ] +} diff --git a/assets/email_template.html b/assets/email_template.html index 819a0bbab..ddd621265 100644 --- a/assets/email_template.html +++ b/assets/email_template.html @@ -1,11 +1,10 @@ - - + nf-core/circrna Pipeline Report @@ -13,7 +12,7 @@ -

nf-core/circrna v${version}

+

nf-core/circrna ${version}

Run Name: $runName

<% if (!success){ diff --git a/assets/email_template.txt b/assets/email_template.txt index 0afdc877f..927b5b6a4 100644 --- a/assets/email_template.txt +++ b/assets/email_template.txt @@ -4,9 +4,8 @@ |\\ | |__ __ / ` / \\ |__) |__ } { | \\| | \\__, \\__/ | \\ |___ \\`-._,-`-, `._,._,' - nf-core/circrna v${version} + nf-core/circrna ${version} ---------------------------------------------------- - Run Name: $runName <% if (success){ diff --git a/assets/methods_description_template.yml b/assets/methods_description_template.yml new file mode 100644 index 000000000..3affe6b57 --- /dev/null +++ b/assets/methods_description_template.yml @@ -0,0 +1,29 @@ +id: "nf-core-circrna-methods-description" +description: "Suggested text and references to use when describing pipeline usage within the methods section of a publication." +section_name: "nf-core/circrna Methods Description" +section_href: "https://github.com/nf-core/circrna" +plot_type: "html" +## TODO nf-core: Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline +## You inject any metadata in the Nextflow '${workflow}' object +data: | +

Methods

+

Data was processed using nf-core/circrna v${workflow.manifest.version} ${doi_text} of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

+

The pipeline was executed with Nextflow v${workflow.nextflow.version} (Di Tommaso et al., 2017) with the following command:

+
${workflow.commandLine}
+

${tool_citations}

+

References

+
    +
  • Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
  • +
  • Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
  • +
  • Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
  • +
  • da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192
  • + ${tool_bibliography} +
+
+
Notes:
+
    + ${nodoi_text} +
  • The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
  • +
  • You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.
  • +
+
diff --git a/assets/multiqc_config.yaml b/assets/multiqc_config.yaml deleted file mode 100644 index 73b9fa7df..000000000 --- a/assets/multiqc_config.yaml +++ /dev/null @@ -1,11 +0,0 @@ -report_comment: > - This report has been generated by the nf-core/circrna - analysis pipeline. For information about how to interpret these results, please see the - documentation. -report_section_order: - software_versions: - order: -1000 - nf-core-circrna-summary: - order: -1001 - -export_plots: true diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml new file mode 100644 index 000000000..570f6c0dc --- /dev/null +++ b/assets/multiqc_config.yml @@ -0,0 +1,15 @@ +report_comment: > + This report has been generated by the nf-core/circrna + analysis pipeline. For information about how to interpret these results, please see the + documentation. +report_section_order: + "nf-core-circrna-methods-description": + order: -1000 + software_versions: + order: -1001 + "nf-core-circrna-summary": + order: -1002 + +export_plots: true + +disable_version_detection: true diff --git a/assets/nf-core-circrna_logo.png b/assets/nf-core-circrna_logo.png deleted file mode 100644 index 107792856..000000000 Binary files a/assets/nf-core-circrna_logo.png and /dev/null differ diff --git a/assets/nf-core-circrna_logo_light.png b/assets/nf-core-circrna_logo_light.png new file mode 100644 index 000000000..85a200b32 Binary files /dev/null and b/assets/nf-core-circrna_logo_light.png differ diff --git a/assets/samplesheet.csv b/assets/samplesheet.csv new file mode 100644 index 000000000..8d222a80e --- /dev/null +++ b/assets/samplesheet.csv @@ -0,0 +1,3 @@ +sample,fastq_1,fastq_2,strandedness +SAMPLE_PAIRED_END,/path/to/fastq/files/AEG588A1_S1_L002_R1_001.fastq.gz,/path/to/fastq/files/AEG588A1_S1_L002_R2_001.fastq.gz,forward +SAMPLE_SINGLE_END,/path/to/fastq/files/AEG588A4_S4_L003_R1_001.fastq.gz,,auto diff --git a/assets/schema_annotation.json b/assets/schema_annotation.json new file mode 100644 index 000000000..eb13a7b6a --- /dev/null +++ b/assets/schema_annotation.json @@ -0,0 +1,34 @@ +{ + "$schema": "https://json-schema.org/draft/2020-12/schema", + "$id": "https://raw.githubusercontent.com/nf-core/circrna/master/assets/schema_annotation.json", + "title": "nf-core/circrna pipeline - params.annotation schema", + "description": "Schema for the file provided with params.annotation", + "type": "array", + "items": { + "type": "object", + "properties": { + "name": { + "type": "string", + "pattern": "^\\S+$", + "errorMessage": "Annotation file name must be provided and cannot contain spaces", + "meta": ["id"] + }, + "file": { + "type": "string", + "format": "file-path", + "exists": true, + "pattern": "^\\S+\\.bed$", + "errorMessage": "Annotation file must be provided and must be a BED file" + }, + "min_overlap": { + "type": "number", + "minimum": 0, + "maximum": 1, + "default": 0.9, + "errorMessage": "Minimum overlap must be a number between 0 and 1", + "meta": ["min_overlap"] + } + }, + "required": ["name", "file"] + } +} diff --git a/assets/schema_input.json b/assets/schema_input.json new file mode 100644 index 000000000..8d288c210 --- /dev/null +++ b/assets/schema_input.json @@ -0,0 +1,40 @@ +{ + "$schema": "https://json-schema.org/draft/2020-12/schema", + "$id": "https://raw.githubusercontent.com/nf-core/circrna/master/assets/schema_input.json", + "title": "nf-core/circrna pipeline - params.input schema", + "description": "Schema for the file provided with params.input", + "type": "array", + "items": { + "type": "object", + "properties": { + "sample": { + "type": "string", + "pattern": "^\\S+$", + "errorMessage": "Sample name must be provided and cannot contain spaces", + "meta": ["id"] + }, + "fastq_1": { + "type": "string", + "format": "file-path", + "exists": true, + "pattern": "^\\S+\\.f(ast)?q\\.gz$", + "errorMessage": "FastQ file for reads 1 must be provided, cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'" + }, + "fastq_2": { + "type": "string", + "format": "file-path", + "exists": true, + "pattern": "^\\S+\\.f(ast)?q\\.gz$", + "errorMessage": "FastQ file for reads 2 cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'" + }, + "strandedness": { + "type": "string", + "enum": ["unstranded", "forward", "reverse", "auto"], + "default": "auto", + "errorMessage": "Strandedness must be one of 'unstranded', 'forward', 'reverse' or 'auto'", + "meta": ["strandedness"] + } + }, + "required": ["sample", "fastq_1"] + } +} diff --git a/assets/schema_phenotype.json b/assets/schema_phenotype.json new file mode 100644 index 000000000..2d6a00b88 --- /dev/null +++ b/assets/schema_phenotype.json @@ -0,0 +1,23 @@ +{ + "$schema": "https://json-schema.org/draft/2020-12/schema", + "$id": "https://raw.githubusercontent.com/nf-core/circrna/master/assets/schema_phenotype.json", + "title": "nf-core/circrna pipeline - params.phenotype schema", + "description": "Schema for the file provided with params.phenotype", + "type": "array", + "items": { + "type": "object", + "properties": { + "sample": { + "type": "string", + "pattern": "^\\S+$", + "errorMessage": "Sample name must be provided and cannot contain spaces" + }, + "condition": { + "type": "string", + "pattern": "^\\S+$", + "errorMessage": "Condition name must be provided and cannot contain spaces" + } + }, + "required": ["sample", "condition"] + } +} diff --git a/assets/sendmail_template.txt b/assets/sendmail_template.txt index 4192b24f9..ff560db3b 100644 --- a/assets/sendmail_template.txt +++ b/assets/sendmail_template.txt @@ -12,18 +12,18 @@ $email_html Content-Type: image/png;name="nf-core-circrna_logo.png" Content-Transfer-Encoding: base64 Content-ID: -Content-Disposition: inline; filename="nf-core-circrna_logo.png" +Content-Disposition: inline; filename="nf-core-circrna_logo_light.png" -<% out << new File("$projectDir/assets/nf-core-circrna_logo.png"). - bytes. - encodeBase64(). - toString(). - tokenize( '\n' )*. - toList()*. - collate( 76 )*. - collect { it.join() }. - flatten(). - join( '\n' ) %> +<% out << new File("$projectDir/assets/nf-core-circrna_logo_light.png"). + bytes. + encodeBase64(). + toString(). + tokenize( '\n' )*. + toList()*. + collate( 76 )*. + collect { it.join() }. + flatten(). + join( '\n' ) %> <% if (mqcFile){ @@ -37,15 +37,15 @@ Content-ID: Content-Disposition: attachment; filename=\"${mqcFileObj.getName()}\" ${mqcFileObj. - bytes. - encodeBase64(). - toString(). - tokenize( '\n' )*. - toList()*. - collate( 76 )*. - collect { it.join() }. - flatten(). - join( '\n' )} + bytes. + encodeBase64(). + toString(). + tokenize( '\n' )*. + toList()*. + collate( 76 )*. + collect { it.join() }. + flatten(). + join( '\n' )} """ }} %> diff --git a/assets/slackreport.json b/assets/slackreport.json new file mode 100644 index 000000000..aa9256200 --- /dev/null +++ b/assets/slackreport.json @@ -0,0 +1,34 @@ +{ + "attachments": [ + { + "fallback": "Plain-text summary of the attachment.", + "color": "<% if (success) { %>good<% } else { %>danger<%} %>", + "author_name": "nf-core/circrna ${version} - ${runName}", + "author_icon": "https://www.nextflow.io/docs/latest/_static/favicon.ico", + "text": "<% if (success) { %>Pipeline completed successfully!<% } else { %>Pipeline completed with errors<% } %>", + "fields": [ + { + "title": "Command used to launch the workflow", + "value": "```${commandLine}```", + "short": false + } + <% + if (!success) { %> + , + { + "title": "Full error message", + "value": "```${errorReport}```", + "short": false + }, + { + "title": "Pipeline configuration", + "value": "<% out << summary.collect{ k,v -> k == "hook_url" ? "_${k}_: (_hidden_)" : ( ( v.class.toString().contains('Path') || ( v.class.toString().contains('String') && v.contains('/') ) ) ? "_${k}_: `${v}`" : (v.class.toString().contains('DateTime') ? ("_${k}_: " + v.format(java.time.format.DateTimeFormatter.ofLocalizedDateTime(java.time.format.FormatStyle.MEDIUM))) : "_${k}_: ${v}") ) }.join(",\n") %>", + "short": false + } + <% } + %> + ], + "footer": "Completed at <% out << dateComplete.format(java.time.format.DateTimeFormatter.ofLocalizedDateTime(java.time.format.FormatStyle.MEDIUM)) %> (duration: ${duration})" + } + ] +} diff --git a/bin/markdown_to_html.py b/bin/markdown_to_html.py deleted file mode 100755 index a26d1ff5e..000000000 --- a/bin/markdown_to_html.py +++ /dev/null @@ -1,91 +0,0 @@ -#!/usr/bin/env python -from __future__ import print_function -import argparse -import markdown -import os -import sys -import io - - -def convert_markdown(in_fn): - input_md = io.open(in_fn, mode="r", encoding="utf-8").read() - html = markdown.markdown( - "[TOC]\n" + input_md, - extensions=["pymdownx.extra", "pymdownx.b64", "pymdownx.highlight", "pymdownx.emoji", "pymdownx.tilde", "toc"], - extension_configs={ - "pymdownx.b64": {"base_path": os.path.dirname(in_fn)}, - "pymdownx.highlight": {"noclasses": True}, - "toc": {"title": "Table of Contents"}, - }, - ) - return html - - -def wrap_html(contents): - header = """ - - - - - -
- """ - footer = """ -
- - - """ - return header + contents + footer - - -def parse_args(args=None): - parser = argparse.ArgumentParser() - parser.add_argument("mdfile", type=argparse.FileType("r"), nargs="?", help="File to convert. Defaults to stdin.") - parser.add_argument( - "-o", "--out", type=argparse.FileType("w"), default=sys.stdout, help="Output file name. Defaults to stdout." - ) - return parser.parse_args(args) - - -def main(args=None): - args = parse_args(args) - converted_md = convert_markdown(args.mdfile.name) - html = wrap_html(converted_md) - args.out.write(html) - - -if __name__ == "__main__": - sys.exit(main()) diff --git a/bin/scrape_software_versions.py b/bin/scrape_software_versions.py deleted file mode 100755 index ab1638f90..000000000 --- a/bin/scrape_software_versions.py +++ /dev/null @@ -1,54 +0,0 @@ -#!/usr/bin/env python -from __future__ import print_function -from collections import OrderedDict -import re - -# TODO nf-core: Add additional regexes for new tools in process get_software_versions -regexes = { - "nf-core/circrna": ["v_pipeline.txt", r"(\S+)"], - "Nextflow": ["v_nextflow.txt", r"(\S+)"], - "FastQC": ["v_fastqc.txt", r"FastQC v(\S+)"], - "MultiQC": ["v_multiqc.txt", r"multiqc, version (\S+)"], -} -results = OrderedDict() -results["nf-core/circrna"] = 'N/A' -results["Nextflow"] = 'N/A' -results["FastQC"] = 'N/A' -results["MultiQC"] = 'N/A' - -# Search each file using its regex -for k, v in regexes.items(): - try: - with open(v[0]) as x: - versions = x.read() - match = re.search(v[1], versions) - if match: - results[k] = "v{}".format(match.group(1)) - except IOError: - results[k] = False - -# Remove software set to false in results -for k in list(results): - if not results[k]: - del results[k] - -# Dump to YAML -print( - """ -id: 'software_versions' -section_name: 'nf-core/circrna Software Versions' -section_href: 'https://github.com/nf-core/circrna' -plot_type: 'html' -description: 'are collected at run time from the software output.' -data: | -
-""" -) -for k, v in results.items(): - print("
{}
{}
".format(k, v)) -print("
") - -# Write out regexes as csv file: -with open("software_versions.csv", "w") as f: - for k, v in results.items(): - f.write("{}\t{}\n".format(k, v)) diff --git a/bin/targetscan_format.sh b/bin/targetscan_format.sh new file mode 100755 index 000000000..9321221bb --- /dev/null +++ b/bin/targetscan_format.sh @@ -0,0 +1,44 @@ +#!/usr/bin/env bash + +## Author: Barry Digby +## License: MIT + +## Script that converts miRbase (mature.fa) file to +## TargetScan compatability. The motivation for doing +## this is the mature.fa file contains many more +## species than TargetScans miR_Family_Info.txt file. + +## Stragtegy is simply to output a 3 column tab delim +## text file containing: +## 1. miR ID +## 2. miR (7bp) seed sequence from mature seq +## 3. Species ID (set to 0000, not important for output). + +## Subset mature.fa according to the species provided by user to '--genome'. + +## Stage input mature.fa file, species +MATURE="$1" + +## Uncompress if necessary +if [ ${MATURE: -3} == ".gz" ]; then + gunzip -f $MATURE + MATURE=${MATURE%%.gz} +fi + +## Convert to TargetScan +## Isolate the sequences +grep -v ">" $MATURE > mature_sequence +## Extract seed sequence (7bp after 1st) +awk '{print substr($1, 2, 7)}' mature_sequence > seed_sequence +## Isolate ID (awk last field (NF)) +grep ">" $MATURE | awk -F ' ' '{print $NF}' > miR_ID +## Combine +paste miR_ID seed_sequence > targetscan_tmp.txt +## Correct delimiter, add dummy species +awk -v OFS="\t" '{print $1, $2, "0000"}' targetscan_tmp.txt > mature.txt + +## Tidy the work dir (comment these for debugging scratch dirs) +rm -rf mature_sequence +rm -rf miR_ID +rm -rf targetscan_tmp.txt +rm -rf seed_sequence diff --git a/conf/base.config b/conf/base.config index e109c8157..bfdae91bd 100644 --- a/conf/base.config +++ b/conf/base.config @@ -1,51 +1,61 @@ /* - * ------------------------------------------------- - * nf-core/circrna Nextflow base config file - * ------------------------------------------------- - * A 'blank slate' config file, appropriate for general - * use on most high performace compute environments. - * Assumes that all software is installed and available - * on the PATH. Runs in `local` mode - all jobs will be - * run on the logged in environment. - */ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + nf-core/circrna Nextflow base config file +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + A 'blank slate' config file, appropriate for general use on most high performance + compute environments. Assumes that all software is installed and available on + the PATH. Runs in `local` mode - all jobs will be run on the logged in environment. +---------------------------------------------------------------------------------------- +*/ process { - // TODO nf-core: Check the defaults for all processes - cpus = { check_max( 1 * task.attempt, 'cpus' ) } - memory = { check_max( 7.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + // TODO nf-core: Check the defaults for all processes + cpus = { 1 * task.attempt } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } - errorStrategy = { task.exitStatus in [143,137,104,134,139] ? 'retry' : 'finish' } - maxRetries = 1 - maxErrors = '-1' + errorStrategy = { task.exitStatus in ((130..145) + 104) ? 'retry' : 'finish' } + maxRetries = 1 + maxErrors = '-1' - // Process-specific resource requirements - // NOTE - Only one of the labels below are used in the fastqc process in the main script. - // If possible, it would be nice to keep the same label naming convention when - // adding in your processes. - // TODO nf-core: Customise requirements for specific processes. - // See https://www.nextflow.io/docs/latest/config.html#config-process-selectors - withLabel:process_low { - cpus = { check_max( 2 * task.attempt, 'cpus' ) } - memory = { check_max( 14.GB * task.attempt, 'memory' ) } - time = { check_max( 6.h * task.attempt, 'time' ) } - } - withLabel:process_medium { - cpus = { check_max( 6 * task.attempt, 'cpus' ) } - memory = { check_max( 42.GB * task.attempt, 'memory' ) } - time = { check_max( 8.h * task.attempt, 'time' ) } - } - withLabel:process_high { - cpus = { check_max( 12 * task.attempt, 'cpus' ) } - memory = { check_max( 84.GB * task.attempt, 'memory' ) } - time = { check_max( 10.h * task.attempt, 'time' ) } - } - withLabel:process_long { - time = { check_max( 20.h * task.attempt, 'time' ) } - } - withName:get_software_versions { - cache = false - } - + // Process-specific resource requirements + // NOTE - Please try and reuse the labels below as much as possible. + // These labels are used and recognised by default in DSL2 files hosted on nf-core/modules. + // If possible, it would be nice to keep the same label naming convention when + // adding in your local modules too. + // See https://www.nextflow.io/docs/latest/config.html#config-process-selectors + withLabel:process_single { + cpus = { 1 } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } + } + withLabel:process_low { + cpus = { 2 * task.attempt } + memory = { 12.GB * task.attempt } + time = { 4.h * task.attempt } + } + withLabel:process_medium { + cpus = { 6 * task.attempt } + memory = { 36.GB * task.attempt } + time = { 8.h * task.attempt } + } + withLabel:process_high { + cpus = { 12 * task.attempt } + memory = { 72.GB * task.attempt } + time = { 16.h * task.attempt } + } + withLabel:process_long { + time = { 20.h * task.attempt } + } + withLabel:process_high_memory { + memory = { 200.GB * task.attempt } + } + withLabel:error_ignore { + errorStrategy = 'ignore' + } + withLabel:error_retry { + errorStrategy = 'retry' + maxRetries = 2 + } } diff --git a/conf/full.config b/conf/full.config new file mode 100644 index 000000000..0c6aa64b5 --- /dev/null +++ b/conf/full.config @@ -0,0 +1,17 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config for full-size tests +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Defines parameters so that mimimal tests are converted to full size pipeline test. + + Use as follows: + nextflow run nf-core/circrna -profile test,full, --outdir + nextflow run nf-core/circrna -profile test_igenomes,full, --outdir + +---------------------------------------------------------------------------------------- +*/ + +params { + tools = 'circexplorer2,ciriquant,find_circ,circrna_finder,mapsplice,dcc,segemehl' + min_tools = 2 +} diff --git a/conf/igenomes.config b/conf/igenomes.config index caeafceb2..ab2b7f045 100644 --- a/conf/igenomes.config +++ b/conf/igenomes.config @@ -1,421 +1,519 @@ /* - * ------------------------------------------------- - * Nextflow config file for iGenomes paths - * ------------------------------------------------- - * Defines reference genomes, using iGenome paths - * Can be used by any config that customises the base - * path using $params.igenomes_base / --igenomes_base - */ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for iGenomes paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Defines reference genomes using iGenome paths. + Can be used by any config that customises the base path using: + $params.igenomes_base / --igenomes_base +---------------------------------------------------------------------------------------- +*/ params { - // illumina iGenomes reference file paths - genomes { - 'GRCh37' { - fasta = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/README.txt" - mito_name = "MT" - macs_gsize = "2.7e9" - blacklist = "${baseDir}/assets/blacklists/GRCh37-blacklist.bed" + // illumina iGenomes reference file paths + genomes { + 'GRCh37' { + fasta = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "hsa" + } + 'GRCh38' { + fasta = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "hsa" + } + 'CHM13' { + fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/BWAIndex/" + bwamem2 = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/BWAmem2Index/" + gtf = "${params.igenomes_base}/Homo_sapiens/NCBI/CHM13/Annotation/Genes/genes.gtf" + gff = "ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/009/914/755/GCF_009914755.1_T2T-CHM13v2.0/GCF_009914755.1_T2T-CHM13v2.0_genomic.gff.gz" + mito_name = "chrM" + } + 'CHM13' { + fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/BWAIndex/" + bwamem2 = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/BWAmem2Index/" + gtf = "${params.igenomes_base}/Homo_sapiens/NCBI/CHM13/Annotation/Genes/genes.gtf" + gff = "ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/009/914/755/GCF_009914755.1_T2T-CHM13v2.0/GCF_009914755.1_T2T-CHM13v2.0_genomic.gff.gz" + mito_name = "chrM" + } + 'GRCm38' { + fasta = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "hsa" + } + 'TAIR10' { + fasta = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/SmallRNA/mature.fa" + mito_name = "Mt" + species_id = "ath" + } + 'EB2' { + fasta = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/SmallRNA/mature.fa" + species_id = "bsu" + } + 'UMD3.1' { + fasta = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "bta" + } + 'WBcel235' { + fasta = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/SmallRNA/mature.fa" + mito_name = "MtDNA" + species_id = "cel" + } + 'CanFam3.1' { + fasta = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "cfa" + } + 'GRCz10' { + fasta = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "dre" + } + 'BDGP6' { + fasta = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Annotation/SmallRNA/mature.fa" + mito_name = "M" + species_id = "dme" + } + 'EquCab2' { + fasta = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "eca" + } + 'EB1' { + fasta = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/SmallRNA/mature.fa" + species_id = "eco" + } + 'Galgal4' { + fasta = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "gga" + } + 'Gm01' { + fasta = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/SmallRNA/mature.fa" + species_id = "gmx" + } + 'Mmul_1' { + fasta = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "mml" + } + 'IRGSP-1.0' { + fasta = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Annotation/SmallRNA/mature.fa" + mito_name = "Mt" + species_id = "osa" + } + 'CHIMP2.1.4' { + fasta = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "ptr" + } + 'Rnor_5.0' { + fasta = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "rno" + } + 'Rnor_6.0' { + fasta = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "rno" + } + 'R64-1-1' { + fasta = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "sce" + } + 'EF2' { + fasta = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "spo" + } + 'Sbi1' { + fasta = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/SmallRNA/mature.fa" + species_id = "sbi" + } + 'Sscrofa10.2' { + fasta = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/SmallRNA/mature.fa" + mito_name = "MT" + species_id = "ssc" + } + 'AGPv3' { + fasta = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Annotation/SmallRNA/mature.fa" + mito_name = "Mt" + species_id = "zma" + } + 'hg38' { + fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "hsa" + } + 'hg19' { + fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "hsa" + } + 'mm10' { + fasta = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "mmu" + } + 'bosTau8' { + fasta = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "bta" + } + 'ce10' { + fasta = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "cel" + } + 'canFam3' { + fasta = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/Genes/genes.bed" + bed12 = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/Genes/genes.bed" + mito_name = "chrM" + species_id = "cfa" + } + 'danRer10' { + fasta = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Annotation/Genes/genes.bed" + bed12 = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Annotation/Genes/genes.bed" + mito_name = "chrM" + species_id = "dre" + } + 'dm6' { + fasta = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "dme" + } + 'equCab2' { + fasta = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "eca" + } + 'galGal4' { + fasta = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "gga" + } + 'panTro4' { + fasta = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "ptr" + } + 'rn6' { + fasta = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "rno" + } + 'sacCer3' { + fasta = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/STARIndex/" + mature = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "sce" + } + 'susScr3' { + fasta = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/WholeGenomeFasta/genome.fa" + fasta_fai = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/WholeGenomeFasta/genome.fa.fai" + bwa = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/BWAIndex/version0.6.0/" + bowtie = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/BowtieIndex/" + bowtie2 = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/STARIndex/" + gtf = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/Genes/genes.bed" + mature = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/SmallRNA/mature.fa" + mito_name = "chrM" + species_id = "ssc" + } } - 'GRCh38' { - fasta = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Annotation/Genes/genes.bed" - mito_name = "chrM" - macs_gsize = "2.7e9" - blacklist = "${baseDir}/assets/blacklists/hg38-blacklist.bed" - } - 'GRCm38' { - fasta = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/README.txt" - mito_name = "MT" - macs_gsize = "1.87e9" - blacklist = "${baseDir}/assets/blacklists/GRCm38-blacklist.bed" - } - 'TAIR10' { - fasta = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/README.txt" - mito_name = "Mt" - } - 'EB2' { - fasta = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/README.txt" - } - 'UMD3.1' { - fasta = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/README.txt" - mito_name = "MT" - } - 'WBcel235' { - fasta = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genes/genes.bed" - mito_name = "MtDNA" - macs_gsize = "9e7" - } - 'CanFam3.1' { - fasta = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/README.txt" - mito_name = "MT" - } - 'GRCz10' { - fasta = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Annotation/Genes/genes.bed" - mito_name = "MT" - } - 'BDGP6' { - fasta = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Annotation/Genes/genes.bed" - mito_name = "M" - macs_gsize = "1.2e8" - } - 'EquCab2' { - fasta = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/README.txt" - mito_name = "MT" - } - 'EB1' { - fasta = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/README.txt" - } - 'Galgal4' { - fasta = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Annotation/Genes/genes.bed" - mito_name = "MT" - } - 'Gm01' { - fasta = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/README.txt" - } - 'Mmul_1' { - fasta = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/README.txt" - mito_name = "MT" - } - 'IRGSP-1.0' { - fasta = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Annotation/Genes/genes.bed" - mito_name = "Mt" - } - 'CHIMP2.1.4' { - fasta = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/README.txt" - mito_name = "MT" - } - 'Rnor_6.0' { - fasta = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Annotation/Genes/genes.bed" - mito_name = "MT" - } - 'R64-1-1' { - fasta = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Annotation/Genes/genes.bed" - mito_name = "MT" - macs_gsize = "1.2e7" - } - 'EF2' { - fasta = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/README.txt" - mito_name = "MT" - macs_gsize = "1.21e7" - } - 'Sbi1' { - fasta = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/README.txt" - } - 'Sscrofa10.2' { - fasta = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/README.txt" - mito_name = "MT" - } - 'AGPv3' { - fasta = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Annotation/Genes/genes.bed" - mito_name = "Mt" - } - 'hg38' { - fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Annotation/Genes/genes.bed" - mito_name = "chrM" - macs_gsize = "2.7e9" - blacklist = "${baseDir}/assets/blacklists/hg38-blacklist.bed" - } - 'hg19' { - fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/README.txt" - mito_name = "chrM" - macs_gsize = "2.7e9" - blacklist = "${baseDir}/assets/blacklists/hg19-blacklist.bed" - } - 'mm10' { - fasta = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/README.txt" - mito_name = "chrM" - macs_gsize = "1.87e9" - blacklist = "${baseDir}/assets/blacklists/mm10-blacklist.bed" - } - 'bosTau8' { - fasta = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Annotation/Genes/genes.bed" - mito_name = "chrM" - } - 'ce10' { - fasta = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/README.txt" - mito_name = "chrM" - macs_gsize = "9e7" - } - 'canFam3' { - fasta = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/README.txt" - mito_name = "chrM" - } - 'danRer10' { - fasta = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Annotation/Genes/genes.bed" - mito_name = "chrM" - macs_gsize = "1.37e9" - } - 'dm6' { - fasta = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Annotation/Genes/genes.bed" - mito_name = "chrM" - macs_gsize = "1.2e8" - } - 'equCab2' { - fasta = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/README.txt" - mito_name = "chrM" - } - 'galGal4' { - fasta = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/README.txt" - mito_name = "chrM" - } - 'panTro4' { - fasta = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/README.txt" - mito_name = "chrM" - } - 'rn6' { - fasta = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Annotation/Genes/genes.bed" - mito_name = "chrM" - } - 'sacCer3' { - fasta = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/BismarkIndex/" - readme = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Annotation/README.txt" - mito_name = "chrM" - macs_gsize = "1.2e7" - } - 'susScr3' { - fasta = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/WholeGenomeFasta/genome.fa" - bwa = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/BWAIndex/genome.fa" - bowtie2 = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/Bowtie2Index/" - star = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/STARIndex/" - bismark = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/BismarkIndex/" - gtf = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/Genes/genes.gtf" - bed12 = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/Genes/genes.bed" - readme = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/README.txt" - mito_name = "chrM" - } - } } diff --git a/conf/igenomes_ignored.config b/conf/igenomes_ignored.config new file mode 100644 index 000000000..b4034d824 --- /dev/null +++ b/conf/igenomes_ignored.config @@ -0,0 +1,9 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for iGenomes paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Empty genomes dictionary to use when igenomes is ignored. +---------------------------------------------------------------------------------------- +*/ + +params.genomes = [:] diff --git a/conf/modules.config b/conf/modules.config new file mode 100644 index 000000000..6ca40abe3 --- /dev/null +++ b/conf/modules.config @@ -0,0 +1,1114 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Config file for defining DSL2 per module options and publishing paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Available keys to override module options: + ext.args = Additional arguments appended to command in module. + ext.args2 = Second set of arguments appended to command in module (multi-tool modules). + ext.args3 = Third set of arguments appended to command in module (multi-tool modules). + ext.prefix = File name prefix for output files. +---------------------------------------------------------------------------------------- +*/ + +process { + + publishDir = [ + path: { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + + withName: CUSTOM_DUMPSOFTWAREVERSIONS { + publishDir = [ + path: { "${params.outdir}/pipeline_info" }, + mode: params.publish_dir_mode, + pattern: '*_versions.yml', + ] + } + + withName: CAT_FASTQ { + publishDir = [ + path: { "${params.outdir}/preprocessing/merged_samples" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: SAMTOOLS_FAIDX { + publishDir = [ + path: { "${params.outdir}/references/index/fasta" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: '.*:FASTQC_TRIMGALORE:FASTQC' { + publishDir = [ + path: { "${params.outdir}/quality_control/fastqc" }, + mode: params.publish_dir_mode, + pattern: "*.{html,zip}", + ] + } + + withName: '.*:FASTQC_TRIMGALORE:TRIMGALORE' { + ext.args = { + [ + "--fastqc_args '-t ${task.cpus}' ", + params.trim_nextseq > 0 ? "--nextseq ${params.trim_nextseq}" : '', + ].join(' ').trim() + } + publishDir = [ + [ + path: { "${params.outdir}/quality_control/trimgalore" }, + mode: params.publish_dir_mode, + pattern: "*.fq.gz", + enabled: params.save_trimmed, + ], + [ + path: { "${params.outdir}/quality_control/trimgalore" }, + mode: params.publish_dir_mode, + pattern: "*.txt", + ], + ] + } + + // PREPARE GENOME + withName: CLEAN_FASTA { + ext.args2 = '\'/>/{ gsub(\$2, "",\$2);gsub(" ", "") };{print}\'' + publishDir = [ + path: { "${params.outdir}/references/genome/clean_fasta" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: GTFFILTER { + ext.suffix = "filtered.gtf" + publishDir = [ + path: { "${params.outdir}/references/genome/filtered_gtf" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: UCSC_GTFTOGENEPRED { + ext.args = "-genePredExt" + publishDir = [ + path: { "${params.outdir}/references/genome/genepred" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: SEQKIT_SPLIT { + ext.args = "-i --by-id-prefix \"\"" + publishDir = [ + path: { "${params.outdir}/references/genome/chromosomes" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: BOWTIE_BUILD { + ext.when = { !params.bowtie && params.tools.split(',').contains('mapsplice') } + publishDir = [ + path: { "${params.outdir}/references/index" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: BOWTIE2_BUILD { + ext.when = { !params.bowtie2 && params.tools.split(',').contains('find_circ') } + publishDir = [ + path: { "${params.outdir}/references/index" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: BWA_INDEX { + ext.when = { !params.bwa && params.tools.split(',').contains('ciriquant') } + publishDir = [ + path: { "${params.outdir}/references/index" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: HISAT2_EXTRACTSPLICESITES { + ext.when = { params.tools.split(',').contains('ciriquant') } + publishDir = [ + path: { "${params.outdir}/references/index/hisat2" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: HISAT2_BUILD { + ext.when = { params.tools.split(',').contains('ciriquant') } + publishDir = [ + path: { "${params.outdir}/references/index" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: STAR_GENOMEGENERATE { + ext.when = { !params.star && (params.tools.split(',').contains('circexplorer2') || params.tools.split(',').contains('dcc') || params.tools.split(',').contains('circrna_finder')) } + ext.args = [ + "", + params.sjdboverhang ? "--sjdbOverhang ${params.sjdboverhang}" : '', + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/references/index" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: CIRCEXPLORER2_REFERENCE { + ext.args = "-v OFS='\\t' '{print \$12, \$1, \$2, \$3, \$4, \$5, \$6, \$7, \$8, \$9, \$10}'" + ext.suffix = "circexplorer2.txt" + publishDir = [ + path: { "${params.outdir}/references/index" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + // circRNA + + withName: '.*:SEGEMEHL:INDEX' { + publishDir = [ + path: { "${params.outdir}/references/index/segemehl" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: '.*:SEGEMEHL:ALIGN' { + ext.args = [ + "", + "-b", + "-S", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/segemehl/intermediates" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:SEGEMEHL:EXTRACT' { + ext.args = "-v FS='\\t' -v OFS='\\t' '{ if (\$4 ~ /;C;/) { print \$1, \$2, \$3, \$1 \":\" \$2 \"-\" \$3 \":\" \$6, \$5, \$6 } }'" + ext.suffix = "segemehl_extracted.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/segemehl/extracted" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:SEGEMEHL:SORT' { + ext.args = "-k1,1 -k2,2n -k3,3n -k4,4 -k6,6" + ext.suffix = "segemehl_sorted.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/segemehl/sorted" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:SEGEMEHL:GROUP' { + ext.summary_col = 5 + ext.args = "-g 1,2,3,4,6 -o count" + ext.suffix = "segemehl_grouped.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/segemehl/grouped" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:SEGEMEHL:UNIFY' { + ext.args = "-v FS='\\t' -v OFS='\\t' '{ print \$1, \$2, \$3, \"FUSIONJUNC_\" (NR-1) \"/\" \$6, \$6, \$5 }'" + ext.suffix = "segemehl.unified.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/segemehl/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.segemehl.unified.bed", + ] + } + + withName: '.*:STAR2PASS:PASS_1' { + ext.when = { params.tools.split(',').contains('circexplorer2') || params.tools.split(',').contains('circrna_finder') } + ext.args = [ + "", + "--chimOutType Junctions WithinBAM", + "--outSAMunmapped Within", + "--outFilterType BySJout", + "--outReadsUnmapped None", + "--readFilesCommand zcat", + "--alignSJDBoverhangMin ${params.alignSJDBoverhangMin}", + "--limitSjdbInsertNsj ${params.limitSjdbInsertNsj}", + "--chimJunctionOverhangMin ${params.chimJunctionOverhangMin}", + "--chimSegmentMin ${params.chimSegmentMin}", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/star/1st_pass/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:STAR2PASS:SJDB' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/star/sjdb/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:STAR2PASS:PASS_2' { + ext.args = [ + "", + params.tools.split(',').contains('circrna_finder') ? "--chimOutType Junctions SeparateSAMold" : "--chimOutType Junctions WithinBAM", + "--outSAMunmapped Within", + "--outFilterType BySJout", + "--outReadsUnmapped None", + "--readFilesCommand zcat", + "--sjdbFileChrStartEnd dataset.SJ.out.tab", + "--alignSJDBoverhangMin ${params.alignSJDBoverhangMin}", + "--limitSjdbInsertNsj ${params.limitSjdbInsertNsj}", + "--chimJunctionOverhangMin ${params.chimJunctionOverhangMin}", + "--chimSegmentMin ${params.chimSegmentMin}", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/star/2nd_pass/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:CIRCEXPLORER2:REFERENCE' { + ext.args = [ + "", + "-genePredExt", + "-geneNameAsName2", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/references/bsj_detection/circexplorer2" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: '.*:CIRCEXPLORER2:PARSE' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/circexplorer2/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:CIRCEXPLORER2:UNIFY' { + ext.args = "-v FS='\\t' -v OFS='\\t' '{ split(\$4, a, \"/\"); print \$1, \$2, \$3, \"FUSIONJUNC_\" (NR-1) \"/\" a[2], a[2], \$6 }'" + ext.suffix = "circexplorer2.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/circexplorer2/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.circexplorer2.bed", + ] + } + + withName: '.*:CIRCRNA_FINDER:MAIN' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/circrna_finder/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + pattern: "*.bed", + ] + } + + withName: '.*:CIRCRNA_FINDER:UNIFY' { + ext.args = "-v FS='\\t' -v OFS='\\t' '{ print \$1, \$2, \$3, \"FUSIONJUNC_\" (NR-1) \"/\" \$5, \$5, \$6 }'" + ext.suffix = "circrna_finder.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/circrna_finder/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.circrna_finder.bed", + ] + } + + withName: '.*:FIND_CIRC:ALIGN' { + ext.args = { + "--very-sensitive --mm -D 20 --score-min=C,-15,0 -q " + (!meta.strandedness || meta.strandedness == 'unstranded' || meta.strandedness == 'auto' + ? '' + : meta.strandedness == 'forward' ? ' --norc' : ' --nofw') + } + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/find_circ/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:FIND_CIRC:SAMTOOLS_INDEX' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/find_circ/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:FIND_CIRC:SAMTOOLS_VIEW' { + ext.prefix = { "${meta.id}_unmapped" } + ext.args = "-hf 4" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/find_circ/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:FIND_CIRC:ANCHORS' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/find_circ/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:FIND_CIRC:MAIN' { + ext.args = { + !meta.strandedness || meta.strandedness == 'unstranded' || meta.strandedness == 'auto' + ? '' + : meta.strandedness == 'forward' ? ' --norc' : ' --nofw' + } + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/find_circ/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:FIND_CIRC:UNIFY' { + ext.args = "-v FS='\\t' -v OFS='\\t' '{ if (\$18 ~ /CIRCULAR/ && \$18 ~ /UNAMBIGUOUS_BP/ && \$18 ~ /ANCHOR_UNIQUE/) { print \$1, \$2, \$3, \"FUSIONJUNC_\" (NR-1) \"/\" \$5, \$5, \$6 } }'" + ext.suffix = "find_circ.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/find_circ/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.find_circ.bed", + ] + } + + withName: '.*:BSJ_DETECTION:CIRIQUANT:MAIN' { + ext.args = "--no-gene" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/ciriquant/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:CIRIQUANT:UNIFY' { + ext.args = "-v OFS='\\t' '{ if (!/^#/ && \$4-=1) { count = substr(\$14, 1, index(\$14, \".\") - 1); print \$1, \$4, \$5, \"FUSIONJUNC_\" (NR-1) \"/\" count, count, \$7 } }'" + ext.suffix = "ciriquant.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/ciriquant/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.ciriquant.bed", + ] + } + + withName: '.*:DCC:MATE1_1ST_PASS' { + ext.prefix = { "${meta.id}_mate1" } + ext.args = [ + "", + "--chimOutType Junctions WithinBAM", + "--outSAMunmapped Within", + "--outFilterType BySJout", + "--outReadsUnmapped None", + "--readFilesCommand zcat", + "--alignSJDBoverhangMin ${params.alignSJDBoverhangMin}", + "--limitSjdbInsertNsj ${params.limitSjdbInsertNsj}", + "--chimJunctionOverhangMin ${params.chimJunctionOverhangMin}", + "--chimSegmentMin ${params.chimSegmentMin}", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/dcc/intermediates/mate1/1st_pass" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:DCC:MATE1_SJDB' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/dcc/intermediates/mate1/sjdb" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:DCC:MATE1_2ND_PASS' { + ext.prefix = { "${meta.id}_mate1" } + ext.args = [ + "", + "--chimOutType Junctions WithinBAM", + "--outSAMunmapped Within", + "--outFilterType BySJout", + "--outReadsUnmapped None", + "--readFilesCommand zcat", + "--sjdbFileChrStartEnd dataset.SJ.out.tab", + "--alignSJDBoverhangMin ${params.alignSJDBoverhangMin}", + "--limitSjdbInsertNsj ${params.limitSjdbInsertNsj}", + "--chimJunctionOverhangMin ${params.chimJunctionOverhangMin}", + "--chimSegmentMin ${params.chimSegmentMin}", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/dcc/intermediates/mate1/2nd_pass" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:DCC:MATE2_1ST_PASS' { + ext.prefix = { "${meta.id}_mate2" } + ext.args = [ + "", + "--chimOutType Junctions WithinBAM", + "--outSAMunmapped Within", + "--outFilterType BySJout", + "--outReadsUnmapped None", + "--readFilesCommand zcat", + "--alignSJDBoverhangMin ${params.alignSJDBoverhangMin}", + "--limitSjdbInsertNsj ${params.limitSjdbInsertNsj}", + "--chimJunctionOverhangMin ${params.chimJunctionOverhangMin}", + "--chimSegmentMin ${params.chimSegmentMin}", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/dcc/intermediates/mate2/1st_pass" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:DCC:MATE2_SJDB' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/dcc/intermediates/mate2/sjdb" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:DCC:MATE2_2ND_PASS' { + ext.prefix = { "${meta.id}_mate2" } + ext.args = [ + "", + "--chimOutType Junctions WithinBAM", + "--outSAMunmapped Within", + "--outFilterType BySJout", + "--outReadsUnmapped None", + "--readFilesCommand zcat", + "--sjdbFileChrStartEnd dataset.SJ.out.tab", + "--alignSJDBoverhangMin ${params.alignSJDBoverhangMin}", + "--limitSjdbInsertNsj ${params.limitSjdbInsertNsj}", + "--chimJunctionOverhangMin ${params.chimJunctionOverhangMin}", + "--chimSegmentMin ${params.chimSegmentMin}", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/dcc/intermediates/mate2/2nd_pass" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:DCC:MAIN' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/dcc/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:DCC:UNIFY' { + ext.args = "-v FS='\\t' -v OFS='\\t' '{ \$2-=1; print \$1, \$2, \$3, \"FUSIONJUNC_\" (NR-1) \"/\" \$5, \$5, \$4 }'" + ext.suffix = "dcc.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/dcc/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.dcc.bed", + ] + } + + withName: '.*:MAPSPLICE:REFERENCE' { + ext.args = [ + "", + "-genePredExt", + "-geneNameAsName2", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/references/bsj_detection/mapsplice" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: '.*:MAPSPLICE:ALIGN' { + ext.args = [ + "", + "--seglen ${params.seglen}", + "--min-intron ${params.min_intron}", + "--max-intron ${params.max_intron}", + "--min-map-len ${params.min_map_len}", + "--min-fusion-distance ${params.min_fusion_distance}", + "--fusion-non-canonical", + ].join(' ').trim() + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/mapsplice/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:MAPSPLICE:PARSE' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/mapsplice/intermediates/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:MAPSPLICE:UNIFY' { + ext.args = "-v FS='\\t' -v OFS='\\t' '{ split(\$4, a, \"/\"); print \$1, \$2, \$3, \"FUSIONJUNC_\" (NR-1) \"/\" a[2], a[2], \$6 }'" + ext.suffix = "mapsplice.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/mapsplice/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.mapsplice.bed", + ] + } + + withName: FILTER_BSJS { + ext.args = { "-v FS='\\t' -v OFS='\\t' '{ if (\$5 >= ${params.bsj_reads}) { print } }'" } + ext.suffix = { "${meta.tool}.filtered.bed" } + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/${meta.tool}/filtered" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: EXTRACT_COUNTS { + ext.args = { "-v FS='\\t' -v OFS='\\t' 'BEGIN { print \"id\", \"${meta.id}\" } { print \$4, \$5 }'" } + ext.suffix = { "counts.tsv" } + publishDir = [ + enabled: false + ] + } + + withName: COMBINE_COUNTS_PER_TOOL { + ext.args = "-f 1 -t -O" + maxRetries = 3 + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: BED_ADD_SAMPLE_TOOL { + ext.args = { "-v FS='\\t' -v OFS='\\t' '{ print \$1, \$2, \$3, \$4, \$5, \$6, \"${meta.id}\", \"${meta.tool}\" }'" } + ext.prefix = { "${meta.id}_${meta.tool}" } + ext.suffix = { "meta.bed" } + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/${meta.tool}/meta" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: COMBINE_TOOLS_PER_SAMPLE { + ext.suffix = "combined.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/samples/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: COMBINE_SAMPLES { + ext.suffix = "combined.bed" + publishDir = [ + path: { "${params.outdir}/bsj_detection/combined" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:ANNOTATE_(COMBINED|PER_SAMPLE|PER_SAMPLE_TOOL):GET_FASTA' { + ext.args = { + [ + "-nameOnly", + params.exons_only ? "-split" : "", + params.consider_strand ? "-s" : "", + ].join(' ').trim() + } + } + + withName: '.*:ANNOTATE_COMBINED:GET_FASTA' { + ext.suffix = "fasta" + publishDir = [ + path: { "${params.outdir}/bsj_detection/combined" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:ANNOTATE_PER_SAMPLE:GET_FASTA' { + ext.suffix = "fasta" + publishDir = [ + path: { "${params.outdir}/bsj_detection/samples/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:ANNOTATE_PER_SAMPLE_TOOL:GET_FASTA' { + ext.suffix = { "${meta.tool}.fasta" } + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/${meta.tool}/fasta" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:ANNOTATE_(COMBINED|PER_SAMPLE|PER_SAMPLE_TOOL):INGEST_DATABASE_NAMES' { + ext.args = { "-v FS='\\t' -v OFS='\\t' '{ print \$1, \$2, \$3, \"${meta.id}:\" \$4, \$5, \$6 }'" } + ext.suffix = "named.bed" + publishDir = [ + path: { "${params.outdir}/references/named_databases" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: '.*:ANNOTATE_(COMBINED|PER_SAMPLE|PER_SAMPLE_TOOL):INTERSECT_DATABASE' { + ext.args = { "-f ${meta.min_overlap} -r -loj -wa -wb" } + ext.suffix = "intersect_database.bed" + } + + withName: '.*:ANNOTATE_COMBINED:INTERSECT_DATABASE' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/combined" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:ANNOTATE_PER_SAMPLE:INTERSECT_DATABASE' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/samples/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:ANNOTATE_PER_SAMPLE_TOOL:INTERSECT_DATABASE' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/${meta.tool}/annotated" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:ANNOTATE_(COMBINED|PER_SAMPLE|PER_SAMPLE_TOOL):ANNOTATE' { + ext.prefix = { "${meta.id}.annotated" } + publishDir = [ + enabled: false + ] + } + + withName: '.*:ANNOTATE_(COMBINED|PER_SAMPLE|PER_SAMPLE_TOOL):RENAME' { + ext.args = { + [ + "-v FS='\\t'", + "-v OFS='\\t'", + "'{ \$4 = \$1 \":\" \$2 \"-\" \$3", + (params.consider_strand ? " \":\" \$6" : ""), + "; print }'", + ].join(' ').trim() + } + ext.suffix = "annotated.bed12" + } + + withName: '.*:ANNOTATE_(COMBINED|PER_SAMPLE|PER_SAMPLE_TOOL):BED2GTF' { + ext.prefix = { "${meta.id}.annotated" } + } + + withName: '.*:ANNOTATE_(COMBINED|PER_SAMPLE|PER_SAMPLE_TOOL):CUT_BED12' { + ext.args = { "-v FS='\\t' -v OFS='\\t' '{ print \$1, \$2, \$3, \$4, \$5, \$6, \$7, \$8, \$9, \$10, \$11, \$12 }'" } + ext.suffix = "cut.bed12" + publishDir = [ + enabled: false + ] + } + + withName: '.*:ANNOTATE_COMBINED:BED2GFF|BED2GTF' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/combined" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:ANNOTATE_PER_SAMPLE:(RENAME|BED2GTF)' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/samples/${meta.id}" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:ANNOTATE_PER_SAMPLE_TOOL:(RENAME|BED2GTF)' { + publishDir = [ + path: { "${params.outdir}/bsj_detection/tools/${meta.tool}/annotated" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: ADD_BACKSPLICE { + ext.args = "-c fastx '{ if (\$name ~ /^.+:[0-9]+-[0-9]+/) { \$seq = \$seq substr(\$seq, 1, 25) } print \">\" \$name; print \$seq }'" + ext.suffix = "backspliced.fa" + publishDir = [ + path: { "${params.outdir}/mirna_prediction" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: UNIFY_MIRANDA { + ext.args = "-v FS='\\t' -v OFS='\\t' 'NR>1 { print \$1, \$2, \$7, \$8, \"miranda\" }'" + ext.suffix = "miranda.tsv" + publishDir = [ + path: { "${params.outdir}/mirna_prediction/binding_sites/tools/miranda/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: UNIFY_TARGETSCAN { + ext.args = "-v FS='\\t' -v OFS='\\t' 'NR>1 { print \$2, \$1, \$6, \$7, \"targetscan\" }'" + ext.suffix = "targetscan.tsv" + publishDir = [ + path: { "${params.outdir}/mirna_prediction/binding_sites/tools/targetscan/unified" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: COMBINE_BINDINGSITES { + ext.prefix = "bindingsites.tsv" + } + + withName: COMBINE_TRANSCRIPTOME_GTFS { + ext.args = "-k 1,1 -k4,4n -k5,5n" + ext.suffix = "combined.gtf" + publishDir = [ + path: { "${params.outdir}/quantification/psirc/transcriptome" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: EXCLUDE_OVERLONG_TRANSCRIPTS { + ext.args = "-v FS='\\t' -v OFS='\\t' '\$5-\$4 <= 10000 { print }'" + ext.suffix = "filtered.gtf" + publishDir = [ + path: { "${params.outdir}/quantification/psirc/transcriptome" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: TRANSCRIPTOME { + ext.args = "-w" + publishDir = [ + path: { "${params.outdir}/quantification/psirc/transcriptome" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: MARK_CIRCULAR { + ext.args = "'{ if (/^>.+:[0-9]+-[0-9]+/) { print \$1 \"\\tC\" } else { print } }'" + ext.suffix = "marked.fasta" + publishDir = [ + path: { "${params.outdir}/quantification/psirc/transcriptome" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: '.*:QUANTIFICATION:CIRIQUANT:MAIN' { + publishDir = [ + [ + path: { "${params.outdir}/quantification/ciriquant/results/transcripts" }, + mode: params.publish_dir_mode, + pattern: "*/gene/*_out.gtf", + saveAs: { filename -> filename.equals('versions.yml') ? null : filename.split('/').last() }, + ], + [ + path: { "${params.outdir}/quantification/ciriquant/results/genes" }, + mode: params.publish_dir_mode, + pattern: "*/gene/*_genes.list", + saveAs: { filename -> filename.equals('versions.yml') ? null : filename.split('/').last() }, + ], + [ + path: { "${params.outdir}/quantification/ciriquant/results/circs" }, + mode: params.publish_dir_mode, + pattern: "*/*.gtf", + saveAs: { filename -> filename.equals('versions.yml') ? null : filename.split('/').last() }, + ], + ] + } + + withName: '.*:QUANTIFICATION:CIRIQUANT:EXTRACT_CIRC' { + ext.args = "-k circ_id,gene_id,score -s \\\t" + ext.suffix = "circ.tsv" + publishDir = [ + path: { "${params.outdir}/quantification/ciriquant/circ" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:QUANTIFICATION:CIRIQUANT:EXTRACT_GENES' { + ext.args = "-v FS='\\t' -v OFS='\\t' '{ print \$1, \$2, \$9 }'" + ext.suffix = "gene.tsv" + publishDir = [ + path: { "${params.outdir}/quantification/ciriquant/gene" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:CIRIQUANT:JOIN_(GENE|CIRC)' { + publishDir = [ + path: { "${params.outdir}/quantification/ciriquant/combined" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:CIRIQUANT:JOIN_CIRC' { + ext.metacols = "circ_id,gene_id" + } + + withName: PSIRC_INDEX { + publishDir = [ + path: { "${params.outdir}/references/index/psirc" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + ] + } + + withName: RUN_PSIRC_QUANT { + publishDir = [ + path: { "${params.outdir}/quantification/psirc/samples/${meta.id}/psirc" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: CUSTOM_TX2GENE { + publishDir = [ + path: { "${params.outdir}/quantification/psirc/transcriptome" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: TXIMETA_TXIMETA { + publishDir = [ + path: { "${params.outdir}/quantification/psirc/samples/${meta.id}/tximeta" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: TXIMETA_TXIMPORT { + publishDir = [ + path: { "${params.outdir}/quantification/psirc/samples/${meta.id}/tximport" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:PSIRC_QUANT:JOIN_(GENE|TX)_(COUNTS|TPM)' { + ext.args = "-f 1,2 -t" + label = "process_medium" + maxRetries = 3 + publishDir = [ + path: { "${params.outdir}/quantification/psirc/combined" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:SPLIT_TYPES_(COUNTS|TPM)' { + publishDir = [ + path: { "${params.outdir}/quantification/psirc/combined" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: MERGE_EXPERIMENTS { + publishDir = [ + path: { "${params.outdir}/quantification/psirc/combined" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:QUANTIFICATION:AGGREGATE' { + publishDir = [ + path: { "${params.outdir}/quantification/aggregations" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:MIRNA_PREDICTION:DESEQ2_NORMALIZATION' { + publishDir = [ + path: { "${params.outdir}/mirna_prediction/mirna_expression" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:MIRNA_PREDICTION:MIRNA_FILTERING' { + publishDir = [ + path: { "${params.outdir}/mirna_prediction/mirna_expression" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: TARGETSCAN_DATABASE { + publishDir = [ + path: { "${params.outdir}/references/mirna_prediction/targetscan" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_reference ? filename : null }, + pattern: "mature.txt", + ] + } + + withName: TARGETSCAN { + ext.prefix = { "${meta.id}.targetscan" } + publishDir = [ + path: { "${params.outdir}/mirna_prediction/binding_sites/tools/targetscan/output" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.txt", + ] + } + + withName: MIRANDA { + ext.prefix = { "${meta.id}.miranda" } + ext.args = "-strict" + publishDir = [ + path: { "${params.outdir}/mirna_prediction/binding_sites/tools/miranda/output" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.txt", + ] + } + + withName: MIRNA_TARGETS { + publishDir = [ + path: { "${params.outdir}/mirna_prediction/binding_sites/targets" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + pattern: "*.txt", + ] + } + + withName: COMBINE_BINDINGSITES { + publishDir = [ + path: { "${params.outdir}/mirna_prediction/binding_sites/majority_vote" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: MAJORITY_VOTE { + publishDir = [ + path: { "${params.outdir}/mirna_prediction/binding_sites/majority_vote" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: '.*:MIRNA_PREDICTION:COMPUTE_CORRELATIONS' { + publishDir = [ + path: { "${params.outdir}/mirna_prediction/correlation" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: CIRCTEST_PREPARE { + publishDir = [ + path: { "${params.outdir}/statistical_tests/circtest" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename != 'versions.yml' && params.save_intermediates ? filename : null }, + ] + } + + withName: CIRCTEST_CIRCTEST { + publishDir = [ + path: { "${params.outdir}/statistical_tests/circtest" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: CIRIQUANT_PREPDE { + publishDir = [ + path: { "${params.outdir}/statistical_tests/ciriquant_de/ciriquant_prep" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: STRINGTIE_PREPDE { + publishDir = [ + path: { "${params.outdir}/statistical_tests/ciriquant_de/stringtie_prep" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: CIRIQUANT_DE { + publishDir = [ + path: { "${params.outdir}/statistical_tests/ciriquant_de" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, + ] + } + + withName: MULTIQC { + ext.args = { params.multiqc_title ? "--title \"${params.multiqc_title}\"" : '' } + } +} diff --git a/conf/test.config b/conf/test.config index 9a3513ba6..c5b9cd7de 100644 --- a/conf/test.config +++ b/conf/test.config @@ -1,26 +1,35 @@ /* - * ------------------------------------------------- - * Nextflow config file for running tests - * ------------------------------------------------- - * Defines bundled input files and everything required - * to run a fast and simple test. Use as follows: - * nextflow run nf-core/circrna -profile test, - */ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for running minimal tests +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Defines input files and everything required to run a fast and simple pipeline test. + + Use as follows: + nextflow run nf-core/circrna -profile test, --outdir + +---------------------------------------------------------------------------------------- +*/ + +process { + resourceLimits = [ + cpus: 4, + memory: '6.GB', + time: '1.h' + ] +} params { - config_profile_name = 'Test profile' - config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = 6.GB - max_time = 48.h + config_profile_name = 'Test profile' + config_profile_description = 'Minimal test dataset to check pipeline function' - // Input data - // TODO nf-core: Specify the paths to your test data on nf-core/test-datasets - // TODO nf-core: Give any required params for the test so that command line flags are not needed - single_end = false - input_paths = [ - ['Testdata', ['https://github.com/nf-core/test-datasets/raw/exoseq/testdata/Testdata_R1.tiny.fastq.gz', 'https://github.com/nf-core/test-datasets/raw/exoseq/testdata/Testdata_R2.tiny.fastq.gz']], - ['SRR389222', ['https://github.com/nf-core/test-datasets/raw/methylseq/testdata/SRR389222_sub1.fastq.gz', 'https://github.com/nf-core/test-datasets/raw/methylseq/testdata/SRR389222_sub2.fastq.gz']] - ] + // Test input data + input = "${params.pipelines_testdata_base_path}circrna/samples.csv" + fasta = "${params.pipelines_testdata_base_path}circrna/reference/chrI.fa" + gtf = "${params.pipelines_testdata_base_path}circrna/reference/chrI.gtf" + mature = "${params.pipelines_testdata_base_path}circrna/reference/mature.fa" + tools = "circexplorer2" + phenotype = "${params.pipelines_testdata_base_path}circrna/phenotype.csv" + skip_trimming = false + outdir = "results/" + bsj_reads = 2 } diff --git a/conf/test_full.config b/conf/test_full.config index 82aa83e4b..094a3f072 100644 --- a/conf/test_full.config +++ b/conf/test_full.config @@ -1,22 +1,2 @@ -/* - * ------------------------------------------------- - * Nextflow config file for running full-size tests - * ------------------------------------------------- - * Defines bundled input files and everything required - * to run a full size pipeline test. Use as follows: - * nextflow run nf-core/circrna -profile test_full, - */ - -params { - config_profile_name = 'Full test profile' - config_profile_description = 'Full test dataset to check pipeline function' - - // Input data for full size test - // TODO nf-core: Specify the paths to your full test data ( on nf-core/test-datasets or directly in repositories, e.g. SRA) - // TODO nf-core: Give any required params for the test so that command line flags are not needed - single_end = false - input_paths = [ - ['Testdata', ['https://github.com/nf-core/test-datasets/raw/exoseq/testdata/Testdata_R1.tiny.fastq.gz', 'https://github.com/nf-core/test-datasets/raw/exoseq/testdata/Testdata_R2.tiny.fastq.gz']], - ['SRR389222', ['https://github.com/nf-core/test-datasets/raw/methylseq/testdata/SRR389222_sub1.fastq.gz', 'https://github.com/nf-core/test-datasets/raw/methylseq/testdata/SRR389222_sub2.fastq.gz']] - ] -} +includeConfig 'test.config' +includeConfig 'full.config' diff --git a/conf/test_igenomes.config b/conf/test_igenomes.config new file mode 100644 index 000000000..d23ddbe8f --- /dev/null +++ b/conf/test_igenomes.config @@ -0,0 +1,27 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for running minimal tests using igenomes +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Defines input files and everything required to run a minimal pipeline test. + + Use as follows: + nextflow run nf-core/circrna -profile test_full, --outdir + +---------------------------------------------------------------------------------------- +*/ + +params { + config_profile_name = 'Minimal igenomes profile' + config_profile_description = 'Minimal igenomes test dataset to check pipeline function' + + // Input data for minima test using igenomes + input = 'https://raw.githubusercontent.com/nf-core/test-datasets/circrna/samples.csv' + + genome = 'ce10' + tool = 'circexplorer2' + phenotype = 'https://raw.githubusercontent.com/nf-core/test-datasets/circrna/phenotype.csv' + skip_trimming = false + star = null // igenomes STAR version is not compatible + outdir = 'results/' + bsj_reads = 2 +} diff --git a/docs/README.md b/docs/README.md index 10ed0f51b..34414f10c 100644 --- a/docs/README.md +++ b/docs/README.md @@ -2,9 +2,9 @@ The nf-core/circrna documentation is split into the following pages: -* [Usage](usage.md) - * An overview of how the pipeline works, how to run it and a description of all of the different command-line flags. -* [Output](output.md) - * An overview of the different results produced by the pipeline and how to interpret them. +- [Usage](usage.md) + - An overview of how the pipeline works, how to run it and a description of all of the different command-line flags. +- [Output](output.md) + - An overview of the different results produced by the pipeline and how to interpret them. You can find a lot more documentation about installing, configuring and running nf-core pipelines on the website: [https://nf-co.re](https://nf-co.re) diff --git a/docs/images/Genomics-Data-Science-original.png b/docs/images/Genomics-Data-Science-original.png new file mode 100644 index 000000000..50e9c02b7 Binary files /dev/null and b/docs/images/Genomics-Data-Science-original.png differ diff --git a/docs/images/metro-map.png b/docs/images/metro-map.png new file mode 100644 index 000000000..2f4f8af89 Binary files /dev/null and b/docs/images/metro-map.png differ diff --git a/docs/images/nf-core-circrna_logo.png b/docs/images/nf-core-circrna_logo.png deleted file mode 100644 index f9617af26..000000000 Binary files a/docs/images/nf-core-circrna_logo.png and /dev/null differ diff --git a/docs/images/nf-core-circrna_logo_dark.png b/docs/images/nf-core-circrna_logo_dark.png new file mode 100644 index 000000000..b48e7b08c Binary files /dev/null and b/docs/images/nf-core-circrna_logo_dark.png differ diff --git a/docs/images/nf-core-circrna_logo_light.png b/docs/images/nf-core-circrna_logo_light.png new file mode 100644 index 000000000..611d5449b Binary files /dev/null and b/docs/images/nf-core-circrna_logo_light.png differ diff --git a/docs/output.md b/docs/output.md index 305b95ac0..b88860a98 100644 --- a/docs/output.md +++ b/docs/output.md @@ -1,63 +1,513 @@ # nf-core/circrna: Output -## :warning: Please read this documentation on the nf-core website: [https://nf-co.re/circrna/output](https://nf-co.re/circrna/output) - -> _Documentation of pipeline parameters is generated automatically from the pipeline schema and can no longer be found in markdown files._ - ## Introduction -This document describes the output produced by the pipeline. Most of the plots are taken from the MultiQC report, which summarises results at the end of the pipeline. +This document describes the output produced by the pipeline. Most of the plots are taken from the MultiQC report generated from the [full-sized test dataset](https://github.com/nf-core/test-datasets/tree/circrna) for the pipeline using a command similar to the one below: + +```bash +nextflow run nf-core/circrna -profile test_full, +``` The directories listed below will be created in the results directory after the pipeline has finished. All paths are relative to the top-level results directory. - +- references: Indices for various tools and intermediate reference genome files +- preprocessing: Per-sample concatenated FASTQ files +- quality_control + - fastqc: FastQC reports for raw reads + - trimgalore: Trim Galore! reports for trimmed reads +- bsj_detection + - combined: Combined BSJ calls across all samples + - samples: Per sample BSJ calls + - tools: Per tool and sample BSJ calls +- quantification + - combined: Quantification results for linear and circular transcripts across samples + - samples: Per sample quantification results + - transcriptome: Combined linear and circular transcriptome, based on GTF file and detected BSJs +- mirna_prediction + - binding_sites + - correlation + - mirna_expression +- statistical_tests + - circtest +- multiqc +- pipeline_info + +## Quality Control + +### FastQC + +:::note +The FastQC plots displayed in the MultiQC report show _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality. +::: + +
+Output files + +- `fastqc/` + - `*_fastqc.html`: FastQC report containing quality metrics. + - `*_fastqc.zip`: Zip archive containing the FastQC report, tab-delimited data file and plot images. + +::: note +The FastQC plots in this directory are generated relative to the raw, input reads. They may contain adapter sequence and regions of low quality. +::: + +
+ +[FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). + +![MultiQC - FastQC sequence counts plot](images/mqc_fastqc_counts.png) + +![MultiQC - FastQC mean quality scores plot](images/mqc_fastqc_quality.png) + +![MultiQC - FastQC adapter content plot](images/mqc_fastqc_adapter.png) + +### TrimGalore + +
+Output files + +- `trimgalore/` + - `*.fq.gz`: If `--save_trimmed` is specified, FastQ files **after** adapter trimming will be placed in this directory. + - `*_trimming_report.txt`: Log file generated by Trim Galore!. +- `trimgalore/fastqc/` + - `*_fastqc.html`: FastQC report containing quality metrics for read 1 (_and read2 if paired-end_) **after** adapter trimming. + - `*_fastqc.zip`: Zip archive containing the FastQC report, tab-delimited data file and plot images. + +
+ +[Trim Galore!](https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) is a wrapper tool around Cutadapt and FastQC to peform quality and adapter trimming on FastQ files. By default, Trim Galore! will automatically detect and trim the appropriate adapter sequence. + +![MultiQC - cutadapt trimmed sequence length plot](images/mqc_cutadapt_trimmed.png) + +### MultiQC + +
+Output files + +- `quality_control/MultiQC/` + - `Raw_Reads_MultiQC.html`: Summary reports of unprocessed RNA-Seq reads. + - `Trimmed_Reads_MultiQC.html`: Summary reports of processed RNA-Seq reads. + +
+ +[MultiQC](http://multiqc.info) is a visualization tool that generates a single HTML report summarising all samples in your project. `nf-core` outputs HTML reports for sequencing read quality control. + +## Reference files + +
+Output files + +- `references` + - `index` + - `bowtie`: Directory containing `Bowtie` indices. + - `bowtie2`: Directory containing `Bowtie2` indices. + - `bwa`: Directory containing `BWA` indices. + - `fasta`: Directory containing FASTA index (`.fai`). + - `hisat2`: Directory containing `HISAT2` indices. + - `segemehl`: Directory containing `Segemehl` index file. + - `star`: Directory containing `STAR` indices. + - `genome` + - `clean_fasta`: Directory containing a FASTA file with reduced headers, since MapSplice has problems with multiple header fields. + - `filtered_gtf`: Directory containing a GTF file with only entries that reside on chromosomes present in the reference FASTA file. + - `chromosomes`: Directory containing individual FASTA files for each chromosome. + - `bsh_detection` + - `circexplorer2`: Directory containing the `CIRCexplorer2` annotation file. + - `mapsplice`: Directory containing the `MapSplice` annotation file. + - `mirna_prediction` + - `targetscan`: Directory containing the TargetScan miRNA database. + +
+ +nf-core/circrna will add the reference files to the output directory if `save_reference` is set to `true`. The resulting files, especially the aligner indices, can be used for speeding up future runs (if the `resume` option cannot be used). In order to achieve this, copy the indices to a location outside of the pipeline's output directory and provide the path to the indices via the corresponding aligner flags (check the [parameters documentation](https://nf-co.re/circrna/parameters/#reference-genome-options) for more information). + +## Pipeline info + +
+Output files + +- `pipeline_info` + - Reports generated by Nextflow: `execution_report.html`, `execution_timeline.html`, `execution_trace.txt` and `pipeline_dag.dot`/`pipeline_dag.svg`. + - Reports generated by the pipeline: `pipeline_report.html`, `pipeline_report.txt` and `software_versions.yml`. The `pipeline_report*` files will only be present if the `--email` / `--email_on_fail` parameter's are used when running the pipeline. + - Parameters used by the pipeline run: `params.json`. + +
+ +## BSJ detection + +The rough workflow for the BSJ detection looks like this: + +1. Each tool detects BSJs in each sample and quantifies how many reads support each BSJ. +2. Bring the tool outputs into a common format. +3. Apply a threshold (parameter `bsj_reads`) to the BSJ reads to filter out lowly supported BSJs. +4. Combine all tool-specific BSJ calls per sample into a single file. +5. Filter out BSJs that are not supported by at least as many tools as specified by`min_tools`. +6. Merge all samples into a single file. This now represents the "circular transcriptome" + +### Per tool + +
+Output files available for all tools + +- `unified`: Directory containing the BSJ calls in the BED6 format. +- `filtered`: Based on `unified`, but filtered for BSJs with at least `bsj_reads` supporting reads. +- `masked`: Based on `filtered`, but scores are replaced by a dot (.) +- `annotated`: Based on `masked`, but with additional columns for the circRNA type, the host gene(s), host transcript(s) and potential database hits. Contains a BED and a GTF file for each sample. +- `fasta`: Extracted sequences of the circRNAs in FASTA format. Based on `masked`. +- `intermediates`: Contains intermediate files generated by the BSJ detection tools, as explained below. +- `${tool}.csv`: Number of reads that the tool found supporting the BSJ. + +
+ +An exemption of the above is `star`, which is not used as a standalone BSJ detection tool, but the output of a 2-pass STAR alignment is used by `CIRCexplorer2`, `circRNA finder` and `DCC`. + +#### CIRCexplorer2 + +
+Output files + +- `bsj_detection/tools/circexplorer2/intermediates/${sample_id}/` + - `*.bed`: Intermediate file generated by `CIRCexplorer2 parse` module, identifying STAR fusion junctions for downstream annotation. + - `*.txt`: Output files generated by `CIRCexplorer2 annotate` module, based on BED 12 format containing circRNA genomic location information, exon cassette composition and an additional 6 columns specifying circRNA annotations. Full descriptions of the 18 columns can be found in the `CIRCexplorer2` [documentation](https://circexplorer2.readthedocs.io/en/latest/modules/annotate/#output). + +
+ +[CIRCexplorer2](https://circexplorer2.readthedocs.io/en/latest/) uses `*.Chimeric.out.junction` files generated from `STAR` 2 pass mode to extract back-splice junction sites using the `CIRCexplorer2 parse` module. Following this, `CIRCexplorer2 annotate` performs re-alignment of reads to the back-splice junction sites to determine the precise positions of downstream donor and upstream acceptor splice sites. Back-splice junction sites are subsequently updated and annotated using the customised annotation text file. + +#### circRNA finder + +
+Output files + +- `bsj_detection/tools/circrna_finder/intermediates/${sample_id}/` + + - `*.filteredJunctions.bed`: A bed file with **all** circular junctions found by the pipeline. The score column indicates the number reads spanning each junction. + - `*.s_filteredJunctions.bed`: A bed file with those junctions in `*.filteredJunctions.bed` that are flanked by GT-AG splice sites. The score column indicates the number reads spanning each junction. + - `*.s_filteredJunctions_fw.bed`: A bed file with the same circular junctions as in file (b), but here the score column gives the average number of forward spliced reads at both splice sites around each circular junction. + +
+ +[circRNA finder](https://github.com/orzechoj/circRNA_finder) uses `*.Chimeric.out.sam`, `*.Chimeric.out.junction` & `*.SJ.out.tab` from STAR 2nd pass files to identify circular RNAs in RNA-Seq data. + +#### CIRIquant + +
+Output files + +- `bsj_detection/tools/ciriquant/intermediates/${sample_id}/` + - `*.log`: A `CIRIerror.log` file which should be empty, and a `${sample_id}.log` file which contains the output log of `CIRIquant`. + - `*.bed`: `CIRI2` output file in BED 6 format. + - `*.gtf`: Output file from `CIRIquant` in GTF format. Full description of the columns available in the `CIRIquant` [documentation](https://ciriquant-cookbook.readthedocs.io/en/latest/quantification.html#output-format). + - `align/` + - `*.sorted.{bam, bam.bai}`: (Sorted and indexed) bam file from `HISAT2` alignment of RNA-Seq reads. + - `circ/` + - `*.ciri`: `CIRI2` output file. + - `*_denovo.sorted.{bam, bam.bai}`: (Sorted and indexed) bam file from `BWA` alignment of candidate circular reads to the pseudo reference. + - `*_index.*.ht2`: `BWA` index files of the pseudo reference. + - `*_index.fa`: Reference FASTA file of candidate circular reads. + +
+ +[CIRIquant](https://github.com/Kevinzjy/CIRIquant) operates by aligning RNA-Seq reads using `HISAT2` and [CIRI2](https://sourceforge.net/projects/ciri/files/CIRI2/) to identify putative circRNAs. Next, a pseudo reference index is generated using `bwa index` by concatenating the two full-length sequences of the putative back-splice junction regions. Candidate circular reads are re-aligned against this pseudo reference using `bwa mem`, and back-splice junction reads are determined if they can be linearly and completely aligned to the putative back-splice junction regions. + +#### DCC + +
+Output files + +- `/bsj_detection/tools/dcc/intermediates/${sample_id}/` + - `*.txt`: Output file from `DCC` containing position and BSJ read counts of circRNAs. + +
+ +[DCC](https://github.com/dieterich-lab/DCC) identifies back-splice junction sites from `*Chimeric.out.junction`, `*SJ.out.tab` & `*Aligned.sortedByCoord.out.bam` files generated by `STAR` 2 pass mode, mapping the paired end reads both jointly and separately (`STAR` does not output read pairs that contain more than one chimeric junction thus a more granular approach is taken by `DCC` to fully characterise back-splice junctions in reads). + +`DCC` then performs a series of filtering steps on candidate circular reads: + +1. Mapping of mates must be consistent with a circular RNA template i.e align to the back-splice junction. +2. Filtering by a minimum number of junction reads per replicate (nf-core/circrna has set this parameter to`-Nr 1 1` allowing all reads). +3. Circular reads are not allowed span more than one gene. +4. Circular reads aligning to mitochondrial genome are removed. +5. Circular reads that lack a canonical (GT/AG) splicing signal at the circRNA junction borders are removed. + +#### Find circ + +
+Output files + +- `bsj_detection/tools/find_circ/intermediates/${sample_id}/` + - `*_anchors.qfa.gz`: 20mer anchors extracted from unmapped reads. + - `*_unmapped.bam`: Unmapped RNA-Seq reads to reference genome. + - `*.sites.bed`: Output from `find_circ`, first six columns are in standard BED format. A description of the remaining columns is available in the `find_circ` [documentation](https://github.com/marvin-jens/find_circ#output-format). + - `*.sites.log`: Summary statistics of candidate circular reads in the sample. + - `*.sites.reads`: Tab delimited file containing circRNA ID & sequence. + +
+ +[find circ](https://github.com/marvin-jens/find_circ) utilises `Bowtie2` short read mapper to align RNA-Seq reads to the genome. Reads that align fully and contiguously are discarded. Unmapped reads are converted to 20mers and aligned independently to find unique anchor positions within spliced exons - anchors that align in reverse orientation indicate circular RNA junctions. Anchor alignments are extended and must meet the following criteria: + +1. Breakpoints flanked by GT/AG splice sites. +2. Unambiguous breakpoint detection. +3. Maximum 2 mismatches in extension procedure. +4. Breakpoint cannot reside more than 2nt inside a 20mer anchor. +5. 2 reads must support the junction. + +#### MapSplice + +
+Output files + +- `bsj_detection/tools/mapsplice/intermediates/${sample_id}/` + - `alignments.bam`: Bam file containing aligned reads and fusion alignments. + - `deletions.txt`: Report of deletions. + - `Fusion output files`: + - `fusions_raw.txt`: raw fusion junctions without filtering + - `fusion_candidates.txt`: filtered fusion junctions + - `fusions_well_annotated.txt`: annotated fusion junction candidates (align to annotation file provided) + - `fusions_not_well_annotated.txt`: fusions that do not align with supplied annotations + - `circular_RNAs.txt`: circular RNAs reported. + - `insertions.txt`: Report of Insertions. + - `junctions.txt`: Reported splice junctions. + - `stats.txt`: Read alignment, Junction statistics. + +
+ +[MapSplice](http://www.netlab.uky.edu/p/bioinfo/MapSplice2) first splits reads into segments, and maps them to reference genome by using `Bowtie`. `MapSplice` attempts to fix unmapped segments as gapped alignments, with each gap corresponding to a splice junction. Finally a remapping step is used to identify back-spliced alignments that are in the presence of small exons. + +#### Segemehl + +
+Output files + +- `bsj_detection/tools/segemehl/intermediates/${sample_id}/` + - `*.bam`: Aligned reads in BAM format + - `*.mult.bed`: Thus, this bed file contains all splice events of a read. The start and end positions indicate the nucleotide after the first split (i.e. the beginning of the first intron) and the nucleotide before the last split (i.e. the end of the last intron), respectively. The name and score are equivalent to the one in the \*.sngl file described above. The following fields 7 & 8 (thickStart and thickEnd) should be the identical to fields 2 & 3. Field 9 holds the color information for the item in RGB encoding (itemRGB). Field 10 (blockCount) indicates the number of splits represented by the BED item. Field 11 is a comma separated list of the intron sizes (blockSizes). Field 12 is the comma separated list of intron starts (blockStarts). + - `*.sngl.bed`: The bed file contains all single splice events predicted in the split read alignments. + - `*.trns.bed`: The custom text file contains all single split alignments predicted to be in trans, i.e. split alignments that are located on different chromosomes and/or different strands. + +
+ +`Segemehl` implements split read alignment mode for reads that failed the attempt of collinear alignment. The algorithm will consider circular alignments. Circular splits are output to `${sample_id}.sngl.bed` and parsed using customised scripts to produce counts representative of `Segemehl` quantification. + +#### STAR + +
+Output files + +- `bsj_detection/tools/star` + - `1st_pass` + - `*.Aligned.out.bam`: Coordinate sorted bam file containing aligned reads and chimeric reads. + - `*.Chimeric.out.junction`: Each line contains the details of chimerically aligned reads. Full descriptions of columns can be found in `STAR` [documentation](https://physiology.med.cornell.edu/faculty/skrabanek/lab/angsd/lecture_notes/STARmanual.pdf) (section 5.4). + - `*.Log.final.out`: Summary mapping statistics after mapping job is complete, useful for quality control. The statistics are calculated for each read (single- or paired-end) and then summed or averaged over all reads. + - `*.Log.out`: Main log file with a lot of detailed information about the run. This file is most useful for troubleshooting and debugging. + - `*.Log.progress.out`: Reports job progress statistics, such as the number of processed reads, % of mapped reads etc. + - `*.SJ.out.tab`: High confidence collapsed splice junctions in tab-delimited form. Full description of columns can be found in `STAR` [documentation](https://physiology.med.cornell.edu/faculty/skrabanek/lab/angsd/lecture_notes/STARmanual.pdf) (section 4.4). + - `2nd_pass` + - `*.Aligned.out.bam`: Coordinate sorted bam file containing aligned reads and chimeric reads. + - `*.Chimeric.out.junction`: Each line contains the details of chimerically aligned reads. Full descriptions of columns can be found in `STAR` [documentation](https://physiology.med.cornell.edu/faculty/skrabanek/lab/angsd/lecture_notes/STARmanual.pdf) (section 5.4). + - `*.Chimeric.out.sam`: Chimeric alignments in SAM format. + - `*.Log.final.out`: Summary mapping statistics after mapping job is complete, useful for quality control. The statistics are calculated for each read (single- or paired-end) and then summed or averaged over all reads. + - `*.Log.out`: Main log file with a lot of detailed information about the run. This file is most useful for troubleshooting and debugging. + - `*.Log.progress.out`: Reports job progress statistics, such as the number of processed reads, % of mapped reads etc. + - `*.SJ.out.tab`: High confidence collapsed splice junctions in tab-delimited form. Full description of columns can be found in `STAR` [documentation](https://physiology.med.cornell.edu/faculty/skrabanek/lab/angsd/lecture_notes/STARmanual.pdf) (section 4.4). + - `sjdb` + - `dataset.SJ.out.tab`: Chromosome, start, end & strand coordinates of novel splice junctions for **all samples** aligned using STAR 1st pass. + +
+ +STAR in 2-pass mode is used to identify novel splice junctions in RNA-Seq data. The first pass of STAR is used to generate a genome index and align reads to the reference genome. The second pass of STAR uses the splice junctions identified in the first pass to align reads to the reference genome. This does not increase the number of detected novel junctions, but allows for more sensitive detection of splice reads mapping to novel junctions. + +### Per sample + +
+Output files + +- `bsj_detection/samples/${sample_id}/` + - `*.grouped.bed`: Grouped BSJ calls in BED format. Score column represents the number of tools that support the BSJ. + - `*.filtered.bed`: Based on `*.grouped.bed`, but filtered for BSJs with at least `min_tools` supporting tools. + - `*.intersect_gtf.bed`: Intersection of `*.filtered.bed` with the reference GTF file. Intermediate file for annotation. + - `*.intersect_database.bed`: Intersection of `*.filtered.bed` with the database BED file. Intermediate file for annotation. + - `*.annotated.bed`: Annotated BSJ calls in BED format, based on `*.filtered.bed`. + - `*.annotated.gtf`: Annotated BSJ calls in GTF format, based on `*.filtered.bed`. + - `*.fa`: Extracted sequences of the circRNAs in FASTA format, based on `*.filtered.bed`. + - `*.upset.png`: Sample-specific upset plot of BSJ calls across tools. + +
+ +nf-core/circrna produces a sample-specific set of BSJ calls. The BSJ calls are filtered for BSJs with at least `min_tools` supporting tools. The filtered BSJ calls are then annotated with the reference GTF file and the database BED file. An upset plot is generated to visualise the overlap of BSJ calls across tools. + +### Combined + +
+Output files + +- `bsj_detection/combined/` + - `*.combined.bed`: Unique BSJ calls across samples in BED format. + - `*.intersect_gtf.bed`: Intersection of `*.filtered.bed` with the reference GTF file. Intermediate file for annotation. + - `*.intersect_database.bed`: Intersection of `*.filtered.bed` with the database BED file. Intermediate file for annotation. + - `*.annotated.bed`: Annotated BSJ calls in BED format, based on `*.filtered.bed`. + - `*.annotated.gtf`: Annotated BSJ calls in GTF format, based on `*.filtered.bed`. + - `*.fa`: Extracted sequences of the circRNAs in FASTA format, based on `*.filtered.bed`. + - `*.upset.png`: Combined upset plot of BSJ calls across samples. + +
+ +nf-core/circrna combines the sample-specific BSJ calls into a single file. The filtered BSJ calls are then annotated with the reference GTF file and the database BED file. An upset plot is generated to visualise the overlap of BSJ calls across tools. + +## Quantification + +Since we now know the BSJ locations, we can now quantify their expression by mapping the reads to the region between the BSJ start and end coordinates. As each read can potentially originate from both linear and circular transcripts, the pipeline performs a joint quantification of the linear and circular transcriptome. +The quantification is performed using psirc-quant, which is a wrapper around `kallisto`. It allows for inferential-uncertainty aware quantification of linear and circular transcripts. + +### Transcriptome + +
+Output files + +- `quantification/transcriptome/` + - `*.combined.gtf`: Combined linear and circular transcriptome in GTF format. + - `*.filtered.gtf`: Filtered linear and circular transcriptome in GTF format, based on `*.combined.gtf`. + - `*.fasta`: Combined linear and circular transcriptome in FASTA format, based on `*.filtered.gtf`. + - `*.marked.fasta`: Transcript sequences in FASTA format with the circRNA sequences marked with a `C` field in the header. + - `*.tx2gene.tsv`: Transcript to gene mapping file. + +
+ +### Per sample + +
+Output files + +- `quantification/samples/${sample_id}/` + - `psirc` + - `*.abundance.h5`: Abundance estimates in HDF5 format. + - `*.abundance.tsv`: Abundance estimates in TSV format. + - `*.run_info.json`: Run information in JSON format. + - `pseudoalignments.bam`: Pseudoalignments in BAM format. + - `pseudoalignments.bai`: Index file for pseudoalignments. + - `tximeta/` + - `*.rds`: RDS file containing the the sample-specific transcript quantification data. + - `tximport/` + - `*.gene_counts_length_scaled.tsv`: Gene counts scaled by transcript length. + - `*.gene_counts_scaled.tsv`: Gene counts scaled by library size. + - `*.gene_counts.tsv`: Gene counts. + - `*.gene_lengths.tsv`: Gene lengths. + - `*.gene_tpm.tsv`: Gene TPM values. + - `*.transcript_counts.tsv`: Transcript counts. + - `*.transcript_lengths.tsv`: Transcript lengths. + - `*.transcript_tpm.tsv`: Transcript TPM values. + +
+ +nf-core/circrna performs quantification of linear and circular transcripts using `psirc-quant`. The quantification results are stored in HDF5 and TSV format. The pipeline also generates a `tximeta` RDS file containing the sample-specific transcript quantification data. The `tximport` directory contains gene and transcript counts, lengths and TPM values. + +### Combined + +
+Output files + +- `quantification/combined/` + - `gene_counts.csv`: Count matrix of genes across samples. + - `gene_tpm.csv`: TPM matrix of genes across samples. + - `tx_counts.csv`: Count matrix of transcripts across samples. + - `tx_tpm.csv`: TPM matrix of transcripts across samples. + - `linear.tsv`: Count matrix of linear transcripts across samples. + - `circular.tsv`: Count matrix of circular transcripts across samples. + - `experiments.merged.rds`: RDS file containing a SummarizedExperiment with the merged transcript quantification data. + +
+ +nf-core/circrna combines the sample-specific quantification results into proper count matrices. It also generates an RDS file containing a SummarizedExperiment with the merged transcript quantification data. + +## miRNA Prediction + +### Binding Sites + +#### Tools + +This section contains predicted binding sites for miRNA-target interactions generated by various computational tools. +Each tool utilizes unique algorithms and criteria to identify potential miRNA binding sites on target genomic sequences, providing complementary insights into miRNA regulatory networks. + +##### miRanda + +
+Output files + +- `mirna_prediction/bindingsites/tools/miranda/output` + - `*.miranda.txt`: Raw predictions from `miRanda`. +- `mirna_prediction/bindingsites/tools/miranda/unified` + - `*.miranda.tsv`: Unified predictions from `miRanda`. + +
+ +[miRanda](http://cbio.mskcc.org/miRNA2003/miranda.html) performs miRNA target prediction of a genomic sequence against a miRNA database in 2 phases: + +1. First a dynamic programming local alignment is carried out between the query miRNA sequence and the reference sequence. This alignment procedure scores based on sequence complementarity and not on sequence identity. +2. Secondly, the algorithm takes high-scoring alignments detected from phase 1 and estimates the thermodynamic stability of RNA duplexes based on these alignments. This second phase of the method utilises folding routines from the `RNAlib` library, part of the [ViennaRNA](https://www.tbi.univie.ac.at/RNA/) package. + +##### TargetScan + +
+Output files + +- `mirna_prediction/bindingsites/tools/targetscan/output` + - `*.targetscan.txt`: Raw predictions from `TargetScan`. +- `mirna_prediction/bindingsites/tools/targetscan/unified` + - `*.targetscan.tsv`: Unified predictions from `TargetScan`. + +
+ +[TargetScan](http://www.targetscan.org/vert_72/) predicts biological targets of miRNAs by searching for the presence of conserved 8mer, 7mer, and 6mer sites within the circRNA mature sequence that match the seed region of each miRNA. + +#### Targets + +
+Output files -## Pipeline overview +- `mirna_prediction/binding_sites/targets` + - `*_miRNA_targets.txt`: Filtered target miRNAs of circRNAs called by quantification tools. Columns are self explanatory: miRNA, Score, Energy_KcalMol, Start, End, Site_type. -The pipeline is built using [Nextflow](https://www.nextflow.io/) -and processes data using the following steps: +
-* [FastQC](#fastqc) - Read quality control -* [MultiQC](#multiqc) - Aggregate report describing results from the whole pipeline -* [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution +nf-core/circrna performs miRNA target filtering on `miRanda` and `TargetScan` predictions: -## FastQC +1. miRNA must be called by both `miRanda` and `TargetScan`. +2. If a site within the circRNA mature sequence shares duplicate miRNA ID's overlapping the same coordinates, the miRNA with the highest score is kept. -[FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. +#### Majority Vote -For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). +
+Output files -**Output files:** +- `mirna_prediction/binding_sites/majority_vote` + - `mirna.targets.tsv`: Stores miRNA-target mappings with all targets listed per miRNA, making it compact and suitable for bulk analyses. + - `mirna.majority.tsv`: Lists each miRNA-target interaction on a separate line, which is helpful for detailed analysis of each interaction independently. -* `fastqc/` - * `*_fastqc.html`: FastQC report containing quality metrics for your untrimmed raw fastq files. -* `fastqc/zips/` - * `*_fastqc.zip`: Zip archive containing the FastQC report, tab-delimited data file and plot images. +
-> **NB:** The FastQC plots displayed in the MultiQC report shows _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality. +nf-core/circrna performs a majority vote on the predicted miRNA targets from [TargetScan](http://www.targetscan.org/vert_72/) and [miRanda](http://cbio.mskcc.org/miRNA2003/miranda.html) based on a +threshold specified by the user. -## MultiQC +### miRNA Expression -[MultiQC](http://multiqc.info) is a visualization tool that generates a single HTML report summarizing all samples in your project. Most of the pipeline QC results are visualised in the report and further statistics are available in the report data directory. +
+Output files -The pipeline has special steps which also allow the software versions to be reported in the MultiQC output for future traceability. +- `mirna_prediction/mirna_expression/` + - `mirna.normalized_counts.tsv`: Contains normalized miRNA expression of all samples. + - `mirna.normalized_counts_filtered.tsv`: Contains miRNA expression after filtering. -For more information about how to use MultiQC reports, see [https://multiqc.info](https://multiqc.info). +
-**Output files:** +nf-core/circrna processes miRNA expression data by normalizing and filtering it for further analysis. -* `multiqc/` - * `multiqc_report.html`: a standalone HTML file that can be viewed in your web browser. - * `multiqc_data/`: directory containing parsed statistics from the different tools used in the pipeline. - * `multiqc_plots/`: directory containing static images from the report in various formats. +### Correlation -## Pipeline information +
+Output files -[Nextflow](https://www.nextflow.io/docs/latest/tracing.html) provides excellent functionality for generating various reports relevant to the running and execution of the pipeline. This will allow you to troubleshoot errors with the running of the pipeline, and also provide you with other information such as launch commands, run times and resource usage. +- `mirna_prediction/correlation` + - `*.tsv`: Files named after the specific miRNA containing correlation results for that miRNA with its target transcripts. -**Output files:** +
-* `pipeline_info/` - * Reports generated by Nextflow: `execution_report.html`, `execution_timeline.html`, `execution_trace.txt` and `pipeline_dag.dot`/`pipeline_dag.svg`. - * Reports generated by the pipeline: `pipeline_report.html`, `pipeline_report.txt` and `software_versions.csv`. - * Documentation for interpretation of results in HTML format: `results_description.html`. +nf-core/circrna computes correlations between miRNA and transcript expression levels and writes the results to individual TSV files for each miRNA-target interaction specified in the input binding sites file. diff --git a/docs/usage.md b/docs/usage.md index a934eb05a..16d21bd70 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -1,32 +1,185 @@ # nf-core/circrna: Usage -## :warning: Please read this documentation on the nf-core website: [https://nf-co.re/circrna/usage](https://nf-co.re/circrna/usage) +## :warning: Please read this documentation on the nf-core website: [https://nf-co.re/rnaseq/usage](https://nf-co.re/rnaseq/usage) > _Documentation of pipeline parameters is generated automatically from the pipeline schema and can no longer be found in markdown files._ -## Introduction +## Pipeline parameters - +Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration except for parameters; see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). + +## Samplesheet input + +You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row as shown in the examples below. + +```bash +--input '[path to samplesheet file]' +``` + +### Multiple runs of the same sample + +The `sample` identifiers have to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate the raw reads before performing any downstream analysis. Below is an example for the same sample sequenced across 3 lanes. If you set the strandedness value to `auto` the pipeline will use the tool-defaults throughout the pipeline. + +```csv title="samplesheet.csv" +sample,fastq_1,fastq_2,strandedness +CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz,auto +CONTROL_REP1,AEG588A1_S1_L003_R1_001.fastq.gz,AEG588A1_S1_L003_R2_001.fastq.gz,auto +CONTROL_REP1,AEG588A1_S1_L004_R1_001.fastq.gz,AEG588A1_S1_L004_R2_001.fastq.gz,auto +``` + +### Full samplesheet + +The pipeline will auto-detect whether a sample is single- or paired-end using the information provided in the samplesheet. The samplesheet can have as many columns as you desire, however, there is a strict requirement for the first 4 columns to match those defined in the table below. + +A final samplesheet file consisting of both single- and paired-end data may look something like the one below. This is for 6 samples, where `TREATMENT_REP3` has been sequenced twice. + +```csv title="samplesheet.csv" +sample,fastq_1,fastq_2,strandedness +CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz,forward +CONTROL_REP2,AEG588A2_S2_L002_R1_001.fastq.gz,AEG588A2_S2_L002_R2_001.fastq.gz,forward +CONTROL_REP3,AEG588A3_S3_L002_R1_001.fastq.gz,AEG588A3_S3_L002_R2_001.fastq.gz,forward +TREATMENT_REP1,AEG588A4_S4_L003_R1_001.fastq.gz,,reverse +TREATMENT_REP2,AEG588A5_S5_L003_R1_001.fastq.gz,,reverse +TREATMENT_REP3,AEG588A6_S6_L003_R1_001.fastq.gz,,reverse +TREATMENT_REP3,AEG588A6_S6_L004_R1_001.fastq.gz,,reverse +``` + +| Column | Description | +| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `sample` | Custom sample name. This entry will be identical for multiple sequencing libraries/runs from the same sample. Spaces in sample names are automatically converted to underscores (`_`). | +| `fastq_1` | Full path to FastQ file for Illumina short reads 1. File has to be gzipped and have the extension ".fastq.gz" or ".fq.gz". | +| `fastq_2` | Full path to FastQ file for Illumina short reads 2. File has to be gzipped and have the extension ".fastq.gz" or ".fq.gz". | +| `strandedness` | Sample strand-specificity. Must be one of `unstranded`, `forward`, `reverse` or `auto`. | + +An [example samplesheet](../assets/samplesheet.csv) has been provided with the pipeline. + +## BSJ detection + +This part of the pipeline is responsible for the detection of back-splice junctions (BSJs) in the input data. The following tools are currently supported: + +- `CIRCexplorer2` +- `circRNA finder` +- `CIRIquant` +- `DCC` +- `find circ` +- `MapSplice` +- `Segemehl` + +The tools to be used can be specified using the `tools` parameter. +Each of the tools also quantifies how many reads support each BSJ. You can specify a cutoff for the minimum number of reads supporting a BSJ using the `bsj_reads` parameter. +Additionally, the parameter `min_tools` can be used to specify how many tools a BSJ has to be detected by to be considered as a valid hit. + +For instructions on how to interpret the output of this section, please check out the [output documentation](https://nf-co.re/circrna/output#bsj-detection). + +## Annotation + +The annotation is generally based on the reference GTF file. It can also utilize BED files that are provided by the various circRNA databases. +The GTF-based annotation allows setting the parameter `exon_boundary` to specify a window around exons. If the BSJ is within this window, it will be annotated as a circRNA - otherwise, it will be annotated as an exon-intron circRNA (EI-circRNA). The default value is `0`. + +For the database-based annotation, an additional sample sheet is required: + +```csv title="annotation.csv" +name,file,min_overlap +db1,db1.bed,0.9 +db2,db2.bed,0.8 +``` + +| Column | Description | +| ------------- | --------------------------------------------------------------------------------------------- | +| `name` | Name of the database. This will be used as a prefix for the region names in the output files. | +| `file` | Path to the BED file. The file has to be a valid BED6 file. | +| `min_overlap` | Minimum bidirectional overlap required between the BSJ and the region in the BED file. | + +The output of the annotation step will be bundled with the outputs of the BSJ detection step. + +## miRNA prediction + +This section allows looking for miRNA binding sites in the circRNAs. +The following tools are currently supported: + +- `miRanda` +- `TargetScan` + +This section will only be executed if the `mature` parameter is provided. +The parameter `mature` should point to a FASTA file containing mature miRNA sequences. +By providing a TSV file containing the miRNA expression of all samples via `mirna_expression`, this +sub-workflow will perform additional normalization and filtering of `mirna_expression` and `mature` before +executing the miRNA binding size prediction. + +To view the outputs of the module, please see the output [documentation](https://nf-co.re/circrna/dev/output#mirna-prediction). + +## Statistical tests + +Currently, only [CircTest](https://github.com/dieterich-lab/CircTest) is supported for the statistical analysis of the circRNA expression data. The `phenotype` parameter is required for this step. + +A valid example of a `phenotype.csv` file (matching the "Full samplesheet") is shown here: + +```csv title="phenotype.csv" +sample,condition +CONTROL_REP1,control +CONTROL_REP2,control +CONTROL_REP3,control +TREATMENT_REP1,treatment +TREATMENT_REP2,treatment +TREATMENT_REP3,treatment +``` + +Note that `TREATMENT_REP3` only has one entry in the `phenotype.csv` file, even though it has two entries in the `samplesheet.csv` file. +If the `phenotype` parameter is provided, the phenotype information will also be added to the `SummarizedExperiment` object, that results from the "Quantification" step. ## Running the pipeline The typical command for running the pipeline is as follows: ```bash -nextflow run nf-core/circrna --input '*_R{1,2}.fastq.gz' -profile docker +nextflow run \ + nf-core/circrna \ + --input \ + --outdir \ + --gtf \ + --fasta \ + --igenomes_ignore \ + --genome null \ + -profile docker ``` +> **NB:** Loading iGenomes configuration remains the default for reasons of consistency with other workflows, but should be disabled when not using iGenomes, applying the recommended usage above. + This will launch the pipeline with the `docker` configuration profile. See below for more information about profiles. Note that the pipeline will create the following files in your working directory: ```bash -work # Directory containing the nextflow working files -results # Finished results (configurable, see below) -.nextflow_log # Log file from Nextflow +work # Directory containing the nextflow working files + # Finished results in specified location (defined with --outdir) +.nextflow_log # Log file from Nextflow # Other nextflow hidden files, eg. history of pipeline runs and old logs. ``` +If you wish to repeatedly use the same parameters for multiple runs, rather than specifying each flag in the command, you can specify these in a params file. + +Pipeline settings can be provided in a `yaml` or `json` file via `-params-file `. + +> [!WARNING] +> Do not use `-c ` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args). + +The above pipeline run specified with a params file in yaml format: + +```bash +nextflow run nf-core/circrna -profile docker -params-file params.yaml +``` + +with: + +```yaml title="params.yaml" +input: './samplesheet.csv' +outdir: './results/' +genome: 'GRCh37' +<...> +``` + +You can also generate such `YAML`/`JSON` files via [nf-core/launch](https://nf-co.re/launch). + ### Updating the pipeline When you run the above command, Nextflow automatically pulls the pipeline code from GitHub and stores it as a cached version. When running the pipeline after this, it will always use the cached version if available - even if the pipeline has been updated since. To make sure that you're running the latest version of the pipeline, make sure that you regularly update the cached version of the pipeline: @@ -35,49 +188,66 @@ When you run the above command, Nextflow automatically pulls the pipeline code f nextflow pull nf-core/circrna ``` +When you run the above command, Nextflow automatically pulls the pipeline code from GitHub and stores it as a cached version. When running the pipeline after this, it will always use the cached version if available - even if the pipeline has been updated since. + ### Reproducibility -It's a good idea to specify a pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you'll be running the same version of the pipeline, even if there have been changes to the code since. +It is a good idea to specify the pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you'll be running the same version of the pipeline, even if there have been changes to the code since. + +First, go to the [nf-core/circrna releases page](https://github.com/nf-core/circrna/releases) and find the latest pipeline version - numeric only (eg. `1.3.1`). Then specify this when running the pipeline with `-r` (one hyphen) - eg. `-r 1.3.1`. Of course, you can switch to another version by changing the number after the `-r` flag. -First, go to the [nf-core/circrna releases page](https://github.com/nf-core/circrna/releases) and find the latest version number - numeric only (eg. `1.3.1`). Then specify this when running the pipeline with `-r` (one hyphen) - eg. `-r 1.3.1`. +This version number will be logged in reports when you run the pipeline, so that you'll know what you used when you look back in the future. For example, at the bottom of the MultiQC reports. -This version number will be logged in reports when you run the pipeline, so that you'll know what you used when you look back in the future. +To further assist in reproducibility, you can use share and reuse [parameter files](#running-the-pipeline) to repeat pipeline runs with the same settings without having to write out a command with every single parameter. + +> [!TIP] +> If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles. ## Core Nextflow arguments -> **NB:** These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen). +> [!NOTE] +> These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen) ### `-profile` Use this parameter to choose a configuration profile. Profiles can give configuration presets for different compute environments. -Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Conda) - see below. +Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below. +> [!IMPORTANT] > We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported. -The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to see if your system is available in these configs please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation). +The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to check if your system is supported, please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation). Note that multiple profiles can be loaded, for example: `-profile test,docker` - the order of arguments is important! They are loaded in sequence, so later profiles can overwrite earlier profiles. -If `-profile` is not specified, the pipeline will run locally and expect all software to be installed and available on the `PATH`. This is _not_ recommended. - -* `docker` - * A generic configuration profile to be used with [Docker](https://docker.com/) - * Pulls software from Docker Hub: [`nfcore/circrna`](https://hub.docker.com/r/nfcore/circrna/) -* `singularity` - * A generic configuration profile to be used with [Singularity](https://sylabs.io/docs/) - * Pulls software from Docker Hub: [`nfcore/circrna`](https://hub.docker.com/r/nfcore/circrna/) -* `podman` - * A generic configuration profile to be used with [Podman](https://podman.io/) - * Pulls software from Docker Hub: [`nfcore/circrna`](https://hub.docker.com/r/nfcore/circrna/) -* `conda` - * Please only use Conda as a last resort i.e. when it's not possible to run the pipeline with Docker, Singularity or Podman. - * A generic configuration profile to be used with [Conda](https://conda.io/docs/) - * Pulls most software from [Bioconda](https://bioconda.github.io/) -* `test` - * A profile with a complete configuration for automated testing - * Includes links to test data so needs no other parameters +If `-profile` is not specified, the pipeline will run locally and expect all software to be installed and available on the `PATH`. This is _not_ recommended, since it can lead to different results on different machines dependent on the computer environment. + +- `test` + - A profile with a complete configuration for automated testing + - Includes links to test data so needs no other parameters +- `docker` + - A generic configuration profile to be used with [Docker](https://docker.com/) + - Pulls software from Docker Hub: [`nfcore/circrna`](https://hub.docker.com/r/nfcore/circrna/) +- `singularity` + - A generic configuration profile to be used with [Singularity](https://sylabs.io/docs/) + - Pulls software from Docker Hub: [`nfcore/circrna`](https://hub.docker.com/r/nfcore/circrna/) +- `podman` + - A generic configuration profile to be used with [Podman](https://podman.io/) + - Pulls software from Docker Hub: [`nfcore/circrna`](https://hub.docker.com/r/nfcore/circrna/) +- `shifter` + - A generic configuration profile to be used with [Shifter](https://nersc.gitlab.io/development/shifter/how-to-use/) + - Pulls software from Docker Hub: [`nfcore/circrna`](https://hub.docker.com/r/nfcore/circrna/) +- `charliecloud` + - A generic configuration profile to be used with [Charliecloud](https://hpc.github.io/charliecloud/) + - Pulls software from Docker Hub: [`nfcore/circrna`](https://hub.docker.com/r/nfcore/circrna/) +- `apptainer` + - A generic configuration profile to be used with [Apptainer](https://apptainer.org/) +- `wave` + - A generic configuration profile to enable [Wave](https://seqera.io/wave/) containers. Use together with one of the above (requires Nextflow ` 24.03.0-edge` or later). +- `conda` + - A generic configuration profile to be used with [Conda](https://conda.io/docs/). Please only use Conda as a last resort i.e. when it's not possible to run the pipeline with Docker, Singularity, Podman, Shifter, Charliecloud, or Apptainer. ### `-resume` @@ -89,27 +259,35 @@ You can also supply a run name to resume a specific run: `-resume [run-name]`. U Specify the path to a specific config file (this is a core Nextflow command). See the [nf-core website documentation](https://nf-co.re/usage/configuration) for more information. -#### Custom resource requests +## Custom configuration -Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the steps in the pipeline, if the job exits with an error code of `143` (exceeded requested resources) it will automatically resubmit with higher requests (2 x original, then 3 x original). If it still fails after three times then the pipeline is stopped. +### Resource requests -Whilst these default requirements will hopefully work for most people with most data, you may find that you want to customise the compute resources that the pipeline requests. You can do this by creating a custom config file. For example, to give the workflow process `star` 32GB of memory, you could use the following config: +Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the pipeline steps, if the job exits with any of the error codes specified [here](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/base.config#L18) it will automatically be resubmitted with higher resources request (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped. -```nextflow -process { - withName: star { - memory = 32.GB - } -} -``` +To change the resource requests, please see the [max resources](https://nf-co.re/docs/usage/configuration#max-resources) and [tuning workflow resources](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources) section of the nf-core website. + +### Custom Containers + +In some cases, you may wish to change the container or conda environment used by a pipeline steps for a particular tool. By default, nf-core pipelines use containers and software from the [biocontainers](https://biocontainers.pro/) or [bioconda](https://bioconda.github.io/) projects. However, in some cases the pipeline specified version maybe out of date. + +To use a different container from the default container or conda environment specified in a pipeline, please see the [updating tool versions](https://nf-co.re/docs/usage/configuration#updating-tool-versions) section of the nf-core website. + +### Custom Tool Arguments + +A pipeline might not always support every possible argument or option of a particular tool used in pipeline. Fortunately, nf-core pipelines provide some freedom to users to insert additional parameters that the pipeline does not include by default. + +To learn how to provide additional arguments to a particular tool of the pipeline, please see the [customising tool arguments](https://nf-co.re/docs/usage/configuration#customising-tool-arguments) section of the nf-core website. + +### nf-core/configs -See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config.html) for more information. +In most cases, you will only need to create a custom config as a one-off but if you and others within your organisation are likely to be running nf-core pipelines regularly and need to use the same settings regularly it may be a good idea to request that your custom config file is uploaded to the `nf-core/configs` git repository. Before you do this please can you test that the config file works with your pipeline of choice using the `-c` parameter. You can then create a pull request to the `nf-core/configs` repository with the addition of your config file, associated documentation file (see examples in [`nf-core/configs/docs`](https://github.com/nf-core/configs/tree/master/docs)), and amending [`nfcore_custom.config`](https://github.com/nf-core/configs/blob/master/nfcore_custom.config) to include your custom profile. -If you are likely to be running `nf-core` pipelines regularly it may be a good idea to request that your custom config file is uploaded to the `nf-core/configs` git repository. Before you do this please can you test that the config file works with your pipeline of choice using the `-c` parameter (see definition above). You can then create a pull request to the `nf-core/configs` repository with the addition of your config file, associated documentation file (see examples in [`nf-core/configs/docs`](https://github.com/nf-core/configs/tree/master/docs)), and amending [`nfcore_custom.config`](https://github.com/nf-core/configs/blob/master/nfcore_custom.config) to include your custom profile. +See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config.html) for more information about creating your own configuration files. If you have any questions or issues please send us a message on [Slack](https://nf-co.re/join/slack) on the [`#configs` channel](https://nfcore.slack.com/channels/configs). -### Running in the background +## Running in the background Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished. @@ -118,7 +296,7 @@ The Nextflow `-bg` flag launches Nextflow in the background, detached from your Alternatively, you can use `screen` / `tmux` or similar tool to create a detached session which you can log back into at a later time. Some HPC setups also allow you to run nextflow within a cluster job submitted your job scheduler (from where it submits more jobs). -#### Nextflow memory requirements +## Nextflow memory requirements In some cases, the Nextflow Java virtual machines can start to request a large amount of memory. We recommend adding the following line to your environment to limit this (typically in `~/.bashrc` or `~./bash_profile`): diff --git a/environment.yml b/environment.yml deleted file mode 100644 index 038f26c3d..000000000 --- a/environment.yml +++ /dev/null @@ -1,15 +0,0 @@ -# You can use this file to create a conda environment for this pipeline: -# conda env create -f environment.yml -name: nf-core-circrna-1.0dev -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - conda-forge::python=3.7.3 - - conda-forge::markdown=3.1.1 - - conda-forge::pymdown-extensions=6.0 - - conda-forge::pygments=2.5.2 - # TODO nf-core: Add required software dependencies here - - bioconda::fastqc=0.11.8 - - bioconda::multiqc=1.7 diff --git a/main.nf b/main.nf index 9defc5a8f..c73ce7416 100644 --- a/main.nf +++ b/main.nf @@ -1,435 +1,120 @@ #!/usr/bin/env nextflow /* -======================================================================================== - nf-core/circrna -======================================================================================== - nf-core/circrna Analysis Pipeline. - #### Homepage / Documentation - https://github.com/nf-core/circrna +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + nf-core/circrna +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Github : https://github.com/nf-core/circrna + Website: https://nf-co.re/circrna + Slack : https://nfcore.slack.com/channels/circrna ---------------------------------------------------------------------------------------- */ -def helpMessage() { - // TODO nf-core: Add to this help message with new command line parameters - log.info nfcoreHeader() - log.info""" - - Usage: - - The typical command for running the pipeline is as follows: - - nextflow run nf-core/circrna --input '*_R{1,2}.fastq.gz' -profile docker - - Mandatory arguments: - --input [file] Path to input data (must be surrounded with quotes) - -profile [str] Configuration profile to use. Can use multiple (comma separated) - Available: conda, docker, singularity, test, awsbatch, and more - - Options: - --genome [str] Name of iGenomes reference - --single_end [bool] Specifies that the input is single-end reads - - References If not specified in the configuration file or you wish to overwrite any of the references - --fasta [file] Path to fasta reference - - Other options: - --outdir [file] The output directory where the results will be saved - --publish_dir_mode [str] Mode for publishing results in the output directory. Available: symlink, rellink, link, copy, copyNoFollow, move (Default: copy) - --email [email] Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits - --email_on_fail [email] Same as --email, except only send mail if the workflow is not successful - --max_multiqc_email_size [str] Threshold size for MultiQC report to be attached in notification email. If file generated by pipeline exceeds the threshold, it will not be attached (Default: 25MB) - -name [str] Name for the pipeline run. If not specified, Nextflow will automatically generate a random mnemonic - - AWSBatch options: - --awsqueue [str] The AWSBatch JobQueue that needs to be set when running on AWSBatch - --awsregion [str] The AWS Region for your AWS Batch job to run on - --awscli [str] Path to the AWS CLI tool - """.stripIndent() -} - -// Show help message -if (params.help) { - helpMessage() - exit 0 -} - /* - * SET UP CONFIGURATION VARIABLES - */ - -// Check if genome exists in the config file -if (params.genomes && params.genome && !params.genomes.containsKey(params.genome)) { - exit 1, "The provided genome '${params.genome}' is not available in the iGenomes file. Currently the available genomes are ${params.genomes.keySet().join(", ")}" -} - -// TODO nf-core: Add any reference files that are needed -// Configurable reference genomes -// -// NOTE - THIS IS NOT USED IN THIS PIPELINE, EXAMPLE ONLY -// If you want to use the channel below in a process, define the following: -// input: -// file fasta from ch_fasta -// -params.fasta = params.genome ? params.genomes[ params.genome ].fasta ?: false : false -if (params.fasta) { ch_fasta = file(params.fasta, checkIfExists: true) } - -// Has the run name been specified by the user? -// this has the bonus effect of catching both -name and --name -custom_runName = params.name -if (!(workflow.runName ==~ /[a-z]+_[a-z]+/)) { - custom_runName = workflow.runName -} - -// Check AWS batch settings -if (workflow.profile.contains('awsbatch')) { - // AWSBatch sanity checking - if (!params.awsqueue || !params.awsregion) exit 1, "Specify correct --awsqueue and --awsregion parameters on AWSBatch!" - // Check outdir paths to be S3 buckets if running on AWSBatch - // related: https://github.com/nextflow-io/nextflow/issues/813 - if (!params.outdir.startsWith('s3:')) exit 1, "Outdir not on S3 - specify S3 Bucket to run on AWSBatch!" - // Prevent trace files to be stored on S3 since S3 does not support rolling files. - if (params.tracedir.startsWith('s3:')) exit 1, "Specify a local tracedir or run without trace! S3 cannot be used for tracefiles." -} - -// Stage config files -ch_multiqc_config = file("$projectDir/assets/multiqc_config.yaml", checkIfExists: true) -ch_multiqc_custom_config = params.multiqc_config ? Channel.fromPath(params.multiqc_config, checkIfExists: true) : Channel.empty() -ch_output_docs = file("$projectDir/docs/output.md", checkIfExists: true) -ch_output_docs_images = file("$projectDir/docs/images/", checkIfExists: true) - -/* - * Create a channel for input read files - */ -if (params.input_paths) { - if (params.single_end) { - Channel - .from(params.input_paths) - .map { row -> [ row[0], [ file(row[1][0], checkIfExists: true) ] ] } - .ifEmpty { exit 1, "params.input_paths was empty - no input files supplied" } - .into { ch_read_files_fastqc; ch_read_files_trimming } - } else { - Channel - .from(params.input_paths) - .map { row -> [ row[0], [ file(row[1][0], checkIfExists: true), file(row[1][1], checkIfExists: true) ] ] } - .ifEmpty { exit 1, "params.input_paths was empty - no input files supplied" } - .into { ch_read_files_fastqc; ch_read_files_trimming } - } -} else { - Channel - .fromFilePairs(params.input, size: params.single_end ? 1 : 2) - .ifEmpty { exit 1, "Cannot find any reads matching: ${params.input}\nNB: Path needs to be enclosed in quotes!\nIf this is single-end data, please specify --single_end on the command line." } - .into { ch_read_files_fastqc; ch_read_files_trimming } -} - -// Header log info -log.info nfcoreHeader() -def summary = [:] -if (workflow.revision) summary['Pipeline Release'] = workflow.revision -summary['Run Name'] = custom_runName ?: workflow.runName -// TODO nf-core: Report custom parameters here -summary['Input'] = params.input -summary['Fasta Ref'] = params.fasta -summary['Data Type'] = params.single_end ? 'Single-End' : 'Paired-End' -summary['Max Resources'] = "$params.max_memory memory, $params.max_cpus cpus, $params.max_time time per job" -if (workflow.containerEngine) summary['Container'] = "$workflow.containerEngine - $workflow.container" -summary['Output dir'] = params.outdir -summary['Launch dir'] = workflow.launchDir -summary['Working dir'] = workflow.workDir -summary['Script dir'] = workflow.projectDir -summary['User'] = workflow.userName -if (workflow.profile.contains('awsbatch')) { - summary['AWS Region'] = params.awsregion - summary['AWS Queue'] = params.awsqueue - summary['AWS CLI'] = params.awscli -} -summary['Config Profile'] = workflow.profile -if (params.config_profile_description) summary['Config Profile Description'] = params.config_profile_description -if (params.config_profile_contact) summary['Config Profile Contact'] = params.config_profile_contact -if (params.config_profile_url) summary['Config Profile URL'] = params.config_profile_url -summary['Config Files'] = workflow.configFiles.join(', ') -if (params.email || params.email_on_fail) { - summary['E-mail Address'] = params.email - summary['E-mail on failure'] = params.email_on_fail - summary['MultiQC maxsize'] = params.max_multiqc_email_size -} -log.info summary.collect { k,v -> "${k.padRight(18)}: $v" }.join("\n") -log.info "-\033[2m--------------------------------------------------\033[0m-" - -// Check the hostnames against configured profiles -checkHostname() - -Channel.from(summary.collect{ [it.key, it.value] }) - .map { k,v -> "
$k
${v ?: 'N/A'}
" } - .reduce { a, b -> return [a, b].join("\n ") } - .map { x -> """ - id: 'nf-core-circrna-summary' - description: " - this information is collected when the pipeline is started." - section_name: 'nf-core/circrna Workflow Summary' - section_href: 'https://github.com/nf-core/circrna' - plot_type: 'html' - data: | -
- $x -
- """.stripIndent() } - .set { ch_workflow_summary } - -/* - * Parse software version numbers - */ -process get_software_versions { - publishDir "${params.outdir}/pipeline_info", mode: params.publish_dir_mode, - saveAs: { filename -> - if (filename.indexOf(".csv") > 0) filename - else null - } - - output: - file 'software_versions_mqc.yaml' into ch_software_versions_yaml - file "software_versions.csv" - - script: - // TODO nf-core: Get all tools to print their version number here - """ - echo $workflow.manifest.version > v_pipeline.txt - echo $workflow.nextflow.version > v_nextflow.txt - fastqc --version > v_fastqc.txt - multiqc --version > v_multiqc.txt - scrape_software_versions.py &> software_versions_mqc.yaml - """ -} - -/* - * STEP 1 - FastQC - */ -process fastqc { - tag "$name" - label 'process_medium' - publishDir "${params.outdir}/fastqc", mode: params.publish_dir_mode, - saveAs: { filename -> - filename.indexOf(".zip") > 0 ? "zips/$filename" : "$filename" - } - - input: - set val(name), file(reads) from ch_read_files_fastqc +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS / WORKFLOWS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ - output: - file "*_fastqc.{zip,html}" into ch_fastqc_results - - script: - """ - fastqc --quiet --threads $task.cpus $reads - """ -} +include { samplesheetToList } from 'plugin/nf-schema' +include { CIRCRNA } from './workflows/circrna' +include { PIPELINE_INITIALISATION } from './subworkflows/local/utils_nfcore_circrna_pipeline' +include { PIPELINE_COMPLETION } from './subworkflows/local/utils_nfcore_circrna_pipeline' +include { getGenomeAttribute } from './subworkflows/local/utils_nfcore_circrna_pipeline' /* - * STEP 2 - MultiQC - */ -process multiqc { - publishDir "${params.outdir}/MultiQC", mode: params.publish_dir_mode - - input: - file (multiqc_config) from ch_multiqc_config - file (mqc_custom_config) from ch_multiqc_custom_config.collect().ifEmpty([]) - // TODO nf-core: Add in log files from your new processes for MultiQC to find! - file ('fastqc/*') from ch_fastqc_results.collect().ifEmpty([]) - file ('software_versions/*') from ch_software_versions_yaml.collect() - file workflow_summary from ch_workflow_summary.collectFile(name: "workflow_summary_mqc.yaml") - - output: - file "*multiqc_report.html" into ch_multiqc_report - file "*_data" - file "multiqc_plots" - - script: - rtitle = custom_runName ? "--title \"$custom_runName\"" : '' - rfilename = custom_runName ? "--filename " + custom_runName.replaceAll('\\W','_').replaceAll('_+','_') + "_multiqc_report" : '' - custom_config_file = params.multiqc_config ? "--config $mqc_custom_config" : '' - // TODO nf-core: Specify which MultiQC modules to use with -m for a faster run time - """ - multiqc -f $rtitle $rfilename $custom_config_file . - """ -} +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + GENOME PARAMETER VALUES +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ +params.fasta = getGenomeAttribute('fasta') +params.gtf = getGenomeAttribute('gtf') +params.bwa = getGenomeAttribute('bwa') +params.star = getGenomeAttribute('star') +params.bowtie = getGenomeAttribute('bowtie') +params.bowtie2 = getGenomeAttribute('bowtie2') +params.mature = getGenomeAttribute('mature') /* - * STEP 3 - Output Description HTML - */ -process output_documentation { - publishDir "${params.outdir}/pipeline_info", mode: params.publish_dir_mode - - input: - file output_docs from ch_output_docs - file images from ch_output_docs_images - - output: - file "results_description.html" +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + RUN MAIN WORKFLOW +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ - script: - """ - markdown_to_html.py $output_docs -o results_description.html - """ +workflow { + // + // SUBWORKFLOW: Run initialisation tasks + // + PIPELINE_INITIALISATION( + params.version, + params.validate_params, + params.monochrome_logs, + args, + params.outdir, + params.input, + ) + + // + // WORKFLOW: Run main workflow + // + NFCORE_CIRCRNA( + PIPELINE_INITIALISATION.out.samplesheet + ) + // + // SUBWORKFLOW: Run completion tasks + // + PIPELINE_COMPLETION( + params.email, + params.email_on_fail, + params.plaintext_email, + params.outdir, + params.monochrome_logs, + params.hook_url, + NFCORE_CIRCRNA.out.multiqc_report, + ) } /* - * Completion e-mail notification - */ -workflow.onComplete { - - // Set up the e-mail variables - def subject = "[nf-core/circrna] Successful: $workflow.runName" - if (!workflow.success) { - subject = "[nf-core/circrna] FAILED: $workflow.runName" - } - def email_fields = [:] - email_fields['version'] = workflow.manifest.version - email_fields['runName'] = custom_runName ?: workflow.runName - email_fields['success'] = workflow.success - email_fields['dateComplete'] = workflow.complete - email_fields['duration'] = workflow.duration - email_fields['exitStatus'] = workflow.exitStatus - email_fields['errorMessage'] = (workflow.errorMessage ?: 'None') - email_fields['errorReport'] = (workflow.errorReport ?: 'None') - email_fields['commandLine'] = workflow.commandLine - email_fields['projectDir'] = workflow.projectDir - email_fields['summary'] = summary - email_fields['summary']['Date Started'] = workflow.start - email_fields['summary']['Date Completed'] = workflow.complete - email_fields['summary']['Pipeline script file path'] = workflow.scriptFile - email_fields['summary']['Pipeline script hash ID'] = workflow.scriptId - if (workflow.repository) email_fields['summary']['Pipeline repository Git URL'] = workflow.repository - if (workflow.commitId) email_fields['summary']['Pipeline repository Git Commit'] = workflow.commitId - if (workflow.revision) email_fields['summary']['Pipeline Git branch/tag'] = workflow.revision - email_fields['summary']['Nextflow Version'] = workflow.nextflow.version - email_fields['summary']['Nextflow Build'] = workflow.nextflow.build - email_fields['summary']['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp - - // TODO nf-core: If not using MultiQC, strip out this code (including params.max_multiqc_email_size) - // On success try attach the multiqc report - def mqc_report = null - try { - if (workflow.success) { - mqc_report = ch_multiqc_report.getVal() - if (mqc_report.getClass() == ArrayList) { - log.warn "[nf-core/circrna] Found multiple reports from process 'multiqc', will use only one" - mqc_report = mqc_report[0] - } - } - } catch (all) { - log.warn "[nf-core/circrna] Could not attach MultiQC report to summary email" - } - - // Check if we are only sending emails on failure - email_address = params.email - if (!params.email && params.email_on_fail && !workflow.success) { - email_address = params.email_on_fail - } - - // Render the TXT template - def engine = new groovy.text.GStringTemplateEngine() - def tf = new File("$projectDir/assets/email_template.txt") - def txt_template = engine.createTemplate(tf).make(email_fields) - def email_txt = txt_template.toString() - - // Render the HTML template - def hf = new File("$projectDir/assets/email_template.html") - def html_template = engine.createTemplate(hf).make(email_fields) - def email_html = html_template.toString() - - // Render the sendmail template - def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, baseDir: "$projectDir", mqcFile: mqc_report, mqcMaxSize: params.max_multiqc_email_size.toBytes() ] - def sf = new File("$projectDir/assets/sendmail_template.txt") - def sendmail_template = engine.createTemplate(sf).make(smail_fields) - def sendmail_html = sendmail_template.toString() - - // Send the HTML e-mail - if (email_address) { - try { - if (params.plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } - // Try to send HTML e-mail using sendmail - [ 'sendmail', '-t' ].execute() << sendmail_html - log.info "[nf-core/circrna] Sent summary e-mail to $email_address (sendmail)" - } catch (all) { - // Catch failures and try with plaintext - def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] - if ( mqc_report.size() <= params.max_multiqc_email_size.toBytes() ) { - mail_cmd += [ '-A', mqc_report ] - } - mail_cmd.execute() << email_html - log.info "[nf-core/circrna] Sent summary e-mail to $email_address (mail)" - } - } - - // Write summary e-mail HTML to a file - def output_d = new File("${params.outdir}/pipeline_info/") - if (!output_d.exists()) { - output_d.mkdirs() - } - def output_hf = new File(output_d, "pipeline_report.html") - output_hf.withWriter { w -> w << email_html } - def output_tf = new File(output_d, "pipeline_report.txt") - output_tf.withWriter { w -> w << email_txt } - - c_green = params.monochrome_logs ? '' : "\033[0;32m"; - c_purple = params.monochrome_logs ? '' : "\033[0;35m"; - c_red = params.monochrome_logs ? '' : "\033[0;31m"; - c_reset = params.monochrome_logs ? '' : "\033[0m"; - - if (workflow.stats.ignoredCount > 0 && workflow.success) { - log.info "-${c_purple}Warning, pipeline completed, but with errored process(es) ${c_reset}-" - log.info "-${c_red}Number of ignored errored process(es) : ${workflow.stats.ignoredCount} ${c_reset}-" - log.info "-${c_green}Number of successfully ran process(es) : ${workflow.stats.succeedCount} ${c_reset}-" - } - - if (workflow.success) { - log.info "-${c_purple}[nf-core/circrna]${c_green} Pipeline completed successfully${c_reset}-" - } else { - checkHostname() - log.info "-${c_purple}[nf-core/circrna]${c_red} Pipeline completed with errors${c_reset}-" - } - -} - - -def nfcoreHeader() { - // Log colors ANSI codes - c_black = params.monochrome_logs ? '' : "\033[0;30m"; - c_blue = params.monochrome_logs ? '' : "\033[0;34m"; - c_cyan = params.monochrome_logs ? '' : "\033[0;36m"; - c_dim = params.monochrome_logs ? '' : "\033[2m"; - c_green = params.monochrome_logs ? '' : "\033[0;32m"; - c_purple = params.monochrome_logs ? '' : "\033[0;35m"; - c_reset = params.monochrome_logs ? '' : "\033[0m"; - c_white = params.monochrome_logs ? '' : "\033[0;37m"; - c_yellow = params.monochrome_logs ? '' : "\033[0;33m"; - - return """ -${c_dim}--------------------------------------------------${c_reset}- - ${c_green},--.${c_black}/${c_green},-.${c_reset} - ${c_blue} ___ __ __ __ ___ ${c_green}/,-._.--~\'${c_reset} - ${c_blue} |\\ | |__ __ / ` / \\ |__) |__ ${c_yellow}} {${c_reset} - ${c_blue} | \\| | \\__, \\__/ | \\ |___ ${c_green}\\`-._,-`-,${c_reset} - ${c_green}`._,._,\'${c_reset} - ${c_purple} nf-core/circrna v${workflow.manifest.version}${c_reset} - -${c_dim}--------------------------------------------------${c_reset}- - """.stripIndent() -} +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + NAMED WORKFLOWS FOR PIPELINE +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ -def checkHostname() { - def c_reset = params.monochrome_logs ? '' : "\033[0m" - def c_white = params.monochrome_logs ? '' : "\033[0;37m" - def c_red = params.monochrome_logs ? '' : "\033[1;91m" - def c_yellow_bold = params.monochrome_logs ? '' : "\033[1;93m" - if (params.hostnames) { - def hostname = "hostname".execute().text.trim() - params.hostnames.each { prof, hnames -> - hnames.each { hname -> - if (hostname.contains(hname) && !workflow.profile.contains(prof)) { - log.error "====================================================\n" + - " ${c_red}WARNING!${c_reset} You are running with `-profile $workflow.profile`\n" + - " but your machine hostname is ${c_white}'$hostname'${c_reset}\n" + - " ${c_yellow_bold}It's highly recommended that you use `-profile $prof${c_reset}`\n" + - "============================================================" - } - } - } - } +// +// WORKFLOW: Run main analysis pipeline depending on type of input +// +workflow NFCORE_CIRCRNA { + take: + ch_samplesheet + + main: + + ch_versions = Channel.empty() + + // + // WORKFLOW: Run nf-core/circrna workflow + // + ch_fasta = Channel.value([[id: "fasta"], file(params.fasta, checkIfExists: true)]) + ch_gtf = Channel.value([[id: "gtf"], file(params.gtf, checkIfExists: true)]) + ch_mature = params.mature ? Channel.value([[id: "mature"], file(params.mature, checkIfExists: true)]) : Channel.empty() + ch_phenotype = params.phenotype ? Channel.value([[id: "phenotype"], file(params.phenotype, checkIfExists: true)]) : Channel.empty() + ch_annotation = params.annotation + ? Channel.fromList( + samplesheetToList(params.annotation, "${projectDir}/assets/schema_annotation.json") + ) + : Channel.empty() + ch_mirna = params.mature && params.mirna_expression ? Channel.value([[id: "mirna"], file(params.mirna_expression, checkIfExists: true)]) : Channel.empty() + + CIRCRNA( + ch_samplesheet, + ch_phenotype, + ch_fasta, + ch_gtf, + ch_mature, + ch_annotation, + ch_versions, + ch_mirna, + ) + + emit: + multiqc_report = CIRCRNA.out.multiqc_report // channel: /path/to/multiqc_report.html } diff --git a/modules.json b/modules.json new file mode 100644 index 000000000..5c07916ad --- /dev/null +++ b/modules.json @@ -0,0 +1,267 @@ +{ + "name": "nf-core/circrna", + "homePage": "https://github.com/nf-core/circrna", + "repos": { + "https://github.com/nf-core/modules.git": { + "modules": { + "nf-core": { + "agat/convertbed2gff": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "agat/spaddintrons": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bedtools/getfasta": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bedtools/groupby": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bedtools/intersect": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bedtools/sort": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bioawk": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"], + "patch": "modules/nf-core/bioawk/bioawk.diff" + }, + "bowtie/align": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bowtie/build": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bowtie2/align": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bowtie2/build": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "bwa/index": { + "branch": "master", + "git_sha": "15a93581f7f81d05c04b828954004a089360ea9b", + "installed_by": ["modules"] + }, + "cat/cat": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "cat/fastq": { + "branch": "master", + "git_sha": "c03f4019225fce21c11f194ff32eca396963f305", + "installed_by": ["modules"] + }, + "circexplorer2/annotate": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "circexplorer2/parse": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "csvtk/join": { + "branch": "master", + "git_sha": "fa92936611247ca647ddee970f94d83f1bcb0ffe", + "installed_by": ["modules"] + }, + "csvtk/split": { + "branch": "master", + "git_sha": "fa92936611247ca647ddee970f94d83f1bcb0ffe", + "installed_by": ["modules"] + }, + "custom/dumpsoftwareversions": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "custom/gtffilter": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "custom/tx2gene": { + "branch": "master", + "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", + "installed_by": ["modules"] + }, + "fastqc": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "gawk": { + "branch": "master", + "git_sha": "27be1be5a87724096b51e1fe579ecbd773f53f1b", + "installed_by": ["modules"] + }, + "gffread": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "gnu/sort": { + "branch": "master", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": ["modules"] + }, + "hisat2/align": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "hisat2/build": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "hisat2/extractsplicesites": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "miranda": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "multiqc": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "samtools/faidx": { + "branch": "master", + "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "installed_by": ["modules"] + }, + "samtools/flagstat": { + "branch": "master", + "git_sha": "2d20463181b1c38981a02e90d3084b5f9fa8d540", + "installed_by": ["bam_stats_samtools"] + }, + "samtools/idxstats": { + "branch": "master", + "git_sha": "2d20463181b1c38981a02e90d3084b5f9fa8d540", + "installed_by": ["bam_stats_samtools"] + }, + "samtools/index": { + "branch": "master", + "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "installed_by": ["bam_sort_stats_samtools", "modules"] + }, + "samtools/sort": { + "branch": "master", + "git_sha": "b7800db9b069ed505db3f9d91b8c72faea9be17b", + "installed_by": ["bam_sort_stats_samtools", "modules"] + }, + "samtools/stats": { + "branch": "master", + "git_sha": "2d20463181b1c38981a02e90d3084b5f9fa8d540", + "installed_by": ["bam_stats_samtools"] + }, + "samtools/view": { + "branch": "master", + "git_sha": "b21df1b4e806f7bf3aff0eb41d84453a0025b43e", + "installed_by": ["modules"] + }, + "segemehl/align": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "segemehl/index": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "star/align": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "star/genomegenerate": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "stringtie/stringtie": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "trimgalore": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "tximeta/tximport": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + }, + "ucsc/gtftogenepred": { + "branch": "master", + "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc", + "installed_by": ["modules"] + } + } + }, + "subworkflows": { + "nf-core": { + "bam_sort_stats_samtools": { + "branch": "master", + "git_sha": "763d4b5c05ffda3ac1ac969dc67f7458cfb2eb1d", + "installed_by": ["subworkflows"] + }, + "bam_stats_samtools": { + "branch": "master", + "git_sha": "763d4b5c05ffda3ac1ac969dc67f7458cfb2eb1d", + "installed_by": ["bam_sort_stats_samtools", "subworkflows"] + }, + "utils_nextflow_pipeline": { + "branch": "master", + "git_sha": "c2b22d85f30a706a3073387f30380704fcae013b", + "installed_by": ["subworkflows"] + }, + "utils_nfcore_pipeline": { + "branch": "master", + "git_sha": "51ae5406a030d4da1e49e4dab49756844fdd6c7a", + "installed_by": ["subworkflows"] + }, + "utils_nfschema_plugin": { + "branch": "master", + "git_sha": "2fd2cd6d0e7b273747f32e465fdc6bcc3ae0814e", + "installed_by": ["subworkflows"] + } + } + } + } + } +} diff --git a/modules/local/annotation/bed2gtf/environment.yml b/modules/local/annotation/bed2gtf/environment.yml new file mode 100644 index 000000000..3bfb488b8 --- /dev/null +++ b/modules/local/annotation/bed2gtf/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::polars=1.24.0 diff --git a/modules/local/annotation/bed2gtf/main.nf b/modules/local/annotation/bed2gtf/main.nf new file mode 100644 index 000000000..36a02d393 --- /dev/null +++ b/modules/local/annotation/bed2gtf/main.nf @@ -0,0 +1,23 @@ +process ANNOTATION_BED2GTF { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'oras://community.wave.seqera.io/library/polars:1.24.0--800cd3e4ff805434' : + 'community.wave.seqera.io/library/polars:1.24.0--2d2d323e8514e707' }" + + input: + tuple val(meta), path(bed12), path(db_intersections) + val exons_only + + output: + tuple val(meta), path("${prefix}.${suffix}"), emit: gtf + + path "versions.yml" , emit: versions + + script: + prefix = task.ext.prefix ?: meta.id + suffix = task.ext.suffix ?: 'gtf' + template 'bed2gtf.py' +} diff --git a/modules/local/annotation/bed2gtf/templates/bed2gtf.py b/modules/local/annotation/bed2gtf/templates/bed2gtf.py new file mode 100755 index 000000000..0579614ac --- /dev/null +++ b/modules/local/annotation/bed2gtf/templates/bed2gtf.py @@ -0,0 +1,91 @@ +#!/usr/bin/env python + +import platform + +import polars as pl + +def format_yaml_like(data: dict, indent: int = 0) -> str: + """Formats a dictionary to a YAML-like string. + + Args: + data (dict): The dictionary to format. + indent (int): The current indentation level. + + Returns: + str: A string formatted as YAML. + """ + yaml_str = "" + for key, value in data.items(): + spaces = " " * indent + if isinstance(value, dict): + yaml_str += f"{spaces}{key}:\\n{format_yaml_like(value, indent + 1)}" + else: + yaml_str += f"{spaces}{key}: {value}\\n" + return yaml_str + +exons_only = bool("${exons_only}") + +columns = ['chr', 'start', 'end', 'name', 'score', 'strand', + 'thickStart', 'thickEnd', 'itemRgb', + 'exonCount', 'exonSizes', 'exonStarts', + 'readNumber', 'circType', 'gene', 'transcript', + 'index', 'flankIntron' + ] +df = pl.scan_csv('${bed12}', separator='\\t', has_header=False, new_columns=columns) + +df = df.with_columns( + attributes = pl.lit('gene_id "') + pl.col('gene') + pl.lit('"; transcript_id "') + pl.col('name') + pl.lit('";'), + source = pl.lit('nf-core/circrna') +) + +if exons_only: + df_exons = df.with_columns( + exonSizes = pl.col('exonSizes').str.split(','), + exonStarts = pl.col('exonStarts').str.split(',') + ).explode('exonSizes', 'exonStarts') + df_exons = df_exons.with_columns( + type = pl.lit('exon'), + phase = pl.lit('.'), + start = pl.col('start') + pl.col('exonStarts').cast(int) + ).with_columns( + end = pl.col('start') + pl.col('exonSizes').cast(int) + ) + df_exons = df_exons.select( + 'chr', 'source', 'type', 'start', 'end', 'score', 'strand', 'phase', 'attributes' + ) + df_cds = df_exons.clone() + df_cds = df_cds.with_columns( + type = pl.lit('CDS'), + phase = pl.lit('.') + ) +else: + df_exons = df.clone() + df_exons = df_exons.with_columns( + type = pl.lit('exon'), + phase = pl.lit('.') + ) + df_exons = df_exons.select( + 'chr', 'source', 'type', 'start', 'end', 'score', 'strand', 'phase', 'attributes' + ) + df_cds = df_exons.clone() + df_cds = df_cds.with_columns( + type = pl.lit('CDS'), + phase = pl.lit('.') + ) + +df_combined = pl.concat([df_exons, df_cds]) +df_combined = df_combined.sort('chr', 'start', 'end') + +df_combined.collect().write_csv('${prefix}.${suffix}', separator='\\t', include_header=False, quote_style="never") + +# Versions + +versions = { + "${task.process}": { + "python": platform.python_version(), + "polars": pl.__version__, + } +} + +with open("versions.yml", "w") as f: + f.write(format_yaml_like(versions)) diff --git a/modules/local/circrna_finder/main.nf b/modules/local/circrna_finder/main.nf new file mode 100644 index 000000000..9bbb9a53b --- /dev/null +++ b/modules/local/circrna_finder/main.nf @@ -0,0 +1,34 @@ +process CIRCRNA_FINDER { + tag "$meta.id" + label 'process_low' + + conda "bioconda::circrna_finder=1.2" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/circrna_finder%3A1.2--pl5321hdfd78af_1' : + 'biocontainers/circrna_finder:1.2--pl5321hdfd78af_1' }" + + input: + tuple val(meta), path(star_input, stageAs: 'input/') + + output: + tuple val(meta), path("${prefix}.filteredJunctions.bed"), emit: results + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def VERSION = 'v1.2' + """ + postProcessStarAlignment.pl ${args} --starDir input/ --outDir ./ + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + awk: \$(awk --version | head -n1 | cut -d' ' -f3 | sed 's/,//g' ) + cat: \$(cat --version | head -n 1 | sed -e 's/cat (GNU coreutils) //') + circRNA_finder: $VERSION + END_VERSIONS + """ +} diff --git a/modules/local/circtest/circtest/main.nf b/modules/local/circtest/circtest/main.nf new file mode 100644 index 000000000..be3494af9 --- /dev/null +++ b/modules/local/circtest/circtest/main.nf @@ -0,0 +1,24 @@ +process CIRCTEST_CIRCTEST { + label 'process_medium' + + conda "conda-forge::r-base=4.2.2 conda-forge::r-aod=1.3.2 conda-forge::r-ggplot2=3.4.0 conda-forge::r-plyr=1.8.8" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/mulled-v2-c79b00aa4647c739dbe7e8480789d3ba67988f2e:0' : + 'biocontainers/mulled-v2-c79b00aa4647c739dbe7e8480789d3ba67988f2e:0' }" + + input: + tuple val(meta) , path(gene_counts), path(circ_counts) + tuple val(meta2), path(phenotype) + + output: + tuple val(meta), path("${prefix}_summary.txt"), emit: summary + tuple val(meta), path("*.pdf") , emit: plots + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + prefix = task.ext.prefix ?: meta.id + template 'circtest.R' +} diff --git a/modules/local/circtest/circtest/templates/circtest.R b/modules/local/circtest/circtest/templates/circtest.R new file mode 100755 index 000000000..debdf0395 --- /dev/null +++ b/modules/local/circtest/circtest/templates/circtest.R @@ -0,0 +1,475 @@ +#!/usr/bin/env Rscript + +require(aod) +require(plyr) +require(ggplot2) + +## CircTest functions +## Package: CircTest (https://github.com/dieterich-lab/CircTest) +## Version: 0.1.1 +## Author(s): Jun Cheng, Tobias Jakobi +## License: GPL + +## SUMMMARY + +#'@title Summarizes data +## Gives count, mean, standard deviation, standard error of the mean, and confidence interval (default 95%). +## data: a data frame. +## measurevar: the name of a column that contains the variable to be summariezed +## groupvars: a vector containing names of columns that contain grouping variables +## na.rm: a boolean that indicates whether to ignore NA's +## conf.interval: the percent range of the confidence interval (default is 95%) +#' +summarySE <- function(data=NULL, measurevar, groupvars=NULL, na.rm=FALSE, + conf.interval=.95, .drop=TRUE) { + + require(plyr) + + # New version of length which can handle NA's: if na.rm==T, don't count them + length2 <- function (x, na.rm=FALSE) { + if (na.rm) sum(!is.na(x)) + else length(x) + } + + # This does the summary. For each group's data frame, return a vector with + # N, mean, and sd + datac <- ddply(data, groupvars, .drop=.drop, + .fun = function(xx, col) { + c(N = length2(xx[[col]], na.rm=na.rm), + mean = mean (xx[[col]], na.rm=na.rm), + sd = sd (xx[[col]], na.rm=na.rm) + ) + }, + measurevar + ) + + # Rename the "mean" column + datac <- rename(datac, c("mean" = measurevar)) + + datac\$se <- datac\$sd / sqrt(datac\$N) # Calculate standard error of the mean + + # Confidence interval multiplier for standard error + # Calculate t-statistic for confidence interval: + # e.g., if conf.interval is .95, use .975 (above/below), and use df=N-1 + ciMult <- qt(conf.interval/2 + .5, datac\$N-1) + datac\$ci <- datac\$se * ciMult + + return(datac) +} + +## RATIO PLOT + +Circ.ratioplot <- function(Circ,Linear,CircCoordinates = None,plotrow='1',size=24,ncol=2,groupindicator1=NULL,groupindicator2=NULL,x='Conditions',y='circRNA/(circRNA+Linear)',lab_legend='groupindicator1', circle_description = c(1:3), gene_column = None, y_axis_range = 1, colour_mode = "colour"){ + + if( !is.null(groupindicator1) & length(groupindicator1) != ncol(Circ)-length(circle_description) ){ + stop("If provided, the length of groupindicator1 should be equal to the number of samples.") + } + if( !is.null(groupindicator2) & length(groupindicator2) != ncol(Circ)-length(circle_description) ){ + stop("If provided, the length of groupindicator2 should be equal to the number of samples.") + } + if(is.null(groupindicator1)){ + stop("At least one grouping should be provided through groupindicator1.") + } + if(!is.null(groupindicator2)){ + twolevel <- TRUE + }else{ + twolevel <- FALSE + } + + rownames.circ <- rownames(Circ) + Circ <- data.frame(lapply(Circ, as.character), stringsAsFactors=FALSE) + rownames(Circ) <- rownames.circ + + rownames.linear <- rownames(Linear) + Linear <- data.frame(lapply(Linear, as.character), stringsAsFactors=FALSE) + rownames(Linear) <- rownames.linear + + if(!missing(CircCoordinates)){ + rownames.circCoordinates <- rownames(CircCoordinates) + CircCoordinates <- data.frame(lapply(CircCoordinates, as.character), stringsAsFactors=FALSE) + rownames(CircCoordinates) <- rownames.circCoordinates + }else{ + CircCoordinates <- data.frame(Circ[,circle_description]) + rownames(CircCoordinates) <- rownames.circ + rownames.circCoordinates <- rownames(CircCoordinates) + CircCoordinates <- data.frame(lapply(CircCoordinates, as.character), stringsAsFactors=FALSE) + rownames(CircCoordinates) <- rownames.circCoordinates + } + + groupindicator1 <- factor(groupindicator1,levels=unique(groupindicator1)) + groupindicator2 <- factor(groupindicator2,levels=unique(groupindicator2)) + + # Get gene name, if no annotation, output NULL + if (is.character(plotrow)){ + if ( ! plotrow %in% rownames(CircCoordinates) ){ + stop("Specified 'plotrow' not found.") + } + }else{ + if ( is.numeric(plotrow) ){ + if ( ! plotrow %in% 1:nrow(CircCoordinates) ){ + stop("Specified 'plotrow' not found.") + } + }else{ + stop("Specified plotrow should be ONE rowname or ONE rownumber.") + } + } + # Choose your own column containing the gene name using gene_column. The genename will be displayed in the plot title if available + if (missing(gene_column)){ + genename = NULL + }else{ + genename <- as.character(CircCoordinates[plotrow,gene_column]) + if (genename == '.'){ + genename = NULL + } + } + if(twolevel){ + plotdat <- summarySE( data.frame(Ratio=as.numeric(Circ[plotrow,-circle_description])/(as.numeric(Linear[plotrow,-circle_description])+as.numeric(Circ[plotrow,-circle_description])), + groupindicator1, + groupindicator2), + measurevar='Ratio',groupvars=c('groupindicator1','groupindicator2') ) + }else{ + plotdat <- summarySE( data.frame(Ratio=as.numeric(Circ[plotrow,-circle_description])/(as.numeric(Linear[plotrow,-circle_description])+as.numeric(Circ[plotrow,-circle_description])), + groupindicator1), + measurevar='Ratio',groupvars=c('groupindicator1') ) + } +# construct plot + Q <- ggplot(plotdat, aes(x=groupindicator1, y=Ratio)) + + geom_boxplot() + theme_classic() + + theme(axis.text.x = element_blank())+ + theme(axis.text.y = element_text(size=size+4))+ + theme(axis.ticks = element_line(colour = 'black', size = 1)) + + theme(axis.ticks.x = element_blank())+ + theme(legend.title=element_blank()) + + theme(text=element_text(size=size+4))+ + theme(legend.text=element_text(size=size)) + + theme(plot.title = element_text(size=size)) + + theme(axis.text.y = element_text(margin=margin(5,5,10,5,"pt")))+ + ggtitle(paste("Annotation: ", genename, "\\nChr ", toString(Circ[plotrow,circle_description]),sep="")) + + ylab("circRNA/(circRNA + Linear RNA)") + + xlab("Sample") + + geom_errorbar(aes(ymin=Ratio, ymax=Ratio+se), width=.2 , size=2) + + geom_bar(stat="identity",aes(fill=groupindicator1), color = "black", size=2) + + if (colour_mode == "bw"){ + Q <- Q + scale_fill_grey(start = 0.0, end = 1) + } else { + Q <- Q + scale_fill_discrete(name=lab_legend) + } + + Q <- Q + + theme(legend.position="bottom") + + theme(axis.ticks.length = unit(0.5, "cm")) + + theme(panel.background = element_blank(), + panel.grid.major = element_blank(), + panel.grid.minor = element_blank(), + axis.line = element_line(colour = "black"), + panel.border = element_rect(colour = "black", fill=NA, size=3)) + + guides(fill=guide_legend( + keywidth=0.3, + keyheight=0.3, + default.unit="inch") + ) + scale_y_continuous(expand=c(0,0), limits= c(0, y_axis_range)) + + if(twolevel){ + Q <- Q + facet_wrap( ~ groupindicator2,ncol=ncol ) + } + + print(Q) +} + +## LINEPLOT + +Circ.lineplot <- function(Circ,Linear,CircCoordinates = None,plotrow='1',size=18,ncol=2,groupindicator1=NULL,groupindicator2=NULL,x='Conditions',y='Counts', circle_description = c(1:3), gene_column = None){ + + require(ggplot2) + + if( !is.null(groupindicator1) & length(groupindicator1) != ncol(Circ)-length(circle_description) ){ + stop("If provided, the length of groupindicator1 should be equal to the number of samples.") + } + if( !is.null(groupindicator2) & length(groupindicator2) != ncol(Circ)-length(circle_description) ){ + stop("If provided, the length of groupindicator2 should be equal to the number of samples.") + } + if(is.null(groupindicator1)){ + stop("At least one grouping should be provided through groupindicator1.") + } + if(!is.null(groupindicator2)){ + twolevel <- TRUE + }else{ + twolevel <- FALSE + } + + rownames.circ <- rownames(Circ) + Circ <- data.frame(lapply(Circ, as.character), stringsAsFactors=FALSE) + rownames(Circ) <- rownames.circ + + rownames.linear <- rownames(Linear) + Linear <- data.frame(lapply(Linear, as.character), stringsAsFactors=FALSE) + rownames(Linear) <- rownames.linear + + # if CircCoordinates are available, use them, otherwise get more information from the Circ table, as indicated by the circle_description columns. + if(!missing(CircCoordinates)){ + rownames.circCoordinates <- rownames(CircCoordinates) + CircCoordinates <- data.frame(lapply(CircCoordinates, as.character), stringsAsFactors=FALSE) + rownames(CircCoordinates) <- rownames.circCoordinates + }else{ + CircCoordinates <- data.frame(Circ[,circle_description]) + rownames(CircCoordinates) <- rownames.circ + rownames.circCoordinates <- rownames(CircCoordinates) + CircCoordinates <- data.frame(lapply(CircCoordinates, as.character), stringsAsFactors=FALSE) + rownames(CircCoordinates) <- rownames.circCoordinates + } + + groupindicator1 <- factor(groupindicator1,levels=unique(groupindicator1)) + groupindicator2 <- factor(groupindicator2,levels=unique(groupindicator2)) + + # Get gene name, if no annotation, output NULL + if (is.character(plotrow)){ + if ( ! plotrow %in% rownames(CircCoordinates) ){ + stop("Specified 'plotrow' not found.") + } + }else{ + if ( is.numeric(plotrow) ){ + if ( ! plotrow %in% 1:nrow(CircCoordinates) ){ + stop("Specified 'plotrow' not found.") + } + }else{ + stop("Specified plotrow should be ONE rowname or ONE rownumber.") + } + } + # Choose your own column containing the gene name using gene_column. The genename will be displayed in the plot title if available + if (missing(gene_column)){ + genename = NULL + }else{ + genename <- as.character(CircCoordinates[plotrow,gene_column]) + if (genename == '.'){ + genename = NULL + } + } + + plot.func <- function(row=plotrow){ + if(twolevel){ + plotdat <- summarySE(data.frame(Counts=c(as.numeric(Circ[row,-circle_description]),as.numeric(Linear[row,-circle_description])), + groupindicator1, + groupindicator2, + Type=c(rep('circRNA',ncol(Circ)-length(circle_description)),rep('linear RNA',ncol(Circ)-length(circle_description))) + ), measurevar='Counts',groupvars=c('Type','groupindicator1','groupindicator2') ) + }else{ + plotdat <- summarySE(data.frame(Counts=c(as.numeric(Circ[row,-circle_description]),as.numeric(Linear[row,-circle_description])), + groupindicator1, + Type=c(rep('circRNA',ncol(Circ)-length(circle_description)),rep('linear RNA',ncol(Circ)-length(circle_description))) + ), measurevar='Counts',groupvars=c('Type','groupindicator1') ) + } + + Q=ggplot(plotdat, aes(x=groupindicator1, y=Counts, group=Type,colour=Type)) + + theme(text=element_text(size=size))+ + theme_bw()+ + labs( list(title=paste(toString(Circ[row,circle_description]),genename,sep=" "),x=x,y=y) ) + + ggtitle(paste(toString(Circ[row,circle_description]),genename,sep=" "))+ + geom_errorbar(aes(ymin=Counts-se, ymax=Counts+se), width=.1, position=position_dodge(.1) ) + + xlab("Condition") + + geom_line(position=position_dodge(.1)) + + geom_point(position=position_dodge(.1)) + if (twolevel){ + Q = Q + facet_wrap( ~ groupindicator2,ncol=ceiling(sqrt(length(levels(groupindicator2)))) ) + } + + print(Q) + } + + return(plot.func(row=plotrow)) +} + +## FILTER + +Circ.filter <- function(circ=circ,linear=linear,Nreplicates=3,filter.sample=4,filter.count=5,percentage=1, circle_description=c(1:3)){ + del_row=c() + for ( i in 1:nrow(circ) ){ + if ( sum(circ[i,-circle_description]>=filter.count) 0){ + new_dat=circ[-del_row,] + return(new_dat) + } else { + return(circ) + } +} + +circ_max_perc <- function(circ=circ,linear=linear,Nreplicates=3){ + # convert to vector + circ = as.numeric(circ) + linear = as.numeric(linear) + if( length(circ) != length(linear) ){ + stop ('Number of samples in circRNA is not equal to Hostgene.') + } + Ngroups = length(circ)/Nreplicates + # calculate percentage + circ_sum = unname(tapply(circ, (seq_along(1:length(circ))-1) %/% Nreplicates, sum )) + linear_sum = unname(tapply(linear, (seq_along(1:length(linear))-1) %/% Nreplicates, sum )) + perc = max(circ_sum / (circ_sum+linear_sum),na.rm=T) + return(perc) +} + +## CIRC TEST + +Circ.test <- function(Circ, Linear, CircCoordinates=None, group, alpha=0.05, plotsig=T, circle_description = c(1:3)){ + + # Requre packge + require(aod) + + # check whether the input matrix are correct + if ( nrow(Circ)!=nrow(Linear) | ncol(Circ) != ncol(Linear)){ + stop('Circ data and Linear data are not matched, dimention different.') + } + + # A vector for pvalue and directions indicator + p.val <- c() + direction <- c() + + # groups + if ( length(group) != ncol(Circ)-length(circle_description) ){ + print(length(group)) + print(ncol(Circ)-length(circle_description)) + stop("length of 'group' must be equal to the number of samples of 'Circ' and 'Linear'. ") + } + group <- factor(group) + counter <- 0 + + ## test + # construct test matrix for each circRNA + + tmp_df = Circ[,FALSE] + + for (j in seq(1,length(unique(group)))){ + tmp_df[paste("group_",j,"_ratio_mean",sep="")] <- NA + } + + for ( i in rownames(Circ) ){ + counter <- counter+1 + + # total read counts vector + tot <- round( as.numeric(Linear[i,-circle_description]) + as.numeric(Circ[i,-circle_description]) ) + + # circRNA read counts + circ <- as.numeric(Circ[i,-circle_description]) + + # if there is 0 in the total count vector, the model will fail. So permute 0 to 1 + if ( 0 %in% tot ){ + tot[tot==0]=1 + } + + if (counter %% 1000 == 0){ + message(paste(counter, "candidates processed")) + } + + tmp_rations <- data.frame(Ratio=as.numeric(Circ[i,-circle_description])/(as.numeric(Linear[i,-circle_description])+as.numeric(Circ[i,-circle_description])), + group=group) + for (rep_group in seq(1,max(as.numeric(levels(group))),1)){ + tmp_df[i, paste("group_",rep_group,"_ratio_mean",sep="")] <- mean(na.omit(unlist(tmp_rations[tmp_rations\$group==rep_group,1]))) + } + + # Constract data frame + testdat = data.frame(tot,circ,group) + + ## do test + # Null model + fitNull <- betabin(cbind(circ,tot-circ) ~ 1, ~ 1, data=testdat) + # Alternative model + fitAlt <- betabin(cbind(circ,tot-circ) ~ group, ~ 1, data=testdat) + # test models + a <- anova(fitNull,fitAlt) + p.value <- a@anova.table[,11][2] + p.val <- c( p.val, p.value ) + } + message(paste(counter, "candidates processed in total")) + + Circ\$direction <- direction + p.adj <- p.adjust(p.val,n=sum(!is.na(p.val)),'BH') + # select significant ones + sig_dat <- Circ[p.adj<=alpha & !is.na(p.adj),] + sig_ratios <- tmp_df[p.adj<=alpha & !is.na(p.adj),] + sig_p <- p.adj[p.adj<=alpha & !is.na(p.adj)] + + # sort by p-val + sig_dat <- sig_dat[order(sig_p),] + sig_ratios <- sig_ratios[order(sig_p),] + sig_p <- sort(sig_p) + + # A summary table + if (missing(CircCoordinates)){ + summary_table <- data.frame(sig_dat[,circle_description],sig_p,sig_dat[,circle_description]) + + rownames(summary_table) <- rownames(sig_dat) + names(summary_table) <- c(names(sig_dat)[circle_description],"sig_p",names(sig_ratios)[circle_description]) + } else { + summary_table <- cbind(CircCoordinates[rownames(sig_dat),],sig_p,sig_ratios) + colnames(summary_table) <- c(colnames(CircCoordinates),"sig_p",colnames(sig_ratios)) + } + + message(paste(nrow(summary_table), "candidates passed the specified thresholds")) + + # return all objects in a list + return(list(summary_table=summary_table, + sig.dat=sig_dat, + p.val=p.val, + p.adj=p.adj, + sig_p=sig_p, + ratios=sig_ratios + ) + ) +} + +## MAIN + +circs = read.table("${circ_counts}", header=T, sep="\\t") +genes = read.table("${gene_counts}", header=T, sep="\\t") +pheno = read.csv ("${phenotype}" , header=T, row.names = "sample") + +circs <- Circ.filter(circ = circs, linear = genes, filter.sample = 2, filter.count = 5, percentage = 0.00001) +genes <- genes[rownames(circs),] + +description <- c(1) +pheno <- pheno[colnames(circs[,-description]),,drop=FALSE] + +test <- Circ.test(circs, genes, group=as.numeric(as.factor(pheno\$condition)), circle_description = description) +write.table(test\$summary_table, "${prefix}_summary.txt", row.names=F) + + +pdf("circ_linear_ratio_plots.pdf", width = 8, height = 10) +for (i in rownames(test\$summary_table)) { + Circ.ratioplot(circs, genes, plotrow=i, groupindicator1=pheno\$condition, + lab_legend = 'condition', circle_description = description ) +} +dev.off() + +pdf("circ_linear_line_plots.pdf", width = 8, height = 10) +for (i in rownames(test\$summary_table)) { + Circ.lineplot(circs, genes, plotrow=i, groupindicator1=pheno\$condition, + circle_description = description ) +} +dev.off() + + +################################################ +################################################ +## VERSIONS FILE ## +################################################ +################################################ + +r.version <- strsplit(version[['version.string']], ' ')[[1]][3] + +writeLines( + c( + '"${task.process}":', + paste(' r-base:', r.version), + paste(' aod:', packageVersion('aod')), + paste(' plyr:', packageVersion('plyr')), + paste(' ggplot2:', packageVersion('ggplot2')) + ), +'versions.yml') + +################################################ +################################################ +################################################ +################################################ diff --git a/modules/local/circtest/prepare/environment.yml b/modules/local/circtest/prepare/environment.yml new file mode 100644 index 000000000..02becc7cb --- /dev/null +++ b/modules/local/circtest/prepare/environment.yml @@ -0,0 +1,5 @@ +name: circtest_prepare +channels: + - conda-forge +dependencies: + - conda-forge::r-base=4.2.1 diff --git a/modules/local/circtest/prepare/main.nf b/modules/local/circtest/prepare/main.nf new file mode 100644 index 000000000..496fe6afc --- /dev/null +++ b/modules/local/circtest/prepare/main.nf @@ -0,0 +1,21 @@ +process CIRCTEST_PREPARE { + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "biocontainers/r-base:4.2.1" + + input: + tuple val(meta), path(gene_counts), path(circ_counts) + + output: + tuple val(meta), path('*_genes.tsv'), path('*_circs.tsv'), emit: counts, optional: true + + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + prefix = task.ext.prefix ?: meta.id + template 'prepare.R' +} diff --git a/modules/local/circtest/prepare/templates/prepare.R b/modules/local/circtest/prepare/templates/prepare.R new file mode 100644 index 000000000..d5dcdebb0 --- /dev/null +++ b/modules/local/circtest/prepare/templates/prepare.R @@ -0,0 +1,39 @@ +#!/usr/bin/env Rscript + +circ <- read.table("${circ_counts}", header=T, sep="\\t", check.names = FALSE) +gene <- read.table("${gene_counts}", header=T, sep="\\t", check.names = FALSE, row.names = 1) + +gene <- gene[circ\$gene_id, ] + +rownames(circ) <- circ\$tx +rownames(gene) <- rownames(circ) +circ\$tx <- NULL + +if (nrow(circ) != nrow(gene)) { + stop("Number of rows in circ and gene counts do not match") +} + +if (nrow(circ) > 0) { + write.table(circ, "${prefix}_circs.tsv", sep="\\t", quote=F, row.names=T) + write.table(gene, "${prefix}_genes.tsv", sep="\\t", quote=F, row.names=T) +} + +################################################ +################################################ +## VERSIONS FILE ## +################################################ +################################################ + +r.version <- strsplit(version[['version.string']], ' ')[[1]][3] + +writeLines( + c( + '"${task.process}":', + paste(' r-base:', r.version) + ), +'versions.yml') + +################################################ +################################################ +################################################ +################################################ diff --git a/modules/local/ciriquant/Dockerfile b/modules/local/ciriquant/Dockerfile new file mode 100644 index 000000000..cbfa3525a --- /dev/null +++ b/modules/local/ciriquant/Dockerfile @@ -0,0 +1,4 @@ +FROM community.wave.seqera.io/library/bioconductor-edger_bwa_hisat2_pysam_pruned:f14fb8726c7f0cf8 + +# Install custom fork +RUN pip install git+https://github.com/nictru/CIRIquant.git@e4916ca7b3370cef54d76ca162be64792d8c1b16 diff --git a/modules/local/ciriquant/ciriquant/main.nf b/modules/local/ciriquant/ciriquant/main.nf new file mode 100644 index 000000000..8c28130e2 --- /dev/null +++ b/modules/local/ciriquant/ciriquant/main.nf @@ -0,0 +1,65 @@ +process CIRIQUANT { + tag "$meta.id" + label 'process_high' + + container "docker.io/nicotru/ciriquant:1.0.4" + + input: + tuple val(meta), path(reads) + tuple val(meta2), path(bed) + tuple val(meta3), path(gtf) + tuple val(meta4), path(fasta) + tuple val(meta5), path(bwa) + tuple val(meta6), path(hisat2) + + output: + tuple val(meta), path("${prefix}/${prefix}.gtf") , emit: gtf + tuple val(meta), path("${prefix}/gene/${prefix}_genes.list"), emit: gene_list, optional: true + tuple val(meta), path("${prefix}/gene/${prefix}_out.gtf") , emit: gene_gtf, optional: true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def VERSION = '2.1.0' + def strandedness = meta.strandedness ?: 'auto' + def library_type = strandedness == 'auto' ? '' : strandedness == 'unstranded' ? '-l 0' : strandedness == 'forward' ? '-l 1' : '-l 2' + def reads_string = meta.single_end ? "-r ${reads}" : "-1 ${reads[0]} -2 ${reads[1]}" + def bed_string = bed ? "--bed ${bed}" : '' + """ + BWA=`which bwa` + HISAT2=`which hisat2` + STRINGTIE=`which stringtie` + SAMTOOLS=`which samtools` + + BWA_FILE=`ls ${bwa}/*.bwt` + BWA_PREFIX=`basename \$BWA_FILE .bwt` + + HISAT2_FILE=`ls ${hisat2}/*.1.ht2` + HISAT2_PREFIX=`basename \$HISAT2_FILE .1.ht2` + + printf "name: ciriquant\\ntools:\\n bwa: \$BWA\\n hisat2: \$HISAT2\\n stringtie: \$STRINGTIE\\n samtools: \$SAMTOOLS\\n\\nreference:\\n fasta: ${fasta}\\n gtf: ${gtf}\\n bwa_index: ${bwa}/\$BWA_PREFIX\\n hisat_index: ${hisat2}/\$HISAT2_PREFIX" > config.yml + + CIRIquant \\ + -t ${task.cpus} \\ + ${reads_string} \\ + ${bed_string} \\ + --config config.yml \\ + -o ${prefix} \\ + -p ${prefix} \\ + ${library_type} \\ + ${args} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bwa: \$(echo \$(bwa 2>&1) | sed 's/^.*Version: //; s/Contact:.*\$//') + ciriquant: \$(echo \$(CIRIquant --version 2>&1) | sed 's/CIRIquant //g' ) + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + stringtie: \$(stringtie --version 2>&1) + hisat2: $VERSION + END_VERSIONS + """ +} diff --git a/modules/local/ciriquant/de/main.nf b/modules/local/ciriquant/de/main.nf new file mode 100644 index 000000000..3795151e9 --- /dev/null +++ b/modules/local/ciriquant/de/main.nf @@ -0,0 +1,35 @@ +process CIRIQUANT_DE { + tag "$meta.id" + label 'process_high' + + container "docker.io/nicotru/ciriquant:1.0.4" + + input: + tuple val(meta), path(library), path(expression), path(gene) + + output: + tuple val(meta), path("${circ_path}"), emit: circ, optional: true + tuple val(meta), path("${gene_path}"), emit: gene, optional: true + path "versions.yml", emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + prefix = task.ext.prefix ?: "${meta.id}" + circ_path = "${prefix}.circ.csv" + gene_path = "${prefix}.gene.csv" + """ + CIRI_DE_replicate \\ + --lib ${library} \\ + --bsj ${expression} \\ + --gene ${gene} \\ + --out ${circ_path} \\ + --out2 ${gene_path} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + ciriquant: \$(echo \$(CIRIquant --version 2>&1) | sed 's/CIRIquant //g' ) + END_VERSIONS + """ +} diff --git a/modules/local/ciriquant/prepde/main.nf b/modules/local/ciriquant/prepde/main.nf new file mode 100644 index 000000000..fda4f2c3b --- /dev/null +++ b/modules/local/ciriquant/prepde/main.nf @@ -0,0 +1,42 @@ +process CIRIQUANT_PREPDE { + tag "$meta.id" + label 'process_high' + + container "docker.io/nicotru/ciriquant:1.0.4" + + input: + tuple val(meta), val(samples), path(gtfs), val(conditions) + + output: + tuple val(meta), path("${prefix}_library.tsv") , emit: library + tuple val(meta), path("${prefix}_annotation.tsv"), emit: annotation + tuple val(meta), path("${prefix}_expression.tsv"), emit: expression + tuple val(meta), path("${prefix}_ratio.tsv") , emit: gene + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + samplesheet = [samples, gtfs, conditions] + .transpose() + .collect{ sample, gtf, condition -> + "${sample}\\t${gtf}\\t${condition}" }.join('\\n') + """ + echo -e "${samplesheet}" > samples.txt + + prep_CIRIquant -i samples.txt \\ + --lib ${prefix}_library.tsv \\ + --circ ${prefix}_annotation.tsv \\ + --bsj ${prefix}_expression.tsv \\ + --ratio ${prefix}_ratio.tsv \\ + ${args} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + ciriquant: \$(echo \$(CIRIquant --version 2>&1) | sed 's/CIRIquant //g' ) + END_VERSIONS + """ +} diff --git a/modules/local/combinebeds/counts/environment.yml b/modules/local/combinebeds/counts/environment.yml new file mode 100644 index 000000000..57f25392c --- /dev/null +++ b/modules/local/combinebeds/counts/environment.yml @@ -0,0 +1,6 @@ +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::polars=1.8.2 + - conda-forge::upsetplot=0.9.0 diff --git a/modules/local/combinebeds/counts/main.nf b/modules/local/combinebeds/counts/main.nf new file mode 100644 index 000000000..bcf8cd97d --- /dev/null +++ b/modules/local/combinebeds/counts/main.nf @@ -0,0 +1,23 @@ +process COMBINEBEDS_COUNTS { + tag "$meta.id" + label "process_low" + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'oras://community.wave.seqera.io/library/pandas_polars_pyarrow_upsetplot:8840b96e156438fc' : + 'community.wave.seqera.io/library/pandas_polars_pyarrow_upsetplot:6982d93f61d3e2ff' }" + + input: + tuple val(meta), val(aggregation), path(candidates), path(beds) + val(max_shift) + val(consider_strand) + + output: + tuple val(meta), path("${prefix}.${suffix}"), emit: combined, optional: true + path "versions.yml" , emit: versions + + script: + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "tsv" + template "counts.py" +} diff --git a/modules/local/combinebeds/counts/templates/counts.py b/modules/local/combinebeds/counts/templates/counts.py new file mode 100644 index 000000000..679c1778a --- /dev/null +++ b/modules/local/combinebeds/counts/templates/counts.py @@ -0,0 +1,87 @@ +#!/usr/bin/env python + +import platform +import base64 +import json + +import polars as pl + +def format_yaml_like(data: dict, indent: int = 0) -> str: + """Formats a dictionary to a YAML-like string. + + Args: + data (dict): The dictionary to format. + indent (int): The current indentation level. + + Returns: + str: A string formatted as YAML. + """ + yaml_str = "" + for key, value in data.items(): + spaces = " " * indent + if isinstance(value, dict): + yaml_str += f"{spaces}{key}:\\n{format_yaml_like(value, indent + 1)}" + else: + yaml_str += f"{spaces}{key}: {value}\\n" + return yaml_str + +max_shift = int("${max_shift}") +consider_strand = "${consider_strand}" == "true" +aggregation = "${aggregation}" +meta_id = "${meta.id}" +prefix = "${prefix}" +suffix = "${suffix}" + +candidate_path = "${candidates}" +bed_paths = "${beds}".split() + +columns = ["chr", "start", "end", "name", "score", "strand"] + +df_candidates = pl.scan_csv(candidate_path, has_header=False, separator="\\t", new_columns=columns) +df_candidates = df_candidates.select(columns) +df_candidates = df_candidates.with_columns(sample=pl.lit("candidate"), tool=pl.lit("candidate"), score=pl.lit(None)) + +df = pl.scan_csv(bed_paths, has_header=False, separator="\\t", new_columns=columns + ["sample", "tool"]) +df_combined = pl.concat([df, df_candidates]) + +df_combined = df_combined.sort("end" ).with_columns(end_group =pl.col("end" ).diff().fill_null(0).gt(max_shift).cum_sum()) +df_combined = df_combined.sort("start").with_columns(start_group=pl.col("start").diff().fill_null(0).gt(max_shift).cum_sum()) + +df_candidates = df_combined.filter(pl.col("sample") == "candidate") +df = df_combined.filter(pl.col("sample") != "candidate") + +group_cols = ["chr", "start_group", "end_group"] + (["strand"] if consider_strand else []) +df = df.join(df_candidates, on=group_cols, how="inner") +df = df.filter((pl.col("start") - pl.col("start_right")).abs() <= max_shift) +df = df.filter((pl.col("end") - pl.col("end_right")).abs() <= max_shift) + +df = df.select(["chr", "start", "end", "strand", "start_group", "end_group", "sample", "tool", "score"]) + +df = df.group_by(["chr", "strand", "start_group", "end_group", "start", "end"]).len().join(df, on=group_cols, how="inner") + +df = df.filter((pl.col("start") - pl.col("start_right")).abs() <= max_shift) +df = df.filter((pl.col("end") - pl.col("end_right")).abs() <= max_shift) +df = df.group_by(["chr", "start", "end", "strand", "start_group", "end_group", "sample", "tool"]).agg(score=pl.sum("score")) +df = df.collect().lazy() + +samples = df.select("sample").group_by("sample").len().collect()["sample"].to_list() +df = df.collect().pivot(on="sample", values="score", index=["chr", "start", "end", "strand", "start_group", "end_group"], aggregate_function=aggregation).lazy() +df = df.group_by(["chr", "strand", "start_group", "end_group"] + samples).agg(start=pl.col("start").first(), end=pl.col("end").first()) +df = df.with_columns(id=pl.col("chr") + pl.lit(":") + pl.col("start").cast(str) + pl.lit("-") + pl.col("end").cast(str) + pl.lit(":") + pl.col("strand")) +df = df.sort("chr", "start", "end", "strand") +df = df.select(["id"] + samples) +df = df.fill_null(0) + +df.sink_csv(f"{prefix}.{suffix}", separator="\\t", include_header=True) + +# Versions + +versions = { + "${task.process}": { + "python": platform.python_version(), + "polars": pl.__version__ + } +} + +with open("versions.yml", "w") as f: + f.write(format_yaml_like(versions)) diff --git a/modules/local/combinebeds/filter/environment.yml b/modules/local/combinebeds/filter/environment.yml new file mode 100644 index 000000000..57f25392c --- /dev/null +++ b/modules/local/combinebeds/filter/environment.yml @@ -0,0 +1,6 @@ +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::polars=1.8.2 + - conda-forge::upsetplot=0.9.0 diff --git a/modules/local/combinebeds/filter/main.nf b/modules/local/combinebeds/filter/main.nf new file mode 100644 index 000000000..f76abf18f --- /dev/null +++ b/modules/local/combinebeds/filter/main.nf @@ -0,0 +1,27 @@ +process COMBINEBEDS_FILTER { + tag "$meta.id" + label "process_low" + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'oras://community.wave.seqera.io/library/pandas_polars_pyarrow_upsetplot:8840b96e156438fc' : + 'community.wave.seqera.io/library/pandas_polars_pyarrow_upsetplot:6982d93f61d3e2ff' }" + + input: + tuple val(meta), path(beds) + val(max_shift) + val(consider_strand) + val(min_tools) + val(min_samples) + + output: + tuple val(meta), path("${prefix}.${suffix}"), emit: combined, optional: true + path "*.png" , emit: plots, optional: true + path "*.json" , emit: multiqc, optional: true + path "versions.yml" , emit: versions + + script: + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "bed" + template "filter.py" +} diff --git a/modules/local/combinebeds/filter/templates/filter.py b/modules/local/combinebeds/filter/templates/filter.py new file mode 100644 index 000000000..4c3fdd40a --- /dev/null +++ b/modules/local/combinebeds/filter/templates/filter.py @@ -0,0 +1,116 @@ +#!/usr/bin/env python + +import platform +import base64 +import json + +import polars as pl +import upsetplot +import matplotlib +import matplotlib.pyplot as plt + +def format_yaml_like(data: dict, indent: int = 0) -> str: + """Formats a dictionary to a YAML-like string. + + Args: + data (dict): The dictionary to format. + indent (int): The current indentation level. + + Returns: + str: A string formatted as YAML. + """ + yaml_str = "" + for key, value in data.items(): + spaces = " " * indent + if isinstance(value, dict): + yaml_str += f"{spaces}{key}:\\n{format_yaml_like(value, indent + 1)}" + else: + yaml_str += f"{spaces}{key}: {value}\\n" + return yaml_str + +max_shift = int("${max_shift}") +consider_strand = "${consider_strand}" == "true" +min_tools = int("${min_tools}") +min_samples = int("${min_samples}") +meta_id = "${meta.id}" +prefix = "${prefix}" + +df = pl.scan_csv("*.bed", + separator="\\t", + has_header=False, + new_columns=["chr", "start", "end", "name", "score", "strand", "sample", "tool"]) + +df = df.group_by("chr", "start", "end", "strand").agg(tools=pl.col("tool").unique(), samples=pl.col("sample").unique()) + +df = df.sort("end" ).with_columns(end_group =pl.col("end" ).diff().fill_null(0).gt(max_shift).cum_sum()) +df = df.sort("start").with_columns(start_group=pl.col("start").diff().fill_null(0).gt(max_shift).cum_sum()) + +group_cols = ["chr", "start_group", "end_group"] + (["strand"] if consider_strand else []) +df = df.join(df, on=group_cols, how="inner") +df = df.filter((pl.col("start") - pl.col("start_right")).abs() <= max_shift) +df = df.filter((pl.col("end") - pl.col("end_right")).abs() <= max_shift) + +df = df.select(["chr", "start", "end", "strand", "samples_right", "tools_right"]) +df = df.group_by(["chr", "start", "end", "strand"]).agg(**{ + "samples": pl.col("samples_right").flatten().unique(), + "tools": pl.col("tools_right").flatten().unique() +}).with_columns(n_samples=pl.col("samples").map_elements(lambda x: len(x), return_dtype=int), + n_tools=pl.col("tools").map_elements(lambda x: len(x), return_dtype=int)) + +df = df.collect() +df = df.with_columns(name=pl.lit("FUSIONJUNC_") + pl.arange(0, len(df)).cast(str) + pl.lit("/0"), + score=pl.lit(".")) + +df_aggregated = df.to_pandas() +n_bsjs = len(df_aggregated) + +df_filtered = df_aggregated[(df_aggregated["n_tools"] >= min_tools) & (df_aggregated["n_samples"] >= min_samples)] +df_filtered = df_filtered[["chr", "start", "end", "name", "score", "strand"]] + +df_filtered.to_csv("${prefix}.${suffix}", sep="\\t", header=False, index=False) + +for col in ["samples", "tools"]: + series = df_aggregated[col] + if series.explode().nunique() <= 1: + continue + memberships = series.to_list() + dataset = upsetplot.from_memberships(memberships) + upsetplot.plot(dataset, + orientation='horizontal', + show_counts=True, + subset_size="count", + min_degree=2, + min_subset_size=min(50, int(n_bsjs * 0.02))) + plot_file = f"{prefix}_{col}.upset.png" + plt.savefig(plot_file) + + image_string = base64.b64encode(open(plot_file, "rb").read()).decode("utf-8") + image_html = f'
' + + multiqc = { + 'id': f"{meta_id}_upset_{col}", + 'parent_id': "upset_plots", + 'parent_name': 'UpSet Plots', + 'parent_description': 'UpSet plots showing the overlap between tools for each sample', + 'section_name': f'UpSet {col}: {meta_id} ', + 'description': f'UpSet plot showing the overlap between {col} for {meta_id}', + 'plot_type': 'image', + 'data': image_html + } + + with open(f"{prefix}_{col}.upset_mqc.json", "w") as f: + f.write(json.dumps(multiqc, indent=4)) + +# Versions + +versions = { + "${task.process}": { + "python": platform.python_version(), + "polars": pl.__version__, + "upsetplot": upsetplot.__version__, + "matplotlib": matplotlib.__version__ + } +} + +with open("versions.yml", "w") as f: + f.write(format_yaml_like(versions)) diff --git a/modules/local/combinebeds/shifts/environment.yml b/modules/local/combinebeds/shifts/environment.yml new file mode 100644 index 000000000..5f93bc08b --- /dev/null +++ b/modules/local/combinebeds/shifts/environment.yml @@ -0,0 +1,7 @@ +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::polars=1.8.2 + - conda-forge::altair=5.5.0 + - conda-forge::vl-convert-python==1.7.0 diff --git a/modules/local/combinebeds/shifts/main.nf b/modules/local/combinebeds/shifts/main.nf new file mode 100644 index 000000000..56cdee3d2 --- /dev/null +++ b/modules/local/combinebeds/shifts/main.nf @@ -0,0 +1,21 @@ +process COMBINEBEDS_SHIFTS { + tag "$meta.id" + label "process_low" + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'oras://community.wave.seqera.io/library/altair_polars_vl-convert-python:e6f1dca28de76d13' : + 'community.wave.seqera.io/library/altair_polars_vl-convert-python:a6c5ee679445250d' }" + + input: + tuple val(meta), path(beds) + + output: + path "*.png" , emit: plots + path "*.json" , emit: multiqc + path "versions.yml", emit: versions + + script: + prefix = task.ext.prefix ?: "${meta.id}" + template "shifts.py" +} diff --git a/modules/local/combinebeds/shifts/templates/shifts.py b/modules/local/combinebeds/shifts/templates/shifts.py new file mode 100644 index 000000000..e8b25f853 --- /dev/null +++ b/modules/local/combinebeds/shifts/templates/shifts.py @@ -0,0 +1,120 @@ +#!/usr/bin/env python + +import platform +import base64 +import json +from itertools import product + +import polars as pl +import altair as alt + +def format_yaml_like(data: dict, indent: int = 0) -> str: + """Formats a dictionary to a YAML-like string. + + Args: + data (dict): The dictionary to format. + indent (int): The current indentation level. + + Returns: + str: A string formatted as YAML. + """ + yaml_str = "" + for key, value in data.items(): + spaces = " " * indent + if isinstance(value, dict): + yaml_str += f"{spaces}{key}:\\n{format_yaml_like(value, indent + 1)}" + else: + yaml_str += f"{spaces}{key}: {value}\\n" + return yaml_str + +meta_id = "${meta.id}" + +df = pl.scan_csv("${beds}".split(" "), + separator="\\t", + has_header=False, + new_columns=["chr", "start", "end", "name", "score", "strand", "sample", "tool"]) + +df = df.group_by("chr", "start", "end", "strand").agg(tools=pl.col("tool").unique(), samples=pl.col("sample").unique()) + +def get_group_sizes(df: pl.LazyFrame, max_shift: int, consider_strand: bool) -> pl.LazyFrame: + df = df.sort("end" ).with_columns(end_group =pl.col("end" ).diff().fill_null(0).gt(max_shift).cum_sum()) + df = df.sort("start").with_columns(start_group=pl.col("start").diff().fill_null(0).gt(max_shift).cum_sum()) + + group_cols = ["chr", "start_group", "end_group"] + (["strand"] if consider_strand else []) + df = df.join(df, on=group_cols, how="inner") + df = df.filter((pl.col("start") - pl.col("start_right")).abs() <= max_shift) + df = df.filter((pl.col("end") - pl.col("end_right")).abs() <= max_shift) + df = df.select(["chr", "start", "end", "strand", "samples_right", "tools_right"]) + df = df.group_by(["chr", "start", "end", "strand"]).agg(**{ + "samples": pl.col("samples_right").flatten().unique(), + "tools": pl.col("tools_right").flatten().unique() + }).with_columns(n_samples=pl.col("samples").map_elements(lambda x: len(x), return_dtype=int), + n_tools=pl.col("tools").map_elements(lambda x: len(x), return_dtype=int)) + + df_sample_counts = (df.group_by("n_samples").agg(count=pl.col("n_samples").count()) + .sort("n_samples") + .rename({"n_samples": "value"}) + .with_columns(metric=pl.lit("n_samples"))) + df_tool_counts = (df.group_by("n_tools").agg(count=pl.col("n_tools").count()) + .sort("n_tools") + .rename({"n_tools": "value"}) + .with_columns(metric=pl.lit("n_tools"))) + + df = (pl.concat([df_sample_counts, df_tool_counts]) + .with_columns(max_shift=max_shift, consider_strand=consider_strand)) + + return df + +shifts = [0, 1, 2, 3, 4, 5, 10, 20, 50] +consider_strands = [True, False] + +dfs = [] +for max_shift, consider_strand in product(shifts, consider_strands): + df_ = get_group_sizes(df, max_shift, consider_strand) + dfs.append(df_.collect()) + +df = pl.concat(dfs).with_columns(max_shift=pl.col("max_shift")) + +metrics = { + "n_samples": "Number of samples", + "n_tools": "Number of tools" +} + +for metric, title in metrics.items(): + n_unique = df.filter(pl.col("metric") == metric).select("value").n_unique("value") + df_ = df.filter(pl.col("metric") == metric) + plot = df_.plot.bar(x="max_shift:N", y="count", color=f"value:{("Q" if n_unique > 10 else "N")}", column="consider_strand") + plot = plot.properties(title=title) + + plot_file = f"{metric}.png" + plot.save(plot_file) + + image_string = base64.b64encode(open(plot_file, "rb").read()).decode("utf-8") + image_html = f'
' + + multiqc = { + 'id': f"{meta_id}_shifts_{metric}", + 'parent_id': "shift_plots", + 'parent_name': 'Shift Plots', + 'parent_description': 'Stacked bar plots showing the agreement between tools and samples for different shift values', + 'section_name': title, + 'description': f'Stacked bar plot showing the agreement between tools and samples for different shift values, {"considering" if consider_strand else "ignoring"} strand', + 'plot_type': 'image', + 'data': image_html + } + + with open(f"{metric}.shifts_mqc.json", "w") as f: + f.write(json.dumps(multiqc, indent=4)) + +# Versions + +versions = { + "${task.process}": { + "python": platform.python_version(), + "polars": pl.__version__, + "altair": alt.__version__ + } +} + +with open("versions.yml", "w") as f: + f.write(format_yaml_like(versions)) diff --git a/modules/local/compute_correlations/environment.yml b/modules/local/compute_correlations/environment.yml new file mode 100644 index 000000000..efe728347 --- /dev/null +++ b/modules/local/compute_correlations/environment.yml @@ -0,0 +1,7 @@ +name: "compute_correlations" +channels: + - conda-forge + - defaults + - bioconda +dependencies: + - "bioconda::bioconductor-fishpond=2.8.0--r43hdfd78af_0" diff --git a/modules/local/compute_correlations/main.nf b/modules/local/compute_correlations/main.nf new file mode 100644 index 000000000..4a72b5eb8 --- /dev/null +++ b/modules/local/compute_correlations/main.nf @@ -0,0 +1,29 @@ +process COMPUTE_CORRELATIONS { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bioconductor-fishpond:2.8.0--r43hdfd78af_0' : + 'biocontainers/bioconductor-fishpond:2.8.0--r43hdfd78af_0' }" + + input: + tuple val(meta), path(bindingsites) + tuple val(meta2), path(mirna_expression) + tuple val(meta3), path(transcript_rds) + + output: + tuple val(meta), path("*.tsv"), emit: correlations, optional: true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + template 'compute_correlations.R' + + stub: + """ + touch ${meta.id}.circrna_correlation.tsv + """ +} diff --git a/modules/local/compute_correlations/templates/compute_correlations.R b/modules/local/compute_correlations/templates/compute_correlations.R new file mode 100644 index 000000000..d9976226d --- /dev/null +++ b/modules/local/compute_correlations/templates/compute_correlations.R @@ -0,0 +1,62 @@ +#!/usr/bin/env Rscript + +library(fishpond) +suppressMessages(library(SummarizedExperiment)) + +tx_expression <- readRDS('${transcript_rds}') +mi_expression <- read.table('${mirna_expression}', header=TRUE, row.names=1, sep='\\t') +interactions <- read.table('${bindingsites}', sep='\\t') + +tx_expression <- scaleInfReps(tx_expression) +tx_expression <- labelKeep(tx_expression) # Here one can perform custom filtering + +if (!any(mcols(tx_expression)\$keep)) { + stop('No transcripts left after filtering') +} + +result_cols <- c('stat', 'log2FC', 'pvalue', 'locfdr', 'qvalue') + +# Iterate rows of interactions +for (i in 1:nrow(interactions)) { + # Get miRNA and target gene + miRNA <- interactions[i, 1] + targets <- unlist(strsplit(interactions[i, 2], ',')) + + mirna_expression <- mi_expression[miRNA,] + transcript_expression <- tx_expression[targets,] + + if (!any(mcols(transcript_expression)\$keep)) { + print(paste('No transcripts left after filtering for miRNA', miRNA)) + next + } + + # Add miRNA expression to colData so that it can be used for correlation + colData(transcript_expression) <- cbind( + colData(transcript_expression), + t(mirna_expression[, rownames(colData(transcript_expression))]) + ) + + result <- rowData(swish(transcript_expression, miRNA, cor = "${params.mirna_correlation}"))[, result_cols] + result <- result[complete.cases(result), ] + write.table(result, paste0(miRNA, '.tsv'), sep = '\\t') +} + +################################################ +################################################ +## VERSIONS FILE ## +################################################ +################################################ + +r.version <- strsplit(version[['version.string']], ' ')[[1]][3] + +writeLines( + c( + '"${task.process}":', + paste(' r-base:', r.version) + ), +'versions.yml') + +################################################ +################################################ +################################################ +################################################ diff --git a/modules/local/dcc/main.nf b/modules/local/dcc/main.nf new file mode 100644 index 000000000..429d7dc59 --- /dev/null +++ b/modules/local/dcc/main.nf @@ -0,0 +1,62 @@ +process DCC { + tag "$meta.id" + label 'process_high' + + conda "bioconda::circtools=1.2.1" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/circtools:1.2.1--pyh7cba7a3_0' : + 'biocontainers/circtools:1.2.1--pyh7cba7a3_0' }" + + input: + tuple val(meta), path(pairs), path(mate1), path(mate2) + path fasta + path gtf + + output: + tuple val(meta), path("${prefix}.txt"), emit: txt + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def strandedness = meta.strandedness ?: 'auto' + def strand_args = strandedness == 'auto' || strandedness == 'unstranded' ? '-N' : strandedness == 'forward' ? '' : '-ss' + if(meta.single_end){ + """ + sed -i 's/^chr//g' $gtf + + mkdir ${prefix} && mv ${prefix}.Chimeric.out.junction ${prefix} && printf "${prefix}/${prefix}.Chimeric.out.junction" > samplesheet + + DCC @samplesheet -D -an $gtf -F -M -Nr 1 1 -A $fasta $strand_args -T ${task.cpus} + + awk '{print \$6}' CircCoordinates >> strand + paste CircRNACount strand | tail -n +2 | awk -v OFS="\\t" '{print \$1,\$2,\$3,\$5,\$4}' >> ${prefix}.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + dcc: \$(DCC --version) + END_VERSIONS + """ + }else{ + """ + sed -i 's/^chr//g' $gtf + + mkdir ${prefix} && mv ${prefix}.Chimeric.out.junction ${prefix} && printf "${prefix}/${prefix}.Chimeric.out.junction" > samplesheet + mkdir ${prefix}_mate1 && mv ${prefix}_mate1.Chimeric.out.junction ${prefix}_mate1 && printf "${prefix}_mate1/${prefix}_mate1.Chimeric.out.junction" > mate1file + mkdir ${prefix}_mate2 && mv ${prefix}_mate2.Chimeric.out.junction ${prefix}_mate2 && printf "${prefix}_mate2/${prefix}_mate2.Chimeric.out.junction" > mate2file + + DCC @samplesheet -mt1 @mate1file -mt2 @mate2file -D -an $gtf -Pi -F -M -Nr 1 1 -A $fasta $strand_args -T ${task.cpus} + + awk '{print \$6}' CircCoordinates >> strand + paste CircRNACount strand | tail -n +2 | awk -v OFS="\\t" '{print \$1,\$2,\$3,\$5,\$4}' >> ${prefix}.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + dcc: \$(DCC --version) + END_VERSIONS + """ + } +} diff --git a/modules/local/deseq2/normalization/environment.yml b/modules/local/deseq2/normalization/environment.yml new file mode 100644 index 000000000..8eb117c31 --- /dev/null +++ b/modules/local/deseq2/normalization/environment.yml @@ -0,0 +1,7 @@ +name: deseq2_normalization +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bioconductor-deseq2=1.34.0 diff --git a/modules/local/deseq2/normalization/main.nf b/modules/local/deseq2/normalization/main.nf new file mode 100644 index 000000000..74cb8b5a3 --- /dev/null +++ b/modules/local/deseq2/normalization/main.nf @@ -0,0 +1,32 @@ +process DESEQ2_NORMALIZATION { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bioconductor-deseq2:1.34.0--r41hc247a5b_3' : + 'biocontainers/bioconductor-deseq2:1.34.0--r41hc247a5b_3' }" + + input: + tuple val(meta), path(counts) + + output: + tuple val(meta), path("${meta.id}.normalized_counts.tsv"), emit: normalized + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + template 'deseq_normalization.R' + + stub: + """ + touch ${meta.id}.normalized_counts.tsv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bioconductor-deseq2: \$(Rscript -e "library(DESeq2); cat(as.character(packageVersion('DESeq2')))") + END_VERSIONS + """ +} diff --git a/modules/local/deseq2/normalization/templates/deseq_normalization.R b/modules/local/deseq2/normalization/templates/deseq_normalization.R new file mode 100644 index 000000000..91b366dc5 --- /dev/null +++ b/modules/local/deseq2/normalization/templates/deseq_normalization.R @@ -0,0 +1,50 @@ +#!/usr/bin/env Rscript + +library(DESeq2) + +raw_counts <- read.table("$counts", sep = "\\t", header = TRUE, stringsAsFactors = FALSE, check.names = FALSE) +samples <- colnames(raw_counts)[-c(1)] + +row.names(raw_counts) <- raw_counts\$miRNA +data <- raw_counts[, -1] +mirna_names <- data.frame(miRNA = raw_counts\$miRNA, order = seq_len(nrow(raw_counts))) + +# normalize using DeSeq2, Library Size Estimation +meta_data <- data.frame(samples) +row.names(meta_data) <- meta_data\$samples +all(colnames(data) %in% rownames(meta_data)) +all(colnames(data) == rownames(meta_data)) + +dds <- DESeqDataSetFromMatrix(countData = data, colData = meta_data, design = ~ 1) +dds <- estimateSizeFactors(dds) +sizeFactors(dds) +normalized_counts <- DESeq2::counts(dds, normalized = TRUE) + +# add miRNA IDs back to counts table +merged_data <- merge(mirna_names, normalized_counts, + by.x = "miRNA", by.y = "row.names") +merged_data <- merged_data[order(merged_data\$order), ] + +norm_data <- subset(merged_data, select = -c(order)) + +write.table(norm_data, paste0("${meta.id}.normalized_counts.tsv"), quote = FALSE, sep = "\\t", row.names = FALSE) + +# TODO: (Can be done later) Add support for Samplesheet so that we can eliminate batch effects + + +################################################ +################################################ +## VERSIONS FILE ## +################################################ +################################################ + +r.version <- strsplit(version[['version.string']], ' ')[[1]][3] +deseq2.version <- as.character(packageVersion('DESeq2')) + +writeLines( + c( + '"${task.process}":', + paste(' r-base:', r.version), + paste(' bioconductor-deseq2:', deseq2.version) + ), +'versions.yml') diff --git a/modules/local/find_circ/anchors/main.nf b/modules/local/find_circ/anchors/main.nf new file mode 100644 index 000000000..9bccb403b --- /dev/null +++ b/modules/local/find_circ/anchors/main.nf @@ -0,0 +1,31 @@ +process FIND_CIRC_ANCHORS { + tag "$meta.id" + label "process_high" + + conda "bioconda::find_circ=1.2" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/find_circ%3A1.2--hdfd78af_0' : + 'biocontainers/find_circ:1.2--hdfd78af_0' }" + + input: + tuple val(meta), path(bam) + + output: + tuple val(meta), path("${prefix}_anchors.qfa.gz"), emit: anchors + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + prefix = task.ext.prefix ?: "${meta.id}" + def VERSION = '1.2' + """ + unmapped2anchors.py $bam | gzip > ${prefix}_anchors.qfa.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + find_circ: $VERSION + END_VERSIONS + """ +} diff --git a/modules/local/find_circ/find_circ/main.nf b/modules/local/find_circ/find_circ/main.nf new file mode 100644 index 000000000..8a4ca128c --- /dev/null +++ b/modules/local/find_circ/find_circ/main.nf @@ -0,0 +1,53 @@ +process FIND_CIRC { + tag "$meta.id" + label "process_high" + + conda "bioconda::find_circ=1.2 bioconda::bowtie2" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/mulled-v2-c27e472038a09e49d9147bc52903e12836302c12:60ffb3b15a2c40c669f8d38382b1e6e4b065f5e4-0' : + 'biocontainers/mulled-v2-c27e472038a09e49d9147bc52903e12836302c12:60ffb3b15a2c40c669f8d38382b1e6e4b065f5e4-0' }" + + input: + tuple val(meta), path(anchors) + tuple val(meta2), path(index) + path fasta + + output: + tuple val(meta), path("${prefix}.sites.bed"), emit: bed + path("${prefix}.sites.reads") , emit: reads + path("${prefix}.sites.log") , emit: log + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + prefix = task.ext.prefix ?: "${meta.id}" + args = task.ext.args ?: "" + args2 = task.ext.args2 ?: "" + def strand_arg = meta.strandedness && (meta.strandedness == 'forward' || meta.strandedness == 'reverse') ? "--stranded" : "" + def VERSION = '1.2' + """ + INDEX=`find -L ./ -name "*.rev.1.bt2" | sed "s/.rev.1.bt2//"` + [ -z "\$INDEX" ] && INDEX=`find -L ./ -name "*.rev.1.bt2l" | sed "s/.rev.1.bt2l//"` + [ -z "\$INDEX" ] && echo "Bowtie2 index files not found" 1>&2 && exit 1 + + bowtie2 \\ + --threads $task.cpus \\ + --reorder \\ + --mm \\ + -D 20 \\ + --score-min=C,-15,0 \\ + -q \\ + -x \$INDEX \\ + $args \\ + -U $anchors | \\ + find_circ.py --genome=$fasta $strand_arg $args2 --prefix=${prefix} --stats=${prefix}.sites.log --reads=${prefix}.sites.reads > ${prefix}.sites.bed + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//') + find_circ: $VERSION + END_VERSIONS + """ +} diff --git a/modules/local/majority_vote/environment.yml b/modules/local/majority_vote/environment.yml new file mode 100644 index 000000000..262d8798a --- /dev/null +++ b/modules/local/majority_vote/environment.yml @@ -0,0 +1,7 @@ +name: annotation +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::polars=1.5.0 + - conda-forge::pyyaml=6.0.2 diff --git a/modules/local/majority_vote/main.nf b/modules/local/majority_vote/main.nf new file mode 100644 index 000000000..33f417ba2 --- /dev/null +++ b/modules/local/majority_vote/main.nf @@ -0,0 +1,35 @@ +process MAJORITY_VOTE { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'oras://community.wave.seqera.io/library/polars_pyyaml:962a0cf7480258c7' : + 'community.wave.seqera.io/library/polars_pyyaml:ad93db0d7bcd508e' }" + + input: + tuple val(meta), path(bindingsites) + + output: + tuple val(meta), path("${meta.id}.majority.tsv"), emit: tsv + tuple val(meta), path("${meta.id}.targets.tsv") , emit: targets + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + min_tools = params.mirna_min_tools + template 'majority.py' + + stub: + """ + touch ${meta.id}.majority.tsv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + python: \$(python --version | sed 's/Python //g') + pandas: \$(python -c "import pandas; print(pandas.__version__)") + END_VERSIONS + """ +} diff --git a/modules/local/majority_vote/templates/majority.py b/modules/local/majority_vote/templates/majority.py new file mode 100644 index 000000000..4812301ad --- /dev/null +++ b/modules/local/majority_vote/templates/majority.py @@ -0,0 +1,41 @@ +#!/usr/bin/env python3 + +import platform + +import polars as pl +import yaml + +paths = "${bindingsites}".split(" ") + +df = pl.scan_csv(paths, + separator="\\t", + has_header=False, + new_columns=['mirna', 'target', 'start', 'end', 'tool']) + +df = df.select(["mirna", "target", "tool"]) + +df = df.group_by(['mirna', 'target']).agg(pl.col("tool").n_unique()) + +df = df.filter(pl.col("tool") > int("${min_tools}")) \ + .select(["mirna", "target"]) + +df = df.collect() + +df.write_csv('${meta.id}.majority.tsv', separator='\\t', include_header=False) + +# Create targets file + +df = df.group_by('mirna').agg(pl.col("target").str.concat(",")) + +df.write_csv('${meta.id}.targets.tsv', separator='\\t', include_header=False) + +# Create version file +versions = { + "${task.process}" : { + "python": platform.python_version(), + "polars": pl.__version__, + } +} + +with open("versions.yml", "w") as f: + f.write(yaml.dump(versions)) diff --git a/modules/local/mapsplice/align/main.nf b/modules/local/mapsplice/align/main.nf new file mode 100644 index 000000000..a90930d6e --- /dev/null +++ b/modules/local/mapsplice/align/main.nf @@ -0,0 +1,75 @@ +process MAPSPLICE_ALIGN { + tag "$meta.id" + label 'process_high' + + conda "bioconda::mapsplice=2.2.1" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/mapsplice:2.2.1--py27h07887db_0': + 'biocontainers/mapsplice:2.2.1--py27h07887db_0' }" + + input: + tuple val(meta), path(reads) + path bowtie_index + tuple val(meta2), path(chromosomes, stageAs: 'chromosomes/*') + path gtf + + output: + tuple val(meta), path("${prefix}/fusions_raw.txt"), emit: raw_fusions + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def VERSION = 'v2.2.1' + def gtf_prefix = gtf.toString() - ~/.gtf/ + if(meta.single_end){ + def handleGzip_R1 = reads[0].getExtension() == 'gz' ? "gzip -d -f ${reads[0]}" : '' + def read1 = reads[0].getExtension() == 'gz' ? reads[0].toString() - ~/.gz/ : reads[0] + """ + $handleGzip_R1 + + mapsplice.py \\ + -c chromosomes \\ + -x $gtf_prefix \\ + -1 ${read1} \\ + -p ${task.cpus} \\ + --bam \\ + --gene-gtf $gtf \\ + -o $prefix \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + mapsplice: $VERSION + END_VERSIONS + """ + } else { + def handleGzip_R1 = reads[0].getExtension() == 'gz' ? "gzip -d -f ${reads[0]}" : '' + def handleGzip_R2 = reads[1].getExtension() == 'gz' ? "gzip -d -f ${reads[1]}" : '' + def read1 = reads[0].getExtension() == 'gz' ? reads[0].toString() - ~/.gz/ : reads[0] + def read2 = reads[1].getExtension() == 'gz' ? reads[1].toString() - ~/.gz/ : reads[1] + """ + $handleGzip_R1 + $handleGzip_R2 + + mapsplice.py \\ + -c chromosomes \\ + -x $gtf_prefix \\ + -1 ${read1} \\ + -2 ${read2} \\ + -p ${task.cpus} \\ + --bam \\ + --gene-gtf $gtf \\ + -o $prefix \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + mapsplice: $VERSION + END_VERSIONS + """ + } +} diff --git a/modules/local/matrix/join_samples/environment.yml b/modules/local/matrix/join_samples/environment.yml new file mode 100644 index 000000000..d1d6cd8ed --- /dev/null +++ b/modules/local/matrix/join_samples/environment.yml @@ -0,0 +1,7 @@ +name: join_samples +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::polars=1.5.0 + - conda-forge::pyyaml=6.0.2 diff --git a/modules/local/matrix/join_samples/main.nf b/modules/local/matrix/join_samples/main.nf new file mode 100644 index 000000000..a301a9cbf --- /dev/null +++ b/modules/local/matrix/join_samples/main.nf @@ -0,0 +1,35 @@ +process JOIN_SAMPLES { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'oras://community.wave.seqera.io/library/polars_pyyaml:962a0cf7480258c7' : + 'community.wave.seqera.io/library/polars_pyyaml:ad93db0d7bcd508e' }" + + input: + tuple val(meta), val(samples), path(matrices) + + output: + tuple val(meta), path("${meta.id}.joined.tsv"), emit: joined + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + metacols = task.ext.metacols ?: "gene_id,gene_name" + has_header = task.ext.has_header == null ? true : task.ext.has_header + template 'join.py' + + stub: + """ + touch ${meta.id}.joined.tsv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + python: \$(python --version | sed 's/Python //g') + polars: \$(python -c "import polars; print(polars.__version__)") + END_VERSIONS + """ +} diff --git a/modules/local/matrix/join_samples/templates/join.py b/modules/local/matrix/join_samples/templates/join.py new file mode 100644 index 000000000..30351c332 --- /dev/null +++ b/modules/local/matrix/join_samples/templates/join.py @@ -0,0 +1,42 @@ +#!/usr/bin/env python3 + +import platform + +import polars as pl +import yaml + +samples = "${samples.join(' ')}".split(" ") +matrices = "${matrices}".split(" ") +metacols = "${metacols}".split(",") + +dfs = { + sample: + pl.scan_csv(matrix, + separator="\\t", + new_columns=metacols + [sample], + has_header="${has_header}" == "true") + .group_by(metacols).agg(pl.sum(sample).alias(sample)) + for sample, matrix in zip(samples, matrices)} + +df_order = pl.concat([df.select(metacols) for df in dfs.values()]).unique().sort(metacols[0]) + +dfs_sorted = [ + df_order.join(df, on=metacols, how="left", coalesce=True) + .select(sample) + for sample, df in dfs.items() + ] + +df = pl.concat([df_order] + dfs_sorted, how="horizontal").fill_null(0) + +df.collect().write_csv("${meta.id}.joined.tsv", separator="\\t") + +# Create version file +versions = { + "${task.process}" : { + "python": platform.python_version(), + "polars": pl.__version__, + } +} + +with open("versions.yml", "w") as f: + f.write(yaml.dump(versions)) diff --git a/modules/local/mirna_filtering/main.nf b/modules/local/mirna_filtering/main.nf new file mode 100644 index 000000000..03efeea48 --- /dev/null +++ b/modules/local/mirna_filtering/main.nf @@ -0,0 +1,24 @@ +process MIRNA_FILTERING { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/r-base:4.2.1' : + 'biocontainers/r-base:4.2.1' }" + + input: + tuple val(meta), path(normalized_counts) + val(mirna_min_sample_percentage) + val(mirna_min_reads) + + output: + tuple val(meta), path("${meta.id}.normalized_counts_filtered.tsv"), emit: filtered + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + template 'mirna_filtering.R' +} diff --git a/modules/local/mirna_filtering/templates/mirna_filtering.R b/modules/local/mirna_filtering/templates/mirna_filtering.R new file mode 100644 index 000000000..588eb2601 --- /dev/null +++ b/modules/local/mirna_filtering/templates/mirna_filtering.R @@ -0,0 +1,51 @@ +#!/usr/bin/env Rscript + +expression_norm <- read.table("$normalized_counts", + sep = "\\t", + header = TRUE, + stringsAsFactors = FALSE, + check.names = FALSE +) + +samples <- colnames(expression_norm)[-c(1)] + +# filter data: counts > 5 in at least 20% of samples +if (length(samples) < 5) { + stop("Cannot perform filtering on less than 5 samples") +} + +sample_nr_cutoff <- ceiling($mirna_min_sample_percentage * length(samples)) +rows_to_keep <- c() + +for (i in seq_len(nrow(expression_norm))) { + mirna_per_sample <- 0 + for (j in 5:ncol(expression_norm)) { + if (expression_norm[i, j] >= $mirna_min_reads) { + mirna_per_sample <- mirna_per_sample + 1 + } + } + if (mirna_per_sample >= sample_nr_cutoff) { + rows_to_keep <- append(rows_to_keep, i) + } +} + +filtered_data <- expression_norm[rows_to_keep, ] + +write.table(filtered_data, paste0("${meta.id}.normalized_counts_filtered.tsv"), + quote = FALSE, sep = "\\t", + row.names = FALSE) + +################################################ +################################################ +## VERSIONS FILE ## +################################################ +################################################ + +r.version <- strsplit(version[['version.string']], ' ')[[1]][3] + +writeLines( + c( + '"${task.process}":', + paste(' r-base:', r.version) + ), +'versions.yml') diff --git a/modules/local/mirna_targets/main.nf b/modules/local/mirna_targets/main.nf new file mode 100644 index 000000000..e525a9f5e --- /dev/null +++ b/modules/local/mirna_targets/main.nf @@ -0,0 +1,44 @@ +process MIRNA_TARGETS { + tag "$meta.id" + label 'process_low' + + conda "bioconda::bedtools=2.30.0" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bedtools:2.30.0--h7d7f7ad_2': + 'biocontainers/bedtools:2.30.0--h7d7f7ad_2' }" + + input: + tuple val(meta), path(targetscan), path(miranda) + + output: + tuple val(meta), path("${prefix}.mirna_targets.txt"), emit: results + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + """ + ## reformat and sort miRanda, TargetScan outputs, convert to BED for overlaps. + tail -n +2 $targetscan | sort -k1,1 -k4n | awk -v OFS="\\t" '{print \$1, \$2, \$4, \$5, \$9}' | awk -v OFS="\\t" '{print \$2, \$3, \$4, \$1, "0", \$5}' > targetscan.bed + tail -n +2 $miranda | sort -k2,2 -k7n | awk -v OFS="\\t" '{print \$2, \$1, \$3, \$4, \$7, \$8}' | awk -v OFS="\\t" '{print \$2, \$5, \$6, \$1, \$3, \$4}' > miranda.bed + + ## intersect, consolidate miRanda, TargetScan information about miRs. + ## -wa to output miRanda hits - targetscan makes it difficult to resolve duplicate miRNAs at MRE sites. + bedtools intersect -a miranda.bed -b targetscan.bed -wa > ${prefix}.mirnas.tmp + bedtools intersect -a targetscan.bed -b miranda.bed | awk '{print \$6}' > mirna_type + + ## remove duplicate miRNA entries at MRE sites. + ## strategy: sory by circs, sort by start position, sort by site type - the goal is to take the best site type (i.e rank site type found at MRE site). + paste ${prefix}.mirnas.tmp mirna_type | sort -k3n -k2n -k7r | awk -v OFS="\\t" '{print \$4,\$1,\$2,\$3,\$5,\$6,\$7}' | awk -F "\\t" '{if (!seen[\$1,\$2,\$3,\$4,\$5,\$6]++)print}' | sort -k1,1 -k3n > ${prefix}.mirna_targets.tmp + echo -e "circRNA\\tmiRNA\\tStart\\tEnd\\tScore\\tEnergy_KcalMol\\tSite_type" | cat - ${prefix}.mirna_targets.tmp > ${prefix}.mirna_targets.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + awk: \$(awk --version | head -n1 | cut -d' ' -f3 | sed 's/,//g' ) + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ +} diff --git a/modules/local/psirc/index/environment.yml b/modules/local/psirc/index/environment.yml new file mode 100644 index 000000000..e0303603c --- /dev/null +++ b/modules/local/psirc/index/environment.yml @@ -0,0 +1,6 @@ +name: psirc_index +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::psirc=1.0.0 diff --git a/modules/local/psirc/index/main.nf b/modules/local/psirc/index/main.nf new file mode 100644 index 000000000..c0cae5967 --- /dev/null +++ b/modules/local/psirc/index/main.nf @@ -0,0 +1,26 @@ +process PSIRC_INDEX { + tag "${meta.id}" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/psirc:1.0.0--he1fd2f9_0' : + 'biocontainers/psirc:1.0.0--he1fd2f9_0' }" + + input: + tuple val(meta), path(fasta) + + output: + tuple val(meta), path("psirc.index"), emit: index + path "versions.yml", emit: versions + + script: + """ + psirc-quant index -i psirc.index --make-unique $fasta + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + psirc-quant: \$(psirc-quant version | sed -n 's/^psirc-quant, version \\([0-9.]*\\).*\$/\\1/p') + END_VERSIONS + """ +} diff --git a/modules/local/psirc/quant/environment.yml b/modules/local/psirc/quant/environment.yml new file mode 100644 index 000000000..222b4e893 --- /dev/null +++ b/modules/local/psirc/quant/environment.yml @@ -0,0 +1,6 @@ +name: psirc_quant +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::psirc=1.0.0 diff --git a/modules/local/psirc/quant/main.nf b/modules/local/psirc/quant/main.nf new file mode 100644 index 000000000..862e9ccdb --- /dev/null +++ b/modules/local/psirc/quant/main.nf @@ -0,0 +1,33 @@ +process PSIRC_QUANT { + tag "${meta.id}" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/psirc:1.0.0--he1fd2f9_0' : + 'biocontainers/psirc:1.0.0--he1fd2f9_0' }" + + input: + tuple val(meta), path(reads) + tuple val(meta2), path(index) + tuple val(meta3), path(gtf) + tuple val(meta4), path(chrom_sizes) + val(bootstrap_samples) + + output: + tuple val(meta), path("${meta.id}"), emit: directory + path "versions.yml" , emit: versions + + script: + def single_end = meta.single_end ? "--single -l 76 -s 20" : "" + def genomebam = gtf ? "--genomebam -g $gtf" : "" + def chromosomes = chrom_sizes ? "-c $chrom_sizes" : "" + """ + psirc-quant quant -t $task.cpus -i $index -o $meta.id $single_end $reads -b $bootstrap_samples $genomebam $chromosomes + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + psirc-quant: \$(psirc-quant version | sed -n 's/^psirc-quant, version \\([0-9.]*\\).*\$/\\1/p') + END_VERSIONS + """ +} diff --git a/modules/local/pygtftk/tabulate/environment.yml b/modules/local/pygtftk/tabulate/environment.yml new file mode 100644 index 000000000..cf20b1f94 --- /dev/null +++ b/modules/local/pygtftk/tabulate/environment.yml @@ -0,0 +1,6 @@ +name: pygtftk_tabulate +channels: + - conda-forge + - bioconda +dependencies: + - pygtftk=1.6.2 diff --git a/modules/local/pygtftk/tabulate/main.nf b/modules/local/pygtftk/tabulate/main.nf new file mode 100644 index 000000000..25f62a815 --- /dev/null +++ b/modules/local/pygtftk/tabulate/main.nf @@ -0,0 +1,36 @@ +process PYGTFTK_TABULATE { + tag "$meta.id" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/pygtftk:1.6.2--py39h4e691d4_2' : + 'biocontainers/pygtftk:1.6.2--py39h4e691d4_2' }" + + input: + tuple val(meta), path(gtf) + + output: + tuple val(meta), path("$outfile"), emit: table + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def suffix = task.ext.suffix ?: gtf.extension + outfile = "${prefix}.${suffix}" + """ + gtftk tabulate \\ + $args \\ + -i $gtf | \\ + grep -v '^tabulate()' > ${outfile} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gtftk: \$(gtftk -v | awk '{print substr(\$2, 2)}') + END_VERSIONS + """ +} diff --git a/modules/local/quantification/merge_experiments/environment.yml b/modules/local/quantification/merge_experiments/environment.yml new file mode 100644 index 000000000..07f95f055 --- /dev/null +++ b/modules/local/quantification/merge_experiments/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +name: "fishpond_swish" +channels: + - conda-forge + - bioconda +dependencies: + - "bioconda::bioconductor-rtracklayer=1.62.0" diff --git a/modules/local/quantification/merge_experiments/main.nf b/modules/local/quantification/merge_experiments/main.nf new file mode 100644 index 000000000..32fadcd87 --- /dev/null +++ b/modules/local/quantification/merge_experiments/main.nf @@ -0,0 +1,32 @@ +process MERGE_EXPERIMENTS { + tag "$meta.id" + label "process_medium" + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bioconductor-rtracklayer:1.62.0--r43ha9d7317_0' : + 'biocontainers/bioconductor-rtracklayer:1.62.0--r43ha9d7317_0' }" + + input: + tuple val(meta), path(experiments) + tuple val(meta2), path(phenotype) + tuple val(meta3), path(gtf) + tuple val(meta4), path(tpm) + + output: + tuple val(meta), path("${meta.id}.merged.rds"), emit: merged + path "versions.yml" , emit: versions + + script: + template "merge_experiments.r" + + stub: + """ + touch ${meta.id}.merged.rds + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bioconductor-summarizedexperiment: \$(Rscript -e "library(SummarizedExperiment); cat(as.character(packageVersion('SummarizedExperiment')))") + END_VERSIONS + """ +} diff --git a/modules/local/quantification/merge_experiments/templates/merge_experiments.r b/modules/local/quantification/merge_experiments/templates/merge_experiments.r new file mode 100644 index 000000000..4e82e57da --- /dev/null +++ b/modules/local/quantification/merge_experiments/templates/merge_experiments.r @@ -0,0 +1,62 @@ +#!/usr/bin/env Rscript --vanilla + +library(SummarizedExperiment) + +paths <- c('${experiments.join("\', \'")}') +experiments <- lapply(paths, readRDS) + +annotation <- rtracklayer::import('${gtf}') +tpm <- read.table('${tpm}', header=TRUE, row.names=1)[, -1] + +se_assays <- list() + +for (se in experiments) { + assays <- assays(se) + # Iterate over named list of assays + for (assay_name in names(assays)) { + assay <- assays[[assay_name]] + + # Add assay to se_assays for its name + if (is.null(se_assays[[assay_name]])) { + se_assays[[assay_name]] <- assay + } else { + se_assays[[assay_name]] <- cbind(se_assays[[assay_name]], assay) + } + } +} + +se_cbind <- do.call(SummarizedExperiment::cbind, experiments) +se <- SummarizedExperiment(assays = se_assays, colData = colData(se_cbind), rowData = rowData(se_cbind)) + +# Join phenotype data +phenotype_path <- '${phenotype}' +if (file.exists(phenotype_path)) { + phenotype <- read.csv(phenotype_path, stringsAsFactors = FALSE) + colData(se) <- merge(colData(se), phenotype, by.x="names", by.y=colnames(phenotype)[1]) +} + +# Convert string columns to factors +for (col in colnames(colData(se))) { + if (is.character(colData(se)[[col]]) && !(col == "names")) { + colData(se)[[col]] <- as.factor(colData(se)[[col]]) + } +} + +rownames(colData(se)) <- colData(se)\$names +colData(se)\$names <- NULL + +# Add transcript annotation +annotation <- annotation[match(rownames(se), annotation\$transcript_id),] +rowData(se) <- annotation + +# Add TPM +assay(se, "tpm", withDimnames = FALSE) <- tpm[rownames(se), rownames(colData(se))] + +saveRDS(se, '${meta.id}.merged.rds') + +writeLines( + c( + '"${task.process}":', + paste(' bioconductor-summarizedexperiment:', packageVersion('SummarizedExperiment')) + ), +'versions.yml') diff --git a/modules/local/quantification/split_types/environment.yml b/modules/local/quantification/split_types/environment.yml new file mode 100644 index 000000000..0c6dab505 --- /dev/null +++ b/modules/local/quantification/split_types/environment.yml @@ -0,0 +1,6 @@ +name: split_types +channels: + - conda-forge + - bioconda +dependencies: + - gawk=5.1.0 diff --git a/modules/local/quantification/split_types/main.nf b/modules/local/quantification/split_types/main.nf new file mode 100644 index 000000000..a95b18af6 --- /dev/null +++ b/modules/local/quantification/split_types/main.nf @@ -0,0 +1,43 @@ +process SPLIT_TYPES { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/gawk:5.1.0' : + 'biocontainers/gawk:5.1.0' }" + + input: + tuple val(meta), path(input) + + output: + tuple val(meta), path("linear.tsv") , emit: linear + tuple val(meta), path("circular.tsv"), emit: circular + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + """ + awk -F'\\t' \\ + 'NR==1 {print > "circular.tsv"; print > "linear.tsv"} \\ + NR>1 {if (\$1 ~ /^circ_/) print > "circular.tsv"; else print > "linear.tsv"}' ${input} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gawk: \$(awk -Wversion | sed '1!d; s/.*Awk //; s/,.*//') + END_VERSIONS + """ + + stub: + """ + touch linear.tsv + touch circular.tsv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gawk: \$(awk -Wversion | sed '1!d; s/.*Awk //; s/,.*//') + END_VERSIONS + """ +} diff --git a/modules/local/seqkit/split/environment.yml b/modules/local/seqkit/split/environment.yml new file mode 100644 index 000000000..d557b8b31 --- /dev/null +++ b/modules/local/seqkit/split/environment.yml @@ -0,0 +1,7 @@ +name: seqkit_split +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::seqkit=2.8.0 diff --git a/modules/local/seqkit/split/main.nf b/modules/local/seqkit/split/main.nf new file mode 100644 index 000000000..1fbc0c8d6 --- /dev/null +++ b/modules/local/seqkit/split/main.nf @@ -0,0 +1,36 @@ +process SEQKIT_SPLIT { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/seqkit:2.8.0--h9ee0642_0' : + 'biocontainers/seqkit:2.8.0--h9ee0642_0' }" + + input: + tuple val(meta), path(fasta) + + output: + tuple val(meta), path("${prefix}/*"), emit: split + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + """ + seqkit \\ + split \\ + $args \\ + --threads $task.cpus \\ + $fasta \\ + --out-dir ${prefix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + seqkit: \$(echo \$(seqkit 2>&1) | sed 's/^.*Version: //; s/ .*\$//') + END_VERSIONS + """ +} diff --git a/modules/local/star/sjdb/main.nf b/modules/local/star/sjdb/main.nf new file mode 100644 index 000000000..835f4e212 --- /dev/null +++ b/modules/local/star/sjdb/main.nf @@ -0,0 +1,32 @@ +process SJDB { + tag "$meta.id" + label 'process_single' + + conda "conda-forge::sed=4.7" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : + 'nf-core/ubuntu:20.04' }" + + input: + tuple val(meta), path(sjdb) + val(bsj_reads) + + output: + tuple val(meta), path("dataset.SJ.out.tab"), emit: sjtab + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def VERSION = '1.3.4' + """ + mkdir tmp + cat *.tab | awk -v BSJ=${bsj_reads} '(\$7 >= BSJ && \$6==0)' | cut -f1-6 | sort -T ./tmp/ | uniq > dataset.SJ.out.tab + rm -rf tmp + cat <<-END_VERSIONS > versions.yml + "${task.process}": + mawk: $VERSION + END_VERSIONS + """ +} diff --git a/modules/local/stringtie/prepde/main.nf b/modules/local/stringtie/prepde/main.nf new file mode 100644 index 000000000..3d24e65f0 --- /dev/null +++ b/modules/local/stringtie/prepde/main.nf @@ -0,0 +1,44 @@ +process STRINGTIE_PREPDE { + tag "$meta.id" + label 'process_low' + + conda "bioconda::stringtie=2.2.1" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/stringtie:2.2.1--hecb563c_2' : + 'biocontainers/stringtie:2.2.1--hecb563c_2' }" + + input: + tuple val(meta), val(samples), path(gtfs) + + output: + tuple val(meta), path("${prefix}_transcript_count_matrix.csv") , emit: transcript_matrix + tuple val(meta), path("${prefix}_gene_count_matrix.csv") , emit: gene_matrix + + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + samplesheet = [samples, gtfs] + .transpose() + .collect{ sample, gtf -> + "${sample}\\t${gtf}" }.join('\\n') + transcript_path = "${prefix}_transcript_count_matrix.csv" + gene_path = "${prefix}_gene_count_matrix.csv" + """ + echo -e "${samplesheet}" > samples.txt + + prepDE.py -i samples.txt \\ + -g ${gene_path} \\ + -t ${transcript_path} \\ + ${args} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + stringtie: \$(stringtie --version 2>&1) + END_VERSIONS + """ +} diff --git a/modules/local/targetscan/database/main.nf b/modules/local/targetscan/database/main.nf new file mode 100644 index 000000000..8ba3ef71c --- /dev/null +++ b/modules/local/targetscan/database/main.nf @@ -0,0 +1,30 @@ +process TARGETSCAN_DATABASE { + tag "$meta.id" + label 'process_low' + + conda "conda-forge::sed=4.7" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : + 'nf-core/ubuntu:20.04' }" + + input: + tuple val(meta), path(mature) + + output: + tuple val(meta), path("mature.txt") , emit: mature_txt + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def VERSION = '1.3.4' + """ + targetscan_format.sh $mature + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + mawk: $VERSION + END_VERSIONS + """ +} diff --git a/modules/local/targetscan/predict/main.nf b/modules/local/targetscan/predict/main.nf new file mode 100644 index 000000000..450611c2d --- /dev/null +++ b/modules/local/targetscan/predict/main.nf @@ -0,0 +1,38 @@ +process TARGETSCAN { + tag "$meta.id" + label 'process_medium' + + conda "bioconda::targetscan=7.0" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/targetscan:7.0--pl5321hdfd78af_0' : + 'biocontainers/targetscan:7.0--pl5321hdfd78af_0' }" + + input: + tuple val(meta), path(fasta) + tuple val(meta2), path(mature_txt) + + output: + tuple val(meta), path("${prefix}.txt"), emit: txt + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + prefix = task.ext.prefix ?: "${meta.id}" + def VERSION = "7.0" + """ + ##format for targetscan + cat $fasta | grep ">" | sed 's/>//g' > id + cat $fasta | grep -v ">" > seq + paste id seq | awk -v OFS="\\t" '{print \$1, "0000", \$2}' > ${prefix}_ts.txt + # run targetscan + targetscan_70.pl mature.txt ${prefix}_ts.txt ${prefix}.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + awk: \$(awk --version | head -n1 | cut -d' ' -f3 | sed 's/,//g' ) + targetscan: $VERSION + END_VERSIONS + """ +} diff --git a/modules/local/tximeta/tximeta/environment.yml b/modules/local/tximeta/tximeta/environment.yml new file mode 100644 index 000000000..be4bcd30b --- /dev/null +++ b/modules/local/tximeta/tximeta/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +name: "tximeta_tximeta" +channels: + - conda-forge + - bioconda +dependencies: + - "bioconda::bioconductor-tximeta=1.20.1" diff --git a/modules/local/tximeta/tximeta/main.nf b/modules/local/tximeta/tximeta/main.nf new file mode 100644 index 000000000..c1be1d37d --- /dev/null +++ b/modules/local/tximeta/tximeta/main.nf @@ -0,0 +1,34 @@ +process TXIMETA_TXIMETA { + tag "$meta.id" + label "process_medium" + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bioconductor-tximeta%3A1.20.1--r43hdfd78af_1' : + 'biocontainers/bioconductor-tximeta:1.20.1--r43hdfd78af_1' }" + + input: + tuple val(meta), path("quants/*") + val quant_type + + output: + tuple val(meta), path("*.rds"), emit: se + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + prefix = task.ext.prefix ?: meta.id + template 'tximeta.r' + + stub: + """ + touch ${meta.id}.rds + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bioconductor-tximeta: \$(Rscript -e "library(tximeta); cat(as.character(packageVersion('tximeta')))") + END_VERSIONS + """ +} diff --git a/modules/local/tximeta/tximeta/templates/tximeta.r b/modules/local/tximeta/tximeta/templates/tximeta.r new file mode 100755 index 000000000..878ada020 --- /dev/null +++ b/modules/local/tximeta/tximeta/templates/tximeta.r @@ -0,0 +1,66 @@ +#!/usr/bin/env Rscript --vanilla + +# Script for importing and processing transcript-level quantifications. +# Written by Lorena Pantano, later modified by Jonathan Manning, and released +# under the MIT license. + +# Loading required libraries +library(tximeta) + +################################################ +################################################ +## Main script starts here ## +################################################ +################################################ + +# Define pattern for file names based on quantification type +pattern <- ifelse('$quant_type' == "kallisto", + ifelse(length(list.files('quants', pattern = "abundance.h5", recursive = T, full.names = T)) != 0, + "abundance.h5", + "abundance.tsv"), + "quant.sf") + +fns <- list.files('quants', pattern = pattern, recursive = T, full.names = T) +names <- basename(dirname(fns)) +names(fns) <- names + +coldata <- data.frame(files = fns, names = names) +rownames(coldata) <- coldata[["names"]] + +# Import transcript-level quantifications +se <- tximeta(coldata, type = '$quant_type', txOut = TRUE) + +# Save summarized experiment to file +saveRDS(se, file = paste0('$prefix', '.rds')) + +################################################ +################################################ +## R SESSION INFO ## +################################################ +################################################ + +sink(paste("R_sessionInfo.log", sep = '.')) +citation("tximeta") +print(sessionInfo()) +sink() + +################################################ +################################################ +## VERSIONS FILE ## +################################################ +################################################ + +r.version <- strsplit(version[['version.string']], ' ')[[1]][3] +tximeta.version <- as.character(packageVersion('tximeta')) + +writeLines( + c( + '"${task.process}":', + paste(' bioconductor-tximeta:', tximeta.version) + ), +'versions.yml') + +################################################ +################################################ +################################################ +################################################ diff --git a/modules/nf-core/agat/convertbed2gff/environment.yml b/modules/nf-core/agat/convertbed2gff/environment.yml new file mode 100644 index 000000000..072565894 --- /dev/null +++ b/modules/nf-core/agat/convertbed2gff/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::agat=1.4.2 diff --git a/modules/nf-core/agat/convertbed2gff/main.nf b/modules/nf-core/agat/convertbed2gff/main.nf new file mode 100644 index 000000000..2ce3e67d5 --- /dev/null +++ b/modules/nf-core/agat/convertbed2gff/main.nf @@ -0,0 +1,45 @@ +process AGAT_CONVERTBED2GFF { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/agat:1.4.2--pl5321hdfd78af_0' : + 'biocontainers/agat:1.4.2--pl5321hdfd78af_0' }" + + input: + tuple val(meta), path(bed) + + output: + tuple val(meta), path("*.gff") , emit: gff + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + """ + agat_convert_bed2gff.pl \\ + --bed $bed \\ + --output ${prefix}.gff \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + agat: \$(agat_convert_bed2gff.pl --help | sed -n 's/.*(AGAT) - Version: \\(.*\\) .*/\\1/p') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.gff + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + agat: \$(agat_convert_bed2gff.pl --help | sed -n 's/.*(AGAT) - Version: \\(.*\\) .*/\\1/p') + END_VERSIONS + """ +} diff --git a/modules/nf-core/agat/convertbed2gff/meta.yml b/modules/nf-core/agat/convertbed2gff/meta.yml new file mode 100644 index 000000000..57bd3d342 --- /dev/null +++ b/modules/nf-core/agat/convertbed2gff/meta.yml @@ -0,0 +1,49 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json +name: agat_convertbed2gff +description: | + Takes a bed12 file and converts to a GFF3 file +keywords: + - genome + - bed + - gff + - conversion +tools: + - agat: + description: "AGAT is a toolkit for manipulation and getting information from + GFF/GTF files" + homepage: "https://github.com/NBISweden/AGAT" + documentation: "https://agat.readthedocs.io/" + tool_dev_url: "https://github.com/NBISweden/AGAT" + doi: "10.5281/zenodo.3552717" + licence: ["GPL v3"] + identifier: biotools:AGAT +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bed: + type: file + description: Input bed12 file + pattern: "*.bed" +output: + - gff: + - meta: + type: map + description: Groovy Map containing sample information + - "*.gff": + type: file + description: Output GFF3 file + pattern: "*.{gff}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" + +authors: + - "@GallVp" +maintainers: + - "@GallVp" diff --git a/modules/nf-core/agat/convertbed2gff/tests/main.nf.test b/modules/nf-core/agat/convertbed2gff/tests/main.nf.test new file mode 100644 index 000000000..1799dab28 --- /dev/null +++ b/modules/nf-core/agat/convertbed2gff/tests/main.nf.test @@ -0,0 +1,58 @@ +nextflow_process { + + name "Test Process AGAT_CONVERTBED2GFF" + script "../main.nf" + process "AGAT_CONVERTBED2GFF" + + tag "modules" + tag "modules_nfcore" + tag "agat" + tag "agat/convertbed2gff" + + test("sarscov2 - bed12") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed12', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed12', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/agat/convertbed2gff/tests/main.nf.test.snap b/modules/nf-core/agat/convertbed2gff/tests/main.nf.test.snap new file mode 100644 index 000000000..4ecc20d76 --- /dev/null +++ b/modules/nf-core/agat/convertbed2gff/tests/main.nf.test.snap @@ -0,0 +1,70 @@ +{ + "sarscov2 - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.gff:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,ccfb13a5b261f660922e1ed845e68cbc" + ], + "gff": [ + [ + { + "id": "test", + "single_end": false + }, + "test.gff:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,ccfb13a5b261f660922e1ed845e68cbc" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-15T14:02:09.48826" + }, + "sarscov2 - bed12": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.gff:md5,4e5a23a6babac6d5b1bcfa06c5b12518" + ] + ], + "1": [ + "versions.yml:md5,ccfb13a5b261f660922e1ed845e68cbc" + ], + "gff": [ + [ + { + "id": "test" + }, + "test.gff:md5,4e5a23a6babac6d5b1bcfa06c5b12518" + ] + ], + "versions": [ + "versions.yml:md5,ccfb13a5b261f660922e1ed845e68cbc" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-15T14:02:03.549345" + } +} \ No newline at end of file diff --git a/modules/nf-core/agat/spaddintrons/environment.yml b/modules/nf-core/agat/spaddintrons/environment.yml new file mode 100644 index 000000000..072565894 --- /dev/null +++ b/modules/nf-core/agat/spaddintrons/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::agat=1.4.2 diff --git a/modules/nf-core/agat/spaddintrons/main.nf b/modules/nf-core/agat/spaddintrons/main.nf new file mode 100644 index 000000000..eaa194e0c --- /dev/null +++ b/modules/nf-core/agat/spaddintrons/main.nf @@ -0,0 +1,50 @@ +process AGAT_SPADDINTRONS { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/agat:1.4.2--pl5321hdfd78af_0': + 'biocontainers/agat:1.4.2--pl5321hdfd78af_0' }" + + input: + tuple val(meta), path(gff) + path config + + output: + tuple val(meta), path("${output}"), emit: gff + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def config_param = config ? "--config $config" : "" + def prefix = meta.id ?: gff.getBaseName() + output = "${prefix}.intron.gff" + """ + agat_sp_add_introns.pl \\ + --gff $gff \\ + $config_param \\ + --out $output \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + agat: \$(agat_sp_add_introns.pl --help | sed -n 's/.*(AGAT) - Version: \\(.*\\) .*/\\1/p') + END_VERSIONS + """ + + stub: + def prefix = meta.id ?: gff.getBaseName() + output = "${prefix}.intron.gff" + """ + touch ${output} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + agat: \$(agat_sp_add_introns.pl --help | sed -n 's/.*(AGAT) - Version: \\(.*\\) .*/\\1/p') + END_VERSIONS + """ +} diff --git a/modules/nf-core/agat/spaddintrons/meta.yml b/modules/nf-core/agat/spaddintrons/meta.yml new file mode 100644 index 000000000..03f17b9f9 --- /dev/null +++ b/modules/nf-core/agat/spaddintrons/meta.yml @@ -0,0 +1,50 @@ +name: agat_spaddintrons +description: Add intron features to gtf/gff file without intron features. +keywords: + - gtf + - gff + - introns +tools: + - agat: + description: "Another Gff Analysis Toolkit (AGAT). Suite of tools to handle gene + annotations in any GTF/GFF format." + homepage: "https://agat.readthedocs.io/en/latest/" + documentation: "https://agat.readthedocs.io/en/latest/" + tool_dev_url: "https://github.com/NBISweden/AGAT" + licence: ["GPL v3"] + identifier: biotools:AGAT + +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - gff: + type: file + description: Input gtf/gff file + pattern: "*.{gff,gff3,gtf}" + - - config: + type: file + description: Optional input agat config file + pattern: "*.{yaml,yml}" +output: + - gff: + - meta: + type: file + description: Output gff3 file with introns + pattern: "*.gff" + - ${output}: + type: file + description: Output gff3 file with introns + pattern: "*.gff" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@anoronh4" +maintainers: + - "@anoronh4" + - "@gallvp" diff --git a/modules/nf-core/agat/spaddintrons/tests/main.nf.test b/modules/nf-core/agat/spaddintrons/tests/main.nf.test new file mode 100644 index 000000000..82d419322 --- /dev/null +++ b/modules/nf-core/agat/spaddintrons/tests/main.nf.test @@ -0,0 +1,61 @@ +nextflow_process { + + name "Test Process AGAT_SPADDINTRONS" + script "../main.nf" + process "AGAT_SPADDINTRONS" + + tag "modules" + tag "modules_nfcore" + tag "agat" + tag "agat/spaddintrons" + + test("homo_sapiens - gtf") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo_sapiens - gtf - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.gff.collect { file(it[1]).getName() } + + process.out.versions ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/agat/spaddintrons/tests/main.nf.test.snap b/modules/nf-core/agat/spaddintrons/tests/main.nf.test.snap new file mode 100644 index 000000000..5e1e9b63e --- /dev/null +++ b/modules/nf-core/agat/spaddintrons/tests/main.nf.test.snap @@ -0,0 +1,48 @@ +{ + "homo_sapiens - gtf": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.intron.gff:md5,ce2e3c8d3e26d4676eb3474868134546" + ] + ], + "1": [ + "versions.yml:md5,b2765a6bc10652f833965c022b025370" + ], + "gff": [ + [ + { + "id": "test" + }, + "test.intron.gff:md5,ce2e3c8d3e26d4676eb3474868134546" + ] + ], + "versions": [ + "versions.yml:md5,b2765a6bc10652f833965c022b025370" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-15T13:14:14.622685" + }, + "homo_sapiens - gtf - stub": { + "content": [ + [ + "test.intron.gff", + "versions.yml:md5,b2765a6bc10652f833965c022b025370" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-15T13:14:21.098429" + } +} \ No newline at end of file diff --git a/modules/nf-core/agat/spaddintrons/tests/tags.yml b/modules/nf-core/agat/spaddintrons/tests/tags.yml new file mode 100644 index 000000000..a47bd9b06 --- /dev/null +++ b/modules/nf-core/agat/spaddintrons/tests/tags.yml @@ -0,0 +1,2 @@ +agat/spaddintrons: + - "modules/nf-core/agat/spaddintrons/**" diff --git a/modules/nf-core/bedtools/getfasta/environment.yml b/modules/nf-core/bedtools/getfasta/environment.yml new file mode 100644 index 000000000..45c307b0e --- /dev/null +++ b/modules/nf-core/bedtools/getfasta/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/getfasta/main.nf b/modules/nf-core/bedtools/getfasta/main.nf new file mode 100644 index 000000000..b316117d4 --- /dev/null +++ b/modules/nf-core/bedtools/getfasta/main.nf @@ -0,0 +1,50 @@ +process BEDTOOLS_GETFASTA { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' : + 'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }" + + input: + tuple val(meta), path(bed) + path fasta + + output: + tuple val(meta), path("*.fa"), emit: fasta + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + if ("$fasta" == "${prefix}.fa") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + bedtools \\ + getfasta \\ + $args \\ + -fi $fasta \\ + -bed $bed \\ + -fo ${prefix}.fa + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + if ("$fasta" == "${prefix}.fa") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + touch ${prefix}.fa + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ +} diff --git a/modules/nf-core/bedtools/getfasta/meta.yml b/modules/nf-core/bedtools/getfasta/meta.yml new file mode 100644 index 000000000..bb38fa259 --- /dev/null +++ b/modules/nf-core/bedtools/getfasta/meta.yml @@ -0,0 +1,50 @@ +name: bedtools_getfasta +description: extract sequences in a FASTA file based on intervals defined in a feature + file. +keywords: + - bed + - fasta + - getfasta +tools: + - bedtools: + description: | + A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. + documentation: https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html + licence: ["MIT"] + identifier: biotools:bedtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bed: + type: file + description: Bed feature file + pattern: "*.{bed}" + - - fasta: + type: file + description: Input fasta file + pattern: "*.{fa,fasta}" +output: + - fasta: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.fa": + type: file + description: Output fasta file with extracted sequences + pattern: "*.{fa}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@joseespinosa" + - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bedtools/getfasta/tests/main.nf.test b/modules/nf-core/bedtools/getfasta/tests/main.nf.test new file mode 100644 index 000000000..54ef4fc7e --- /dev/null +++ b/modules/nf-core/bedtools/getfasta/tests/main.nf.test @@ -0,0 +1,62 @@ +nextflow_process { + + name "Test Process BEDTOOLS_GETFASTA" + script "../main.nf" + process "BEDTOOLS_GETFASTA" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/getfasta" + + test("sarscov2 - bed - fasta") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true), + ] + + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bed - fasta - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true), + ] + + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bedtools/getfasta/tests/main.nf.test.snap b/modules/nf-core/bedtools/getfasta/tests/main.nf.test.snap new file mode 100644 index 000000000..69bf33f74 --- /dev/null +++ b/modules/nf-core/bedtools/getfasta/tests/main.nf.test.snap @@ -0,0 +1,72 @@ +{ + "sarscov2 - bed - fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fa:md5,41c3a45a57a16c04f828d8f8bb52df70" + ] + ], + "1": [ + "versions.yml:md5,427b4f64b2f05f28f0beef96c9f0d310" + ], + "fasta": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fa:md5,41c3a45a57a16c04f828d8f8bb52df70" + ] + ], + "versions": [ + "versions.yml:md5,427b4f64b2f05f28f0beef96c9f0d310" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T14:16:19.383758985" + }, + "sarscov2 - bed - fasta - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fa:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,427b4f64b2f05f28f0beef96c9f0d310" + ], + "fasta": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fa:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,427b4f64b2f05f28f0beef96c9f0d310" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T14:16:47.47010536" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/getfasta/tests/tags.yml b/modules/nf-core/bedtools/getfasta/tests/tags.yml new file mode 100644 index 000000000..42ec3026c --- /dev/null +++ b/modules/nf-core/bedtools/getfasta/tests/tags.yml @@ -0,0 +1,2 @@ +bedtools/getfasta: + - "modules/nf-core/bedtools/getfasta/**" diff --git a/modules/nf-core/bedtools/groupby/environment.yml b/modules/nf-core/bedtools/groupby/environment.yml new file mode 100644 index 000000000..45c307b0e --- /dev/null +++ b/modules/nf-core/bedtools/groupby/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/groupby/main.nf b/modules/nf-core/bedtools/groupby/main.nf new file mode 100644 index 000000000..063e7ba2a --- /dev/null +++ b/modules/nf-core/bedtools/groupby/main.nf @@ -0,0 +1,50 @@ +process BEDTOOLS_GROUPBY { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' : + 'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }" + + input: + tuple val(meta), path(bed) + val(summary_col) + + output: + tuple val(meta), path('*.bed'), emit: bed + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}.grouped" + def summary_col = task.ext.summary_col ? "-c ${task.ext.summary_col}" : "-c 5" + if ("$bed" == "${prefix}.bed") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + bedtools \\ + groupby \\ + -i $bed \\ + ${summary_col} \\ + $args \\ + > ${prefix}.bed + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.bed + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ +} diff --git a/modules/nf-core/bedtools/groupby/meta.yml b/modules/nf-core/bedtools/groupby/meta.yml new file mode 100644 index 000000000..3be92b077 --- /dev/null +++ b/modules/nf-core/bedtools/groupby/meta.yml @@ -0,0 +1,50 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/yaml-schema.json +name: bedtools_groupby +description: Groups features in a BED file by given column(s) and computes summary + statistics for each group to another column. +keywords: + - bed + - groupby + - bedtools +tools: + - bedtools: + description: | + A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. + documentation: https://bedtools.readthedocs.io/en/latest/content/tools/groupby.html + homepage: https://bedtools.readthedocs.io/en/latest/ + doi: 10.1093/bioinformatics/btq033 + licence: ["MIT"] + identifier: biotools:bedtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. `[ id:'test', single_end:false ]` + - bed: + type: file + description: Input BED file + pattern: "*.{bed}" + - - summary_col: + type: string + description: Column to summarize +output: + - bed: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. `[ id:'test', single_end:false ]` + - "*.bed": + type: file + description: Grouped by bed file with combined features + pattern: "*.{bed}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@mashehu" +maintainers: + - "@mashehu" diff --git a/modules/nf-core/bedtools/groupby/tests/main.nf.test b/modules/nf-core/bedtools/groupby/tests/main.nf.test new file mode 100644 index 000000000..b7dedcc2a --- /dev/null +++ b/modules/nf-core/bedtools/groupby/tests/main.nf.test @@ -0,0 +1,37 @@ + +nextflow_process { + + name "Test Process BEDTOOLS_GROUPBY" + script "../main.nf" + process "BEDTOOLS_GROUPBY" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/groupby" + + test("test-bedtools-groupby") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true), + ] + input[1] = 5 + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/bedtools/groupby/tests/main.nf.test.snap b/modules/nf-core/bedtools/groupby/tests/main.nf.test.snap new file mode 100644 index 000000000..956487d0f --- /dev/null +++ b/modules/nf-core/bedtools/groupby/tests/main.nf.test.snap @@ -0,0 +1,37 @@ +{ + "test-bedtools-groupby": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.grouped.bed:md5,ba080b3d282f206f6312122c71a66745" + ] + ], + "1": [ + "versions.yml:md5,8f48acf848ff45a4fff4e10a806f29f5" + ], + "bed": [ + [ + { + "id": "test", + "single_end": false + }, + "test.grouped.bed:md5,ba080b3d282f206f6312122c71a66745" + ] + ], + "versions": [ + "versions.yml:md5,8f48acf848ff45a4fff4e10a806f29f5" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-26T14:10:16.714787" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/groupby/tests/nextflow.config b/modules/nf-core/bedtools/groupby/tests/nextflow.config new file mode 100644 index 000000000..3b6019fb2 --- /dev/null +++ b/modules/nf-core/bedtools/groupby/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: BEDTOOLS_GROUPBY { + ext.args = "-g 1" + } +} diff --git a/modules/nf-core/bedtools/intersect/environment.yml b/modules/nf-core/bedtools/intersect/environment.yml new file mode 100644 index 000000000..45c307b0e --- /dev/null +++ b/modules/nf-core/bedtools/intersect/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/intersect/main.nf b/modules/nf-core/bedtools/intersect/main.nf new file mode 100644 index 000000000..d9e79e7fa --- /dev/null +++ b/modules/nf-core/bedtools/intersect/main.nf @@ -0,0 +1,59 @@ +process BEDTOOLS_INTERSECT { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' : + 'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }" + + input: + tuple val(meta), path(intervals1), path(intervals2) + tuple val(meta2), path(chrom_sizes) + + output: + tuple val(meta), path("*.${extension}"), emit: intersect + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + //Extension of the output file. It is set by the user via "ext.suffix" in the config. Corresponds to the file format which depends on arguments (e. g., ".bed", ".bam", ".txt", etc.). + extension = task.ext.suffix ?: "${intervals1.extension}" + def sizes = chrom_sizes ? "-g ${chrom_sizes}" : '' + if ("$intervals1" == "${prefix}.${extension}" || + "$intervals2" == "${prefix}.${extension}") + error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + bedtools \\ + intersect \\ + -a $intervals1 \\ + -b $intervals2 \\ + $args \\ + $sizes \\ + > ${prefix}.${extension} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + extension = task.ext.suffix ?: "bed" + if ("$intervals1" == "${prefix}.${extension}" || + "$intervals2" == "${prefix}.${extension}") + error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + touch ${prefix}.${extension} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ +} diff --git a/modules/nf-core/bedtools/intersect/meta.yml b/modules/nf-core/bedtools/intersect/meta.yml new file mode 100644 index 000000000..45ecf377a --- /dev/null +++ b/modules/nf-core/bedtools/intersect/meta.yml @@ -0,0 +1,63 @@ +name: bedtools_intersect +description: Allows one to screen for overlaps between two sets of genomic features. +keywords: + - bed + - intersect + - overlap +tools: + - bedtools: + description: | + A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. + documentation: https://bedtools.readthedocs.io/en/latest/content/tools/intersect.html + licence: ["MIT"] + identifier: biotools:bedtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - intervals1: + type: file + description: BAM/BED/GFF/VCF + pattern: "*.{bam|bed|gff|vcf}" + - intervals2: + type: file + description: BAM/BED/GFF/VCF + pattern: "*.{bam|bed|gff|vcf}" + - - meta2: + type: map + description: | + Groovy Map containing reference chromosome sizes + e.g. [ id:'test' ] + - chrom_sizes: + type: file + description: Chromosome sizes file + pattern: "*{.sizes,.txt}" +output: + - intersect: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.${extension}": + type: file + description: File containing the description of overlaps found between the two + features + pattern: "*.${extension}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@edmundmiller" + - "@sruthipsuresh" + - "@drpatelh" + - "@sidorov-si" +maintainers: + - "@edmundmiller" + - "@sruthipsuresh" + - "@drpatelh" + - "@sidorov-si" diff --git a/modules/nf-core/bedtools/intersect/tests/main.nf.test b/modules/nf-core/bedtools/intersect/tests/main.nf.test new file mode 100644 index 000000000..cd7709467 --- /dev/null +++ b/modules/nf-core/bedtools/intersect/tests/main.nf.test @@ -0,0 +1,90 @@ +nextflow_process { + + name "Test Process BEDTOOLS_INTERSECT" + script "../main.nf" + process "BEDTOOLS_INTERSECT" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/intersect" + + test("sarscov2 - bed - bed") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test2.bed', checkIfExists: true) + ] + + input[1] = [[:], []] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam - bam") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/baits.bed', checkIfExists: true) + ] + + input[1] = [[:], []] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bed - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test2.bed', checkIfExists: true) + ] + + input[1] = [[:], []] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bedtools/intersect/tests/main.nf.test.snap b/modules/nf-core/bedtools/intersect/tests/main.nf.test.snap new file mode 100644 index 000000000..b748dd499 --- /dev/null +++ b/modules/nf-core/bedtools/intersect/tests/main.nf.test.snap @@ -0,0 +1,101 @@ +{ + "sarscov2 - bam - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.bam:md5,738324efe2b1e442ceb6539a630c3fe6" + ] + ], + "1": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ], + "intersect": [ + [ + { + "id": "test" + }, + "test_out.bam:md5,738324efe2b1e442ceb6539a630c3fe6" + ] + ], + "versions": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-17T20:55:57.454847668" + }, + "sarscov2 - bed - bed": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,afcbf01c2f2013aad71dbe8e34f2c15c" + ] + ], + "1": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ], + "intersect": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,afcbf01c2f2013aad71dbe8e34f2c15c" + ] + ], + "versions": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-17T20:55:49.072132931" + }, + "sarscov2 - bed - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ], + "intersect": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-17T20:56:06.259192552" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/intersect/tests/nextflow.config b/modules/nf-core/bedtools/intersect/tests/nextflow.config new file mode 100644 index 000000000..f1f9e6937 --- /dev/null +++ b/modules/nf-core/bedtools/intersect/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: BEDTOOLS_INTERSECT { + ext.prefix = { "${meta.id}_out" } + } +} diff --git a/modules/nf-core/bedtools/intersect/tests/tags.yml b/modules/nf-core/bedtools/intersect/tests/tags.yml new file mode 100644 index 000000000..6219cc40b --- /dev/null +++ b/modules/nf-core/bedtools/intersect/tests/tags.yml @@ -0,0 +1,2 @@ +bedtools/intersect: + - "modules/nf-core/bedtools/intersect/**" diff --git a/modules/nf-core/bedtools/sort/environment.yml b/modules/nf-core/bedtools/sort/environment.yml new file mode 100644 index 000000000..45c307b0e --- /dev/null +++ b/modules/nf-core/bedtools/sort/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/sort/main.nf b/modules/nf-core/bedtools/sort/main.nf new file mode 100644 index 000000000..b833150a1 --- /dev/null +++ b/modules/nf-core/bedtools/sort/main.nf @@ -0,0 +1,54 @@ +process BEDTOOLS_SORT { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' : + 'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }" + + input: + tuple val(meta), path(intervals) + path genome_file + + output: + tuple val(meta), path("*.${extension}"), emit: sorted + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def genome_cmd = genome_file ? "-g $genome_file" : "" + extension = task.ext.suffix ?: intervals.extension + if ("$intervals" == "${prefix}.${extension}") { + error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + } + """ + bedtools \\ + sort \\ + -i $intervals \\ + $genome_cmd \\ + $args \\ + > ${prefix}.${extension} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + extension = task.ext.suffix ?: intervals.extension + """ + touch ${prefix}.${extension} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ +} diff --git a/modules/nf-core/bedtools/sort/meta.yml b/modules/nf-core/bedtools/sort/meta.yml new file mode 100644 index 000000000..313698f16 --- /dev/null +++ b/modules/nf-core/bedtools/sort/meta.yml @@ -0,0 +1,57 @@ +name: bedtools_sort +description: Sorts a feature file by chromosome and other criteria. +keywords: + - bed + - sort + - bedtools + - chromosome +tools: + - bedtools: + description: | + A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. + documentation: https://bedtools.readthedocs.io/en/latest/content/tools/sort.html + licence: ["MIT"] + identifier: biotools:bedtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - intervals: + type: file + description: BED/BEDGRAPH + pattern: "*.{bed|bedGraph}" + - - genome_file: + type: file + description: | + Optional reference genome 2 column file that defines the expected chromosome order. + pattern: "*.{fai,txt,chromsizes}" +output: + - sorted: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.${extension}": + type: file + description: Sorted output file + pattern: "*.${extension}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@edmundmiller" + - "@sruthipsuresh" + - "@drpatelh" + - "@chris-cheshire" + - "@adamrtalbot" +maintainers: + - "@edmundmiller" + - "@sruthipsuresh" + - "@drpatelh" + - "@chris-cheshire" + - "@adamrtalbot" diff --git a/modules/nf-core/bedtools/sort/tests/main.nf.test b/modules/nf-core/bedtools/sort/tests/main.nf.test new file mode 100644 index 000000000..b1f36dd91 --- /dev/null +++ b/modules/nf-core/bedtools/sort/tests/main.nf.test @@ -0,0 +1,58 @@ +nextflow_process { + + name "Test Process BEDTOOLS_SORT" + script "../main.nf" + config "./nextflow.config" + process "BEDTOOLS_SORT" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/sort" + + test("test_bedtools_sort") { + + when { + process { + """ + input[0] = [ [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + + test("test_bedtools_sort_with_genome") { + + when { + process { + """ + input[0] = [ [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ] + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/sort/tests/main.nf.test.snap b/modules/nf-core/bedtools/sort/tests/main.nf.test.snap new file mode 100644 index 000000000..f10e8b984 --- /dev/null +++ b/modules/nf-core/bedtools/sort/tests/main.nf.test.snap @@ -0,0 +1,68 @@ +{ + "test_bedtools_sort_with_genome": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.testtext:md5,fe4053cf4de3aebbdfc3be2efb125a74" + ] + ], + "1": [ + "versions.yml:md5,cdbae2c7ebc41e534aaf0835779061f8" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test_out.testtext:md5,fe4053cf4de3aebbdfc3be2efb125a74" + ] + ], + "versions": [ + "versions.yml:md5,cdbae2c7ebc41e534aaf0835779061f8" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-19T10:13:11.830452" + }, + "test_bedtools_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.testtext:md5,fe4053cf4de3aebbdfc3be2efb125a74" + ] + ], + "1": [ + "versions.yml:md5,cdbae2c7ebc41e534aaf0835779061f8" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test_out.testtext:md5,fe4053cf4de3aebbdfc3be2efb125a74" + ] + ], + "versions": [ + "versions.yml:md5,cdbae2c7ebc41e534aaf0835779061f8" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-19T10:16:40.535947" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/sort/tests/nextflow.config b/modules/nf-core/bedtools/sort/tests/nextflow.config new file mode 100644 index 000000000..f203c99c5 --- /dev/null +++ b/modules/nf-core/bedtools/sort/tests/nextflow.config @@ -0,0 +1,8 @@ +process { + + withName: BEDTOOLS_SORT { + ext.prefix = { "${meta.id}_out" } + ext.suffix = "testtext" + } + +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/sort/tests/tags.yml b/modules/nf-core/bedtools/sort/tests/tags.yml new file mode 100644 index 000000000..47c85eead --- /dev/null +++ b/modules/nf-core/bedtools/sort/tests/tags.yml @@ -0,0 +1,2 @@ +bedtools/sort: + - "modules/nf-core/bedtools/sort/**" diff --git a/modules/nf-core/bioawk/bioawk.diff b/modules/nf-core/bioawk/bioawk.diff new file mode 100644 index 000000000..ac2b860c4 --- /dev/null +++ b/modules/nf-core/bioawk/bioawk.diff @@ -0,0 +1,41 @@ +Changes in component 'nf-core/bioawk' +'modules/nf-core/bioawk/meta.yml' is unchanged +'modules/nf-core/bioawk/environment.yml' is unchanged +Changes in 'bioawk/main.nf': +--- modules/nf-core/bioawk/main.nf ++++ modules/nf-core/bioawk/main.nf +@@ -11,8 +11,8 @@ + tuple val(meta), path(input) + + output: +- tuple val(meta), path("*.gz"), emit: output +- path "versions.yml" , emit: versions ++ tuple val(meta), path("${output}"), emit: output ++ path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when +@@ -20,15 +20,15 @@ + script: + def args = task.ext.args ?: '' // args is used for the main arguments of the tool + prefix = task.ext.prefix ?: "${meta.id}" ++ suffix = task.ext.suffix ?: input.getExtension() ++ output = "${prefix}.${suffix}" + if ("${input}" == "${prefix}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + def VERSION = '1.0' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + """ + bioawk \\ + $args \\ + $input \\ +- > ${prefix} +- +- gzip ${prefix} ++ > ${output} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + +'modules/nf-core/bioawk/tests/main.nf.test.snap' is unchanged +'modules/nf-core/bioawk/tests/main.nf.test' is unchanged +'modules/nf-core/bioawk/tests/nextflow.config' is unchanged +************************************************************ diff --git a/modules/nf-core/bioawk/environment.yml b/modules/nf-core/bioawk/environment.yml new file mode 100644 index 000000000..0be1e105f --- /dev/null +++ b/modules/nf-core/bioawk/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bioawk=1.0 diff --git a/modules/nf-core/bioawk/main.nf b/modules/nf-core/bioawk/main.nf new file mode 100644 index 000000000..0858a0029 --- /dev/null +++ b/modules/nf-core/bioawk/main.nf @@ -0,0 +1,38 @@ +process BIOAWK { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bioawk:1.0--h5bf99c6_6': + 'biocontainers/bioawk:1.0--h5bf99c6_6' }" + + input: + tuple val(meta), path(input) + + output: + tuple val(meta), path("${output}"), emit: output + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' // args is used for the main arguments of the tool + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: input.getExtension() + output = "${prefix}.${suffix}" + if ("${input}" == "${prefix}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + def VERSION = '1.0' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + """ + bioawk \\ + $args \\ + $input \\ + > ${output} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bioawk: $VERSION + END_VERSIONS + """ +} diff --git a/modules/nf-core/bioawk/meta.yml b/modules/nf-core/bioawk/meta.yml new file mode 100644 index 000000000..c691ac0c2 --- /dev/null +++ b/modules/nf-core/bioawk/meta.yml @@ -0,0 +1,51 @@ +name: "bioawk" +description: Bioawk is an extension to Brian Kernighan's awk, adding the support of + several common biological data formats. +keywords: + - bioawk + - fastq + - fasta + - sam + - file manipulation + - awk +tools: + - "bioawk": + description: "BWK awk modified for biological data" + homepage: "https://github.com/lh3/bioawk" + documentation: "https://github.com/lh3/bioawk" + tool_dev_url: "https://github.com/lh3/bioawk" + licence: ["Free software license (https://github.com/lh3/bioawk/blob/master/README.awk#L1)"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: Input sequence biological sequence file (optionally gzipped) to + be manipulated via program specified in `$args`. + pattern: "*.{bed,gff,sam,vcf,fastq,fasta,tab,bed.gz,gff.gz,sam.gz,vcf.gz,fastq.gz,fasta.gz,tab.gz}" +output: + - output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.gz": + type: file + description: | + Manipulated and gzipped version of input sequence file following program specified in `args`. + File name will be what is specified in `$prefix`. Do not include `.gz` suffix in `$prefix`! Output files` will be gzipped for you! + pattern: "*.gz" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@jfy133" +maintainers: + - "@jfy133" diff --git a/modules/nf-core/bioawk/tests/main.nf.test b/modules/nf-core/bioawk/tests/main.nf.test new file mode 100644 index 000000000..270ff1ef3 --- /dev/null +++ b/modules/nf-core/bioawk/tests/main.nf.test @@ -0,0 +1,35 @@ + +nextflow_process { + + name "Test Process BIOAWK" + script "../main.nf" + process "BIOAWK" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "bioawk" + + test("test-bioawk") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/bioawk/tests/main.nf.test.snap b/modules/nf-core/bioawk/tests/main.nf.test.snap new file mode 100644 index 000000000..fa9b59305 --- /dev/null +++ b/modules/nf-core/bioawk/tests/main.nf.test.snap @@ -0,0 +1,37 @@ +{ + "test-bioawk": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "sample_1.fa.gz:md5,b558dd15d8940373a032a827d490e693" + ] + ], + "1": [ + "versions.yml:md5,5fe88e58a71f10551df56518c35ba91a" + ], + "output": [ + [ + { + "id": "test", + "single_end": false + }, + "sample_1.fa.gz:md5,b558dd15d8940373a032a827d490e693" + ] + ], + "versions": [ + "versions.yml:md5,5fe88e58a71f10551df56518c35ba91a" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-28T10:24:46.397249" + } +} \ No newline at end of file diff --git a/modules/nf-core/bioawk/tests/nextflow.config b/modules/nf-core/bioawk/tests/nextflow.config new file mode 100644 index 000000000..5ef017d97 --- /dev/null +++ b/modules/nf-core/bioawk/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + withName: BIOAWK { + ext.args = "-c fastx \'{print \">\" \$name ORS length(\$seq)}\'" + ext.prefix = "sample_1.fa" + } +} diff --git a/modules/nf-core/bowtie/align/environment.yml b/modules/nf-core/bowtie/align/environment.yml new file mode 100644 index 000000000..40d9b0366 --- /dev/null +++ b/modules/nf-core/bowtie/align/environment.yml @@ -0,0 +1,10 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + # renovate: datasource=conda depName=bioconda/samtools + - bioconda::bowtie=1.3.1 + - bioconda::bowtie=1.3.1 + - bioconda::samtools=1.20 diff --git a/modules/nf-core/bowtie/align/main.nf b/modules/nf-core/bowtie/align/main.nf new file mode 100644 index 000000000..e00acce21 --- /dev/null +++ b/modules/nf-core/bowtie/align/main.nf @@ -0,0 +1,78 @@ +process BOWTIE_ALIGN { + tag "$meta.id" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/c8/c8c0819a9b1f520c49c933e667ae50de2a0730ece4c8b9efe79ac5e403963a9f/data' : + 'community.wave.seqera.io/library/bowtie_samtools:e1a14e1ce4e0170d' }" + + input: + tuple val(meta), path(reads) + tuple val(meta2), path(index) + val (save_unaligned) + + output: + tuple val(meta), path('*.bam') , emit: bam + tuple val(meta), path('*.out') , emit: log + tuple val(meta), path('*fastq.gz') , emit: fastq, optional : true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def args2 = task.ext.args2 ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def unaligned = save_unaligned ? "--un ${prefix}.unmapped.fastq" : '' + def endedness = meta.single_end ? "$reads" : "-1 ${reads[0]} -2 ${reads[1]}" + """ + INDEX=\$(find -L ./ -name "*.3.ebwt" | sed 's/\\.3.ebwt\$//') + + bowtie \\ + --threads $task.cpus \\ + --sam \\ + -x \$INDEX \\ + -q \\ + $unaligned \\ + $args \\ + $endedness \\ + 2> >(tee ${prefix}.out >&2) \\ + | samtools view $args2 -@ $task.cpus -bS -o ${prefix}.bam - + + if [ -f ${prefix}.unmapped.fastq ]; then + gzip ${prefix}.unmapped.fastq + fi + if [ -f ${prefix}.unmapped_1.fastq ]; then + gzip ${prefix}.unmapped_1.fastq + gzip ${prefix}.unmapped_2.fastq + fi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie: \$(echo \$(bowtie --version 2>&1) | sed 's/^.*bowtie-align-s version //; s/ .*\$//') + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def unaligned = save_unaligned ? + meta.single_end ? "echo '' | gzip > ${prefix}.unmapped.fastq.gz" : + "echo '' | gzip > ${prefix}.unmapped_1.fastq.gz; echo '' | gzip > ${prefix}.unmapped_2.fastq.gz" + : '' + """ + touch ${prefix}.bam + touch ${prefix}.out + $unaligned + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie: \$(echo \$(bowtie --version 2>&1) | sed 's/^.*bowtie-align-s version //; s/ .*\$//') + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + +} diff --git a/modules/nf-core/bowtie/align/meta.yml b/modules/nf-core/bowtie/align/meta.yml new file mode 100644 index 000000000..7b3468023 --- /dev/null +++ b/modules/nf-core/bowtie/align/meta.yml @@ -0,0 +1,80 @@ +name: bowtie_align +description: Align reads to a reference genome using bowtie +keywords: + - align + - map + - fastq + - fasta + - genome + - reference +tools: + - bowtie: + description: | + bowtie is a software package for mapping DNA sequences against + a large reference genome, such as the human genome. + homepage: http://bowtie-bio.sourceforge.net/index.shtml + documentation: http://bowtie-bio.sourceforge.net/manual.shtml + arxiv: arXiv:1303.3997 + licence: ["Artistic-2.0"] + identifier: biotools:bowtie +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. + - - meta2: + type: map + description: | + Groovy Map containing genome information + e.g. [ id:'sarscov2' ] + - index: + type: file + description: Bowtie genome index files + pattern: "*.ebwt" + - - save_unaligned: + type: boolean + description: Whether to save fastq files containing the reads which did not + align. +output: + - bam: + - meta: + type: file + description: Output BAM file containing read alignments + pattern: "*.{bam}" + - "*.bam": + type: file + description: Output BAM file containing read alignments + pattern: "*.{bam}" + - log: + - meta: + type: file + description: Log file + pattern: "*.log" + - "*.out": + type: file + description: Log file + pattern: "*.log" + - fastq: + - meta: + type: file + description: Unaligned FastQ files + pattern: "*.fastq.gz" + - "*fastq.gz": + type: file + description: Unaligned FastQ files + pattern: "*.fastq.gz" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@kevinmenden" +maintainers: + - "@kevinmenden" diff --git a/modules/nf-core/bowtie/align/tests/main.nf.test b/modules/nf-core/bowtie/align/tests/main.nf.test new file mode 100644 index 000000000..3403ae225 --- /dev/null +++ b/modules/nf-core/bowtie/align/tests/main.nf.test @@ -0,0 +1,129 @@ +nextflow_process { + + name "Test Process BOWTIE_ALIGN" + script "../main.nf" + process "BOWTIE_ALIGN" + + tag "modules" + tag "modules_nfcore" + tag "bowtie" + tag "bowtie/align" + tag "bowtie/build" + + + setup { + run("BOWTIE_BUILD") { + script "../../../bowtie/build/main.nf" + process { + """ + input[0] = [[ id:'sarscov2' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + """ + } + } + } + + test("sarscov2 - single_end") { + + when { + process { + """ + input[0] = [ [id:"test", single_end:true], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE_BUILD.out.index + input[2] = true + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.versions, + process.out.bam.collect { bam(it[1]).getReadsMD5() }, + process.out.fastq, + process.out.log + ).match() } + ) + } + + } + + test("sarscov2 - single_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ [id:"test", single_end:true], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE_BUILD.out.index + input[2] = true + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - paired_end") { + + when { + process { + """ + input[0] = [ [id:"test", single_end:false], + [file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ] + input[1] = BOWTIE_BUILD.out.index + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.versions, + process.out.bam.collect { bam(it[1]).getReads(2) }, + process.out.log + ).match() } + ) + } + + } + + test("sarscov2 - paired_end - stub") { + + options "-stub" + when { + process { + """ + input[0] = [ [id:"test", single_end:false], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE_BUILD.out.index + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bowtie/align/tests/main.nf.test.snap b/modules/nf-core/bowtie/align/tests/main.nf.test.snap new file mode 100644 index 000000000..e24eff79e --- /dev/null +++ b/modules/nf-core/bowtie/align/tests/main.nf.test.snap @@ -0,0 +1,192 @@ +{ + "sarscov2 - single_end": { + "content": [ + [ + "versions.yml:md5,40a84d909e40d3b39ab6ed522cc75145" + ], + [ + "7bdcfc6f54ae6e8f4570395cc85db9a3" + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.unmapped.fastq.gz:md5,5729a694abd09657da3b9101861090c4" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.out:md5,4b9140ceadb8a18ae9330885370f8a0b" + ] + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-14T10:55:41.588212" + }, + "sarscov2 - single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.unmapped.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "3": [ + "versions.yml:md5,40a84d909e40d3b39ab6ed522cc75145" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": true + }, + "test.unmapped.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,40a84d909e40d3b39ab6ed522cc75145" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-14T10:55:46.311312" + }, + "sarscov2 - paired_end": { + "content": [ + [ + "versions.yml:md5,40a84d909e40d3b39ab6ed522cc75145" + ], + [ + [ + "ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG", + "ACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.out:md5,5e13272d112cef8faeedcdbd7c602de0" + ] + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-14T10:55:51.790156" + }, + "sarscov2 - paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,40a84d909e40d3b39ab6ed522cc75145" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,40a84d909e40d3b39ab6ed522cc75145" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-14T10:55:56.594761" + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie/align/tests/tags.yml b/modules/nf-core/bowtie/align/tests/tags.yml new file mode 100644 index 000000000..a5753d586 --- /dev/null +++ b/modules/nf-core/bowtie/align/tests/tags.yml @@ -0,0 +1,2 @@ +bowtie/align: + - "modules/nf-core/bowtie/align/**" diff --git a/modules/nf-core/bowtie/build/environment.yml b/modules/nf-core/bowtie/build/environment.yml new file mode 100644 index 000000000..fff53becc --- /dev/null +++ b/modules/nf-core/bowtie/build/environment.yml @@ -0,0 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + # renovate: datasource=conda depName=bioconda/bowtie + - bioconda::bowtie=1.3.1 + - bioconda::samtools=1.20 diff --git a/modules/nf-core/bowtie/build/main.nf b/modules/nf-core/bowtie/build/main.nf new file mode 100644 index 000000000..953e12f68 --- /dev/null +++ b/modules/nf-core/bowtie/build/main.nf @@ -0,0 +1,50 @@ +process BOWTIE_BUILD { + tag "${meta.id}" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/c8/c8c0819a9b1f520c49c933e667ae50de2a0730ece4c8b9efe79ac5e403963a9f/data' : + 'community.wave.seqera.io/library/bowtie_samtools:e1a14e1ce4e0170d' }" + + input: + tuple val(meta), path(fasta) + + output: + tuple val(meta), path('bowtie') , emit: index + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + """ + mkdir -p bowtie + bowtie-build --threads $task.cpus $fasta bowtie/${prefix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie: \$(echo \$(bowtie --version 2>&1) | sed 's/^.*bowtie-align-s version //; s/ .*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + mkdir -p bowtie + touch bowtie/${prefix}.1.ebwt + touch bowtie/${prefix}.2.ebwt + touch bowtie/${prefix}.3.ebwt + touch bowtie/${prefix}.4.ebwt + touch bowtie/${prefix}.rev.1.ebwt + touch bowtie/${prefix}.rev.2.ebwt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie: \$(echo \$(bowtie --version 2>&1) | sed 's/^.*bowtie-align-s version //; s/ .*\$//') + END_VERSIONS + """ + +} diff --git a/modules/nf-core/bowtie/build/meta.yml b/modules/nf-core/bowtie/build/meta.yml new file mode 100644 index 000000000..af84c5cc4 --- /dev/null +++ b/modules/nf-core/bowtie/build/meta.yml @@ -0,0 +1,48 @@ +name: bowtie_build +description: Create bowtie index for reference genome +keywords: + - index + - fasta + - genome + - reference +tools: + - bowtie: + description: | + bowtie is a software package for mapping DNA sequences against + a large reference genome, such as the human genome. + homepage: http://bowtie-bio.sourceforge.net/index.shtml + documentation: http://bowtie-bio.sourceforge.net/manual.shtml + arxiv: arXiv:1303.3997 + licence: ["Artistic-2.0"] + identifier: biotools:bowtie +input: + - - meta: + type: map + description: | + Groovy Map containing information about the genome fasta + e.g. [ id:'test' ] + - fasta: + type: file + description: Input genome fasta file +output: + - index: + - meta: + type: map + description: | + Groovy Map containing information about the genome fasta + e.g. [ id:'test' ] + - bowtie: + type: file + description: Folder containing bowtie genome index files + pattern: "*.ebwt" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@kevinmenden" + - "@drpatelh" +maintainers: + - "@kevinmenden" + - "@drpatelh" diff --git a/modules/nf-core/bowtie/build/tests/main.nf.test b/modules/nf-core/bowtie/build/tests/main.nf.test new file mode 100644 index 000000000..1811013d5 --- /dev/null +++ b/modules/nf-core/bowtie/build/tests/main.nf.test @@ -0,0 +1,60 @@ +nextflow_process { + + name "Test Process BOWTIE_BUILD" + script "../main.nf" + process "BOWTIE_BUILD" + + tag "modules" + tag "modules_nfcore" + tag "bowtie" + tag "bowtie/build" + + test("sarscov2 - fasta") { + + when { + process { + """ + input[0] = [ + [id: 'sarscov2'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fasta - stub") { + + options "-stub" + tag "version" + tag "stub" + + when { + process { + """ + input[0] = [[id: 'sarscov2'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot(path(process.out.versions.get(0)).yaml).match("versions") }, + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/bowtie/build/tests/main.nf.test.snap b/modules/nf-core/bowtie/build/tests/main.nf.test.snap new file mode 100644 index 000000000..e71a80d92 --- /dev/null +++ b/modules/nf-core/bowtie/build/tests/main.nf.test.snap @@ -0,0 +1,110 @@ +{ + "sarscov2 - fasta - stub": { + "content": [ + { + "0": [ + [ + { + "id": "sarscov2" + }, + [ + "sarscov2.1.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.2.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.3.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.4.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.rev.1.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.rev.2.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,01c0299b236b1052f80f4be6aacfae6b" + ], + "index": [ + [ + { + "id": "sarscov2" + }, + [ + "sarscov2.1.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.2.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.3.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.4.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.rev.1.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sarscov2.rev.2.ebwt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,01c0299b236b1052f80f4be6aacfae6b" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-14T10:56:03.634167" + }, + "versions": { + "content": [ + { + "BOWTIE_BUILD": { + "bowtie": "1.3.1" + } + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-10T11:48:00.007395903" + }, + "sarscov2 - fasta": { + "content": [ + { + "0": [ + [ + { + "id": "sarscov2" + }, + [ + "sarscov2.1.ebwt:md5,d9b76ecf9fd0413240173273b38d8199", + "sarscov2.2.ebwt:md5,02b44af9f94c62ecd3c583048e25d4cf", + "sarscov2.3.ebwt:md5,4ed93abba181d8dfab2e303e33114777", + "sarscov2.4.ebwt:md5,c25be5f8b0378abf7a58c8a880b87626", + "sarscov2.rev.1.ebwt:md5,b37aaf11853e65a3b13561f27a912b06", + "sarscov2.rev.2.ebwt:md5,9e6b0c4c1ddb99ae71ff8a4fe5ec6459" + ] + ] + ], + "1": [ + "versions.yml:md5,01c0299b236b1052f80f4be6aacfae6b" + ], + "index": [ + [ + { + "id": "sarscov2" + }, + [ + "sarscov2.1.ebwt:md5,d9b76ecf9fd0413240173273b38d8199", + "sarscov2.2.ebwt:md5,02b44af9f94c62ecd3c583048e25d4cf", + "sarscov2.3.ebwt:md5,4ed93abba181d8dfab2e303e33114777", + "sarscov2.4.ebwt:md5,c25be5f8b0378abf7a58c8a880b87626", + "sarscov2.rev.1.ebwt:md5,b37aaf11853e65a3b13561f27a912b06", + "sarscov2.rev.2.ebwt:md5,9e6b0c4c1ddb99ae71ff8a4fe5ec6459" + ] + ] + ], + "versions": [ + "versions.yml:md5,01c0299b236b1052f80f4be6aacfae6b" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.0" + }, + "timestamp": "2024-11-14T10:56:00.181902" + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie/build/tests/tags.yml b/modules/nf-core/bowtie/build/tests/tags.yml new file mode 100644 index 000000000..1ccfa30c9 --- /dev/null +++ b/modules/nf-core/bowtie/build/tests/tags.yml @@ -0,0 +1,2 @@ +bowtie/build: + - "modules/nf-core/bowtie/build/**" diff --git a/modules/nf-core/bowtie2/align/environment.yml b/modules/nf-core/bowtie2/align/environment.yml new file mode 100644 index 000000000..0be959067 --- /dev/null +++ b/modules/nf-core/bowtie2/align/environment.yml @@ -0,0 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bowtie2=2.5.2 + - bioconda::samtools=1.18 + - conda-forge::pigz=2.6 diff --git a/modules/nf-core/bowtie2/align/main.nf b/modules/nf-core/bowtie2/align/main.nf new file mode 100644 index 000000000..7b2f25eb4 --- /dev/null +++ b/modules/nf-core/bowtie2/align/main.nf @@ -0,0 +1,116 @@ +process BOWTIE2_ALIGN { + tag "$meta.id" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:f70b31a2db15c023d641c32f433fb02cd04df5a6-0' : + 'biocontainers/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:f70b31a2db15c023d641c32f433fb02cd04df5a6-0' }" + + input: + tuple val(meta) , path(reads) + tuple val(meta2), path(index) + tuple val(meta3), path(fasta) + val save_unaligned + val sort_bam + + output: + tuple val(meta), path("*.sam") , emit: sam , optional:true + tuple val(meta), path("*.bam") , emit: bam , optional:true + tuple val(meta), path("*.cram") , emit: cram , optional:true + tuple val(meta), path("*.csi") , emit: csi , optional:true + tuple val(meta), path("*.crai") , emit: crai , optional:true + tuple val(meta), path("*.log") , emit: log + tuple val(meta), path("*fastq.gz") , emit: fastq , optional:true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: "" + def args2 = task.ext.args2 ?: "" + def prefix = task.ext.prefix ?: "${meta.id}" + + def unaligned = "" + def reads_args = "" + if (meta.single_end) { + unaligned = save_unaligned ? "--un-gz ${prefix}.unmapped.fastq.gz" : "" + reads_args = "-U ${reads}" + } else { + unaligned = save_unaligned ? "--un-conc-gz ${prefix}.unmapped.fastq.gz" : "" + reads_args = "-1 ${reads[0]} -2 ${reads[1]}" + } + + def samtools_command = sort_bam ? 'sort' : 'view' + def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ + def extension_matcher = (args2 =~ extension_pattern) + def extension = extension_matcher.getCount() > 0 ? extension_matcher[0][2].toLowerCase() : "bam" + def reference = fasta && extension=="cram" ? "--reference ${fasta}" : "" + if (!fasta && extension=="cram") error "Fasta reference is required for CRAM output" + + """ + INDEX=`find -L ./ -name "*.rev.1.bt2" | sed "s/\\.rev.1.bt2\$//"` + [ -z "\$INDEX" ] && INDEX=`find -L ./ -name "*.rev.1.bt2l" | sed "s/\\.rev.1.bt2l\$//"` + [ -z "\$INDEX" ] && echo "Bowtie2 index files not found" 1>&2 && exit 1 + + bowtie2 \\ + -x \$INDEX \\ + $reads_args \\ + --threads $task.cpus \\ + $unaligned \\ + $args \\ + 2> >(tee ${prefix}.bowtie2.log >&2) \\ + | samtools $samtools_command $args2 --threads $task.cpus ${reference} -o ${prefix}.${extension} - + + if [ -f ${prefix}.unmapped.fastq.1.gz ]; then + mv ${prefix}.unmapped.fastq.1.gz ${prefix}.unmapped_1.fastq.gz + fi + + if [ -f ${prefix}.unmapped.fastq.2.gz ]; then + mv ${prefix}.unmapped.fastq.2.gz ${prefix}.unmapped_2.fastq.gz + fi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//') + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) + END_VERSIONS + """ + + stub: + def args2 = task.ext.args2 ?: "" + def prefix = task.ext.prefix ?: "${meta.id}" + def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ + def extension = (args2 ==~ extension_pattern) ? (args2 =~ extension_pattern)[0][2].toLowerCase() : "bam" + def create_unmapped = "" + if (meta.single_end) { + create_unmapped = save_unaligned ? "touch ${prefix}.unmapped.fastq.gz" : "" + } else { + create_unmapped = save_unaligned ? "touch ${prefix}.unmapped_1.fastq.gz && touch ${prefix}.unmapped_2.fastq.gz" : "" + } + if (!fasta && extension=="cram") error "Fasta reference is required for CRAM output" + + def create_index = "" + if (extension == "cram") { + create_index = "touch ${prefix}.crai" + } else if (extension == "bam") { + create_index = "touch ${prefix}.csi" + } + + """ + touch ${prefix}.${extension} + ${create_index} + touch ${prefix}.bowtie2.log + ${create_unmapped} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//') + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) + END_VERSIONS + """ + +} diff --git a/modules/nf-core/bowtie2/align/meta.yml b/modules/nf-core/bowtie2/align/meta.yml new file mode 100644 index 000000000..7436097b8 --- /dev/null +++ b/modules/nf-core/bowtie2/align/meta.yml @@ -0,0 +1,132 @@ +name: bowtie2_align +description: Align reads to a reference genome using bowtie2 +keywords: + - align + - map + - fasta + - fastq + - genome + - reference +tools: + - bowtie2: + description: | + Bowtie 2 is an ultrafast and memory-efficient tool for aligning + sequencing reads to long reference sequences. + homepage: http://bowtie-bio.sourceforge.net/bowtie2/index.shtml + documentation: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml + doi: 10.1038/nmeth.1923 + licence: ["GPL-3.0-or-later"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test', single_end:false ] + - index: + type: file + description: Bowtie2 genome index files + pattern: "*.ebwt" + - - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Bowtie2 genome fasta file + pattern: "*.fasta" + - - save_unaligned: + type: boolean + description: | + Save reads that do not map to the reference (true) or discard them (false) + (default: false) + - - sort_bam: + type: boolean + description: use samtools sort (true) or samtools view (false) + pattern: "true or false" +output: + - sam: + - meta: + type: file + description: Output SAM file containing read alignments + pattern: "*.sam" + - "*.sam": + type: file + description: Output SAM file containing read alignments + pattern: "*.sam" + - bam: + - meta: + type: file + description: Output BAM file containing read alignments + pattern: "*.bam" + - "*.bam": + type: file + description: Output BAM file containing read alignments + pattern: "*.bam" + - cram: + - meta: + type: file + description: Output CRAM file containing read alignments + pattern: "*.cram" + - "*.cram": + type: file + description: Output CRAM file containing read alignments + pattern: "*.cram" + - csi: + - meta: + type: file + description: Output SAM/BAM index for large inputs + pattern: "*.csi" + - "*.csi": + type: file + description: Output SAM/BAM index for large inputs + pattern: "*.csi" + - crai: + - meta: + type: file + description: Output CRAM index + pattern: "*.crai" + - "*.crai": + type: file + description: Output CRAM index + pattern: "*.crai" + - log: + - meta: + type: file + description: Alignment log + pattern: "*.log" + - "*.log": + type: file + description: Alignment log + pattern: "*.log" + - fastq: + - meta: + type: file + description: Unaligned FastQ files + pattern: "*.fastq.gz" + - "*fastq.gz": + type: file + description: Unaligned FastQ files + pattern: "*.fastq.gz" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@joseespinosa" + - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bowtie2/align/tests/cram_crai.config b/modules/nf-core/bowtie2/align/tests/cram_crai.config new file mode 100644 index 000000000..03f1d5e51 --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/cram_crai.config @@ -0,0 +1,5 @@ +process { + withName: BOWTIE2_ALIGN { + ext.args2 = '--output-fmt cram --write-index' + } +} diff --git a/modules/nf-core/bowtie2/align/tests/large_index.config b/modules/nf-core/bowtie2/align/tests/large_index.config new file mode 100644 index 000000000..fdc1c59dd --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/large_index.config @@ -0,0 +1,5 @@ +process { + withName: BOWTIE2_BUILD { + ext.args = '--large-index' + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test b/modules/nf-core/bowtie2/align/tests/main.nf.test new file mode 100644 index 000000000..0de5950fe --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test @@ -0,0 +1,623 @@ +nextflow_process { + + name "Test Process BOWTIE2_ALIGN" + script "../main.nf" + process "BOWTIE2_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "bowtie2" + tag "bowtie2/build" + tag "bowtie2/align" + + test("sarscov2 - fastq, index, fasta, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, false, false - sam") { + + config "./sam.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.sam[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, false, false - sam2") { + + config "./sam2.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.sam[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, large_index, fasta, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], large_index, fasta, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, true, true - cram") { + + config "./cram_crai.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = true //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.cram[0][1]).name, + file(process.out.crai[0][1]).name + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, false, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + file(process.out.csi[0][1]).name, + file(process.out.log[0][1]).name, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, true, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + file(process.out.csi[0][1]).name, + file(process.out.log[0][1]).name, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test.snap b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap new file mode 100644 index 000000000..028e7da68 --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap @@ -0,0 +1,311 @@ +{ + "sarscov2 - [fastq1, fastq2], large_index, fasta, false, false - bam": { + "content": [ + "test.bam", + [ + [ + { + "id": "test", + "single_end": false + }, + "test.bowtie2.log:md5,bd89ce1b28c93bf822bae391ffcedd19" + ] + ], + [ + + ], + [ + "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T13:19:25.337323" + }, + "sarscov2 - fastq, index, fasta, false, false - sam2": { + "content": [ + [ + "ERR5069949.2151832\t16\tMT192765.1\t17453\t42\t150M\t*\t0\t0\tACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA\tAAAA versions.yml + "${task.process}": + bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//') + END_VERSIONS + """ + + stub: + """ + mkdir bowtie2 + touch bowtie2/${fasta.baseName}.{1..4}.bt2 + touch bowtie2/${fasta.baseName}.rev.{1,2}.bt2 + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/bowtie2/build/meta.yml b/modules/nf-core/bowtie2/build/meta.yml new file mode 100644 index 000000000..2729a92ec --- /dev/null +++ b/modules/nf-core/bowtie2/build/meta.yml @@ -0,0 +1,49 @@ +name: bowtie2_build +description: Builds bowtie index for reference genome +keywords: + - build + - index + - fasta + - genome + - reference +tools: + - bowtie2: + description: | + Bowtie 2 is an ultrafast and memory-efficient tool for aligning + sequencing reads to long reference sequences. + homepage: http://bowtie-bio.sourceforge.net/bowtie2/index.shtml + documentation: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml + doi: 10.1038/nmeth.1923 + licence: ["GPL-3.0-or-later"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Input genome fasta file +output: + - index: + - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test', single_end:false ] + - bowtie2: + type: file + description: Bowtie2 genome index files + pattern: "*.bt2" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@joseespinosa" + - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bowtie2/build/tests/main.nf.test b/modules/nf-core/bowtie2/build/tests/main.nf.test new file mode 100644 index 000000000..163760257 --- /dev/null +++ b/modules/nf-core/bowtie2/build/tests/main.nf.test @@ -0,0 +1,31 @@ +nextflow_process { + + name "Test Process BOWTIE2_BUILD" + script "modules/nf-core/bowtie2/build/main.nf" + process "BOWTIE2_BUILD" + tag "modules" + tag "modules_nfcore" + tag "bowtie2" + tag "bowtie2/build" + + test("Should run without failures") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assert process.success + assert snapshot(process.out).match() + } + + } + +} diff --git a/modules/nf-core/bowtie2/build/tests/main.nf.test.snap b/modules/nf-core/bowtie2/build/tests/main.nf.test.snap new file mode 100644 index 000000000..6875e0213 --- /dev/null +++ b/modules/nf-core/bowtie2/build/tests/main.nf.test.snap @@ -0,0 +1,45 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + [ + "genome.1.bt2:md5,cbe3d0bbea55bc57c99b4bfa25b5fbdf", + "genome.2.bt2:md5,47b153cd1319abc88dda532462651fcf", + "genome.3.bt2:md5,4ed93abba181d8dfab2e303e33114777", + "genome.4.bt2:md5,c25be5f8b0378abf7a58c8a880b87626", + "genome.rev.1.bt2:md5,52be6950579598a990570fbcf5372184", + "genome.rev.2.bt2:md5,e3b4ef343dea4dd571642010a7d09597" + ] + ] + ], + "1": [ + "versions.yml:md5,1df11e9b82891527271c889c880d3974" + ], + "index": [ + [ + { + "id": "test" + }, + [ + "genome.1.bt2:md5,cbe3d0bbea55bc57c99b4bfa25b5fbdf", + "genome.2.bt2:md5,47b153cd1319abc88dda532462651fcf", + "genome.3.bt2:md5,4ed93abba181d8dfab2e303e33114777", + "genome.4.bt2:md5,c25be5f8b0378abf7a58c8a880b87626", + "genome.rev.1.bt2:md5,52be6950579598a990570fbcf5372184", + "genome.rev.2.bt2:md5,e3b4ef343dea4dd571642010a7d09597" + ] + ] + ], + "versions": [ + "versions.yml:md5,1df11e9b82891527271c889c880d3974" + ] + } + ], + "timestamp": "2023-11-23T11:51:01.107681997" + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie2/build/tests/tags.yml b/modules/nf-core/bowtie2/build/tests/tags.yml new file mode 100644 index 000000000..81aa61dab --- /dev/null +++ b/modules/nf-core/bowtie2/build/tests/tags.yml @@ -0,0 +1,2 @@ +bowtie2/build: + - modules/nf-core/bowtie2/build/** diff --git a/modules/nf-core/bwa/index/environment.yml b/modules/nf-core/bwa/index/environment.yml new file mode 100644 index 000000000..35c9da752 --- /dev/null +++ b/modules/nf-core/bwa/index/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bwa=0.7.18 diff --git a/modules/nf-core/bwa/index/main.nf b/modules/nf-core/bwa/index/main.nf new file mode 100644 index 000000000..29d995774 --- /dev/null +++ b/modules/nf-core/bwa/index/main.nf @@ -0,0 +1,53 @@ +process BWA_INDEX { + tag "$fasta" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bwa:0.7.18--he4a0461_0' : + 'biocontainers/bwa:0.7.18--he4a0461_0' }" + + input: + tuple val(meta), path(fasta) + + output: + tuple val(meta), path("bwa") , emit: index + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def prefix = task.ext.prefix ?: "${fasta.baseName}" + def args = task.ext.args ?: '' + """ + mkdir bwa + bwa \\ + index \\ + $args \\ + -p bwa/${prefix} \\ + $fasta + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bwa: \$(echo \$(bwa 2>&1) | sed 's/^.*Version: //; s/Contact:.*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${fasta.baseName}" + """ + mkdir bwa + + touch bwa/${prefix}.amb + touch bwa/${prefix}.ann + touch bwa/${prefix}.bwt + touch bwa/${prefix}.pac + touch bwa/${prefix}.sa + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bwa: \$(echo \$(bwa 2>&1) | sed 's/^.*Version: //; s/Contact:.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/bwa/index/meta.yml b/modules/nf-core/bwa/index/meta.yml new file mode 100644 index 000000000..77dbc7af0 --- /dev/null +++ b/modules/nf-core/bwa/index/meta.yml @@ -0,0 +1,56 @@ +name: bwa_index +description: Create BWA index for reference genome +keywords: + - index + - fasta + - genome + - reference +tools: + - bwa: + description: | + BWA is a software package for mapping DNA sequences against + a large reference genome, such as the human genome. + homepage: http://bio-bwa.sourceforge.net/ + documentation: https://bio-bwa.sourceforge.net/bwa.shtml + arxiv: arXiv:1303.3997 + licence: ["GPL-3.0-or-later"] + identifier: "biotools:bwa" +input: + - - meta: + type: map + description: | + Groovy Map containing reference information. + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Input genome fasta file + ontologies: + - edam: "http://edamontology.org/data_2044" # Sequence + - edam: "http://edamontology.org/format_1929" # FASTA +output: + - index: + - meta: + type: map + description: | + Groovy Map containing reference information. + e.g. [ id:'test', single_end:false ] + - bwa: + type: map + description: | + Groovy Map containing reference information. + e.g. [ id:'test', single_end:false ] + pattern: "*.{amb,ann,bwt,pac,sa}" + ontologies: + - edam: "http://edamontology.org/data_3210" # Genome index + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@maxulysse" +maintainers: + - "@drpatelh" + - "@maxulysse" + - "@gallvp" diff --git a/modules/nf-core/bwa/index/tests/main.nf.test b/modules/nf-core/bwa/index/tests/main.nf.test new file mode 100644 index 000000000..af33e73ca --- /dev/null +++ b/modules/nf-core/bwa/index/tests/main.nf.test @@ -0,0 +1,33 @@ +nextflow_process { + + name "Test Process BWA_INDEX" + tag "modules_nfcore" + tag "modules" + tag "bwa" + tag "bwa/index" + script "../main.nf" + process "BWA_INDEX" + + test("BWA index") { + + when { + process { + """ + input[0] = [ + [id: 'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bwa/index/tests/main.nf.test.snap b/modules/nf-core/bwa/index/tests/main.nf.test.snap new file mode 100644 index 000000000..7c8f04657 --- /dev/null +++ b/modules/nf-core/bwa/index/tests/main.nf.test.snap @@ -0,0 +1,47 @@ +{ + "BWA index": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + [ + "genome.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", + "genome.ann:md5,c32e11f6c859f166c7525a9c1d583567", + "genome.bwt:md5,0469c30a1e239dd08f68afe66fde99da", + "genome.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66", + "genome.sa:md5,ab3952cabf026b48cd3eb5bccbb636d1" + ] + ] + ], + "1": [ + "versions.yml:md5,a64462ac7dfb21f4ade9b02e7f65c5bb" + ], + "index": [ + [ + { + "id": "test" + }, + [ + "genome.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", + "genome.ann:md5,c32e11f6c859f166c7525a9c1d583567", + "genome.bwt:md5,0469c30a1e239dd08f68afe66fde99da", + "genome.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66", + "genome.sa:md5,ab3952cabf026b48cd3eb5bccbb636d1" + ] + ] + ], + "versions": [ + "versions.yml:md5,a64462ac7dfb21f4ade9b02e7f65c5bb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-16T11:40:09.925307" + } +} \ No newline at end of file diff --git a/modules/nf-core/bwa/index/tests/tags.yml b/modules/nf-core/bwa/index/tests/tags.yml new file mode 100644 index 000000000..28bb483c4 --- /dev/null +++ b/modules/nf-core/bwa/index/tests/tags.yml @@ -0,0 +1,2 @@ +bwa/index: + - modules/nf-core/bwa/index/** diff --git a/modules/nf-core/cat/cat/environment.yml b/modules/nf-core/cat/cat/environment.yml new file mode 100644 index 000000000..50c2059af --- /dev/null +++ b/modules/nf-core/cat/cat/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::pigz=2.3.4 diff --git a/modules/nf-core/cat/cat/main.nf b/modules/nf-core/cat/cat/main.nf new file mode 100644 index 000000000..2862c64cd --- /dev/null +++ b/modules/nf-core/cat/cat/main.nf @@ -0,0 +1,78 @@ +process CAT_CAT { + tag "$meta.id" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/pigz:2.3.4' : + 'biocontainers/pigz:2.3.4' }" + + input: + tuple val(meta), path(files_in) + + output: + tuple val(meta), path("${prefix}"), emit: file_out + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def args2 = task.ext.args2 ?: '' + def file_list = files_in.collect { it.toString() } + + // choose appropriate concatenation tool depending on input and output format + + // | input | output | command1 | command2 | + // |-----------|------------|----------|----------| + // | gzipped | gzipped | cat | | + // | ungzipped | ungzipped | cat | | + // | gzipped | ungzipped | zcat | | + // | ungzipped | gzipped | cat | pigz | + + // Use input file ending as default + prefix = task.ext.prefix ?: "${meta.id}${getFileSuffix(file_list[0])}" + out_zip = prefix.endsWith('.gz') + in_zip = file_list[0].endsWith('.gz') + command1 = (in_zip && !out_zip) ? 'zcat' : 'cat' + command2 = (!in_zip && out_zip) ? "| pigz -c -p $task.cpus $args2" : '' + if(file_list.contains(prefix.trim())) { + error "The name of the input file can't be the same as for the output prefix in the " + + "module CAT_CAT (currently `$prefix`). Please choose a different one." + } + """ + $command1 \\ + $args \\ + ${file_list.join(' ')} \\ + $command2 \\ + > ${prefix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) + END_VERSIONS + """ + + stub: + def file_list = files_in.collect { it.toString() } + prefix = task.ext.prefix ?: "${meta.id}${file_list[0].substring(file_list[0].lastIndexOf('.'))}" + if(file_list.contains(prefix.trim())) { + error "The name of the input file can't be the same as for the output prefix in the " + + "module CAT_CAT (currently `$prefix`). Please choose a different one." + } + """ + touch $prefix + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) + END_VERSIONS + """ +} + +// for .gz files also include the second to last extension if it is present. E.g., .fasta.gz +def getFileSuffix(filename) { + def match = filename =~ /^.*?((\.\w{1,5})?(\.\w{1,5}\.gz$))/ + return match ? match[0][1] : filename.substring(filename.lastIndexOf('.')) +} diff --git a/modules/nf-core/cat/cat/meta.yml b/modules/nf-core/cat/cat/meta.yml new file mode 100644 index 000000000..81778a067 --- /dev/null +++ b/modules/nf-core/cat/cat/meta.yml @@ -0,0 +1,43 @@ +name: cat_cat +description: A module for concatenation of gzipped or uncompressed files +keywords: + - concatenate + - gzip + - cat +tools: + - cat: + description: Just concatenation + documentation: https://man7.org/linux/man-pages/man1/cat.1.html + licence: ["GPL-3.0-or-later"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - files_in: + type: file + description: List of compressed / uncompressed files + pattern: "*" +output: + - file_out: + - meta: + type: file + description: Concatenated file. Will be gzipped if file_out ends with ".gz" + pattern: "${file_out}" + - ${prefix}: + type: file + description: Concatenated file. Will be gzipped if file_out ends with ".gz" + pattern: "${file_out}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@erikrikarddaniel" + - "@FriederikeHanssen" +maintainers: + - "@erikrikarddaniel" + - "@FriederikeHanssen" diff --git a/modules/nf-core/cat/cat/tests/main.nf.test b/modules/nf-core/cat/cat/tests/main.nf.test new file mode 100644 index 000000000..9cb161788 --- /dev/null +++ b/modules/nf-core/cat/cat/tests/main.nf.test @@ -0,0 +1,191 @@ +nextflow_process { + + name "Test Process CAT_CAT" + script "../main.nf" + process "CAT_CAT" + tag "modules" + tag "modules_nfcore" + tag "cat" + tag "cat/cat" + + test("test_cat_name_conflict") { + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'genome', single_end:true ], + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) + ] + ] + """ + } + } + then { + assertAll( + { assert !process.success }, + { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("test_cat_unzipped_unzipped") { + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) + ] + ] + """ + } + } + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + + test("test_cat_zipped_zipped") { + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/alignment/last/contigs.genome.maf.gz', checkIfExists: true) + ] + ] + """ + } + } + then { + def lines = path(process.out.file_out.get(0).get(1)).linesGzip + assertAll( + { assert process.success }, + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } + ) + } + } + + test("test_cat_zipped_unzipped") { + config './nextflow_zipped_unzipped.config' + + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/alignment/last/contigs.genome.maf.gz', checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_cat_unzipped_zipped") { + config './nextflow_unzipped_zipped.config' + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) + ] + ] + """ + } + } + then { + def lines = path(process.out.file_out.get(0).get(1)).linesGzip + assertAll( + { assert process.success }, + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } + ) + } + } + + test("test_cat_one_file_unzipped_zipped") { + config './nextflow_unzipped_zipped.config' + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + ] + """ + } + } + then { + def lines = path(process.out.file_out.get(0).get(1)).linesGzip + assertAll( + { assert process.success }, + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } + ) + } + } +} diff --git a/modules/nf-core/cat/cat/tests/main.nf.test.snap b/modules/nf-core/cat/cat/tests/main.nf.test.snap new file mode 100644 index 000000000..b7623ee65 --- /dev/null +++ b/modules/nf-core/cat/cat/tests/main.nf.test.snap @@ -0,0 +1,147 @@ +{ + "test_cat_unzipped_unzipped": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2" + ] + ], + "1": [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ], + "file_out": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2" + ] + ], + "versions": [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2023-10-16T14:32:18.500464399" + }, + "test_cat_zipped_unzipped": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9" + ] + ], + "1": [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ], + "file_out": [ + [ + { + "id": "test", + "single_end": true + }, + "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9" + ] + ], + "versions": [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2023-10-16T14:32:49.642741302" + }, + "test_cat_zipped_zipped": { + "content": [ + [ + "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab", + "MT192765.1\tGenbank\tgene\t259\t21548\t.\t+\t.\tParent=unknown_transcript_1", + "MT192765.1\tGenbank\tCDS\t259\t13461\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", + "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", + "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1", + "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1" + ], + 78, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:46.802978" + }, + "test_cat_name_conflict": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:29.45394" + }, + "test_cat_one_file_unzipped_zipped": { + "content": [ + [ + ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", + "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", + "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", + "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", + "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", + "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 374, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:52:02.774016" + }, + "test_cat_unzipped_zipped": { + "content": [ + [ + ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", + "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", + "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", + "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", + "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", + "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 375, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:57.581523" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config new file mode 100644 index 000000000..ec26b0fdc --- /dev/null +++ b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config @@ -0,0 +1,6 @@ + +process { + withName: CAT_CAT { + ext.prefix = 'cat.txt.gz' + } +} diff --git a/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config new file mode 100644 index 000000000..fbc79783d --- /dev/null +++ b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config @@ -0,0 +1,8 @@ + +process { + + withName: CAT_CAT { + ext.prefix = 'cat.txt' + } + +} diff --git a/modules/nf-core/cat/cat/tests/tags.yml b/modules/nf-core/cat/cat/tests/tags.yml new file mode 100644 index 000000000..37b578f52 --- /dev/null +++ b/modules/nf-core/cat/cat/tests/tags.yml @@ -0,0 +1,2 @@ +cat/cat: + - modules/nf-core/cat/cat/** diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml new file mode 100644 index 000000000..9b926b1ff --- /dev/null +++ b/modules/nf-core/cat/fastq/environment.yml @@ -0,0 +1,12 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::coreutils=9.5 + - conda-forge::grep=3.11 + - conda-forge::gzip=1.13 + - conda-forge::lbzip2=2.5 + - conda-forge::sed=4.8 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf new file mode 100644 index 000000000..acfb6d0e6 --- /dev/null +++ b/modules/nf-core/cat/fastq/main.nf @@ -0,0 +1,88 @@ +process CAT_FASTQ { + tag "${meta.id}" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/52/52ccce28d2ab928ab862e25aae26314d69c8e38bd41ca9431c67ef05221348aa/data' + : 'community.wave.seqera.io/library/coreutils_grep_gzip_lbzip2_pruned:838ba80435a629f8'}" + + input: + tuple val(meta), path(reads, stageAs: "input*/*") + + output: + tuple val(meta), path("*.merged.fastq.gz"), emit: reads + path "versions.yml", emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def prefix = task.ext.prefix ?: "${meta.id}" + def readList = reads instanceof List ? reads.collect { it.toString() } : [reads.toString()] + if (meta.single_end) { + if (readList.size >= 1) { + """ + cat ${readList.join(' ')} > ${prefix}.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } else { + error("Could not find any FASTQ files to concatenate in the process input") + } + } + else { + if (readList.size >= 2) { + def read1 = [] + def read2 = [] + readList.eachWithIndex { v, ix -> (ix & 1 ? read2 : read1) << v } + """ + cat ${read1.join(' ')} > ${prefix}_1.merged.fastq.gz + cat ${read2.join(' ')} > ${prefix}_2.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } else { + error("Could not find any FASTQ file pairs to concatenate in the process input") + } + } + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def readList = reads instanceof List ? reads.collect { it.toString() } : [reads.toString()] + if (meta.single_end) { + if (readList.size >= 1) { + """ + echo '' | gzip > ${prefix}.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } else { + error("Could not find any FASTQ files to concatenate in the process input") + } + } + else { + if (readList.size >= 2) { + """ + echo '' | gzip > ${prefix}_1.merged.fastq.gz + echo '' | gzip > ${prefix}_2.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } else { + error("Could not find any FASTQ file pairs to concatenate in the process input") + } + } +} diff --git a/modules/nf-core/cat/fastq/meta.yml b/modules/nf-core/cat/fastq/meta.yml new file mode 100644 index 000000000..91ff2fb5f --- /dev/null +++ b/modules/nf-core/cat/fastq/meta.yml @@ -0,0 +1,45 @@ +name: cat_fastq +description: Concatenates fastq files +keywords: + - cat + - fastq + - concatenate +tools: + - cat: + description: | + The cat utility reads files sequentially, writing them to the standard output. + documentation: https://www.gnu.org/software/coreutils/manual/html_node/cat-invocation.html + licence: ["GPL-3.0-or-later"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files to be concatenated. +output: + - reads: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.merged.fastq.gz": + type: file + description: Merged fastq file + pattern: "*.{merged.fastq.gz}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@joseespinosa" + - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test new file mode 100644 index 000000000..013c1d0f4 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -0,0 +1,334 @@ +nextflow_process { + + name "Test Process CAT_FASTQ" + script "../main.nf" + process "CAT_FASTQ" + tag "modules" + tag "modules_nfcore" + tag "cat" + tag "cat/fastq" + + test("test_cat_fastq_single_end") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_same_name") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end_same_name") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_single_file") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_single_file - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_no_files") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [] + ]) + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } + ) + } + } + + test("test_cat_fastq_paired_end_no_files") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [] + ]) + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } + ) + } + } + + test("test_cat_fastq_single_end_no_files - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [] + ]) + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } + ) + } + } + + test("test_cat_fastq_paired_end_no_files - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [] + ]) + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() } + ) + } + } +} diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap new file mode 100644 index 000000000..ee5ab3647 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -0,0 +1,416 @@ +{ + "test_cat_fastq_paired_end_no_files - stub": { + "content": [ + " Could not find any FASTQ file pairs to concatenate in the process input" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:14:51.248685461" + }, + "test_cat_fastq_single_end_single_file": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:24:04.902821069" + }, + "test_cat_fastq_paired_end_same_name": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:23:57.476357974" + }, + "test_cat_fastq_paired_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:24:34.615815265" + }, + "test_cat_fastq_single_end": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:23:32.489874386" + }, + "test_cat_fastq_single_end_same_name": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:23:49.184759506" + }, + "test_cat_fastq_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:24:12.857293744" + }, + "test_cat_fastq_paired_end_no_files": { + "content": [ + " Could not find any FASTQ file pairs to concatenate in the process input" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:14:40.806088747" + }, + "test_cat_fastq_single_end_no_files - stub": { + "content": [ + " Could not find any FASTQ files to concatenate in the process input" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:14:45.852365218" + }, + "test_cat_fastq_single_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:24:27.816080065" + }, + "test_cat_fastq_paired_end": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:23:41.739469187" + }, + "test_cat_fastq_single_end_no_files": { + "content": [ + " Could not find any FASTQ files to concatenate in the process input" + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:14:35.695192409" + }, + "test_cat_fastq_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:24:21.178950408" + }, + "test_cat_fastq_single_end_single_file - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-02-25T17:24:40.851404993" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml new file mode 100644 index 000000000..6ac436140 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/tags.yml @@ -0,0 +1,2 @@ +cat/fastq: + - modules/nf-core/cat/fastq/** diff --git a/modules/nf-core/circexplorer2/annotate/environment.yml b/modules/nf-core/circexplorer2/annotate/environment.yml new file mode 100644 index 000000000..1eac75ec8 --- /dev/null +++ b/modules/nf-core/circexplorer2/annotate/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::circexplorer2=2.3.8 diff --git a/modules/nf-core/circexplorer2/annotate/main.nf b/modules/nf-core/circexplorer2/annotate/main.nf new file mode 100644 index 000000000..0e9fa0a02 --- /dev/null +++ b/modules/nf-core/circexplorer2/annotate/main.nf @@ -0,0 +1,50 @@ +process CIRCEXPLORER2_ANNOTATE { + tag "$meta.id" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/circexplorer2:2.3.8--pyh864c0ab_1': + 'biocontainers/circexplorer2:2.3.8--pyh864c0ab_1' }" + + input: + tuple val(meta), path(junctions) + path(fasta) + path(gene_annotation) + + output: + tuple val(meta), path("*.txt"), emit: txt + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + """ + CIRCexplorer2 \\ + annotate \\ + -r $gene_annotation \\ + -g $fasta \\ + -b $junctions \\ + -o ${prefix}.txt \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + circexplorer2: \$(echo \$(CIRCexplorer2 --version 2>&1) ) + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + circexplorer2: \$(echo \$(CIRCexplorer2 --version 2>&1) ) + END_VERSIONS + """ +} diff --git a/modules/nf-core/circexplorer2/annotate/meta.yml b/modules/nf-core/circexplorer2/annotate/meta.yml new file mode 100644 index 000000000..20b853104 --- /dev/null +++ b/modules/nf-core/circexplorer2/annotate/meta.yml @@ -0,0 +1,52 @@ +name: "circexplorer2_annotate" +description: Annotate circRNAs detected in the output from CIRCexplorer2 parse +keywords: + - rna + - circrna + - annotate +tools: + - "circexplorer2": + description: "Circular RNA analysis toolkits" + homepage: "https://github.com/YangLab/CIRCexplorer2/" + documentation: "https://circexplorer2.readthedocs.io/en/latest/" + doi: "10.1101/gr.202895.115" + licence: ["MIT License"] + identifier: biotools:CIRCexplorer2 +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - junctions: + type: file + description: Reformatted junctions file + pattern: "*.{junction}" + - - fasta: + type: file + description: Genome FASTA file + pattern: "*.{fa,fasta}" + - - gene_annotation: + type: file + description: Reformatted GTF file for CIRCexplorer2 + pattern: "*.{txt}" +output: + - txt: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.txt": + type: file + description: Annotated circRNA TXT file + pattern: "*.{txt}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@BarryDigby" +maintainers: + - "@BarryDigby" diff --git a/modules/nf-core/circexplorer2/annotate/tests/main.nf.test b/modules/nf-core/circexplorer2/annotate/tests/main.nf.test new file mode 100644 index 000000000..3ad614a4f --- /dev/null +++ b/modules/nf-core/circexplorer2/annotate/tests/main.nf.test @@ -0,0 +1,73 @@ + +nextflow_process { + + name "Test Process CIRCEXPLORER2_ANNOTATE" + script "../main.nf" + process "CIRCEXPLORER2_ANNOTATE" + + tag "modules" + tag "modules_nfcore" + tag "circexplorer2" + tag "circexplorer2/annotate" + + test("test-circexplorer2-annotate") { + + when { + process { + """ + input[0] = [ + [ id:'fust1_3' ], + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/circexplorer2/fust1_3.junction.bed") + ] + input[1] = [ + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/reference/chrI.fa") + ] + input[2] = [ + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/reference/chrI.txt") + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.txt[0][1]).readLines()[3..7], + process.out.versions + ).match() + } + ) + } + } + + test("test-circexplorer2-annotate-stub") { + options '-stub' + when { + process { + """ + input[0] = [ + [ id:'fust1_3' ], + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/circexplorer2/fust1_3.junction.bed") + ] + input[1] = [ + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/reference/chrI.fa") + ] + input[2] = [ + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/reference/chrI.txt") + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/circexplorer2/annotate/tests/main.nf.test.snap b/modules/nf-core/circexplorer2/annotate/tests/main.nf.test.snap new file mode 100644 index 000000000..4d06b8a1a --- /dev/null +++ b/modules/nf-core/circexplorer2/annotate/tests/main.nf.test.snap @@ -0,0 +1,54 @@ +{ + "test-circexplorer2-annotate": { + "content": [ + [ + "chrI\t1166228\t1167979\tcircular_RNA/3\t0\t-\t1166228\t1166228\t0,0,0\t3\t100,206,325\t0,152,1426\t3\tcircRNA\thaf-6\tNM_001306301\t6,5,4\tchrI:1164729-1166228|chrI:1167979-1169559", + "chrI\t1212576\t1222830\tcircular_RNA/1\t0\t+\t1212576\t1212576\t0,0,0\t4\t200,193,198,151\t0,1213,8473,10103\t1\tcircRNA\therc-1\tNM_058433\t2,3,4,5\tchrI:1211591-1212576|chrI:1222830-1232374", + "chrI\t1221049\t1234675\tcircular_RNA/2\t0\t+\t1221049\t1221049\t0,0,0\t5\t198,151,262,107,181\t0,1630,11325,12729,13445\t2\tcircRNA\therc-1\tNM_058433\t4,5,6,7,8\tchrI:1213982-1221049|chrI:1234675-1236164", + "chrI\t1225178\t1225538\tcircular_RNA/1\t0\t-\t1225178\t1225178\t0,0,0\t1\t360\t0\t1\tcircRNA\tY48G8AL.13\tNM_058435\t2\tchrI:1224781-1225178|chrI:1225538-1226621", + "chrI\t1247364\t1247592\tcircular_RNA/1\t0\t+\t1247364\t1247364\t0,0,0\t1\t228\t0\t1\tcircRNA\therc-1\tNM_058433\t15\tchrI:1245394-1247364|chrI:1247592-1247780" + ], + [ + "versions.yml:md5,a7b0ad80540b92d95b487df458960438" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-28T10:44:26.322638" + }, + "test-circexplorer2-annotate-stub": { + "content": [ + { + "0": [ + [ + { + "id": "fust1_3" + }, + "fust1_3.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,a7b0ad80540b92d95b487df458960438" + ], + "txt": [ + [ + { + "id": "fust1_3" + }, + "fust1_3.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,a7b0ad80540b92d95b487df458960438" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-28T10:44:35.023305" + } +} \ No newline at end of file diff --git a/modules/nf-core/circexplorer2/parse/environment.yml b/modules/nf-core/circexplorer2/parse/environment.yml new file mode 100644 index 000000000..1eac75ec8 --- /dev/null +++ b/modules/nf-core/circexplorer2/parse/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::circexplorer2=2.3.8 diff --git a/modules/nf-core/circexplorer2/parse/main.nf b/modules/nf-core/circexplorer2/parse/main.nf new file mode 100644 index 000000000..db7a0063f --- /dev/null +++ b/modules/nf-core/circexplorer2/parse/main.nf @@ -0,0 +1,49 @@ +process CIRCEXPLORER2_PARSE { + tag "$meta.id" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/circexplorer2:2.3.8--pyh864c0ab_1': + 'biocontainers/circexplorer2:2.3.8--pyh864c0ab_1' }" + + input: + tuple val(meta), path(fusions) + + output: + tuple val(meta), path("*.bed"), emit: junction + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def aligner = "${fusions}".endsWith(".junction") ? "-t STAR" : "${fusions}".endsWith(".txt") ? "-t MapSplice" : "${fusions}".endsWith(".bam") ? "-t BWA" : "-t segemehl" + if ("${fusions}" == "${prefix}.bed") error "Input and output names are the same, set prefix in module configuration to disambiguate!" + """ + CIRCexplorer2 \\ + parse \\ + $aligner \\ + $fusions \\ + -b ${prefix}.bed \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + circexplorer2: \$( echo \$(CIRCexplorer2 --version 2>&1) ) + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.bed + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + circexplorer2: \$( echo \$(CIRCexplorer2 --version 2>&1) ) + END_VERSIONS + """ +} diff --git a/modules/nf-core/circexplorer2/parse/meta.yml b/modules/nf-core/circexplorer2/parse/meta.yml new file mode 100644 index 000000000..382c64f30 --- /dev/null +++ b/modules/nf-core/circexplorer2/parse/meta.yml @@ -0,0 +1,46 @@ +name: "circexplorer2_parse" +description: CIRCexplorer2 parses fusion junction files from multiple aligners to + prepare them for CIRCexplorer2 annotate. +keywords: + - parse + - circrna + - splice +tools: + - "circexplorer2": + description: "Circular RNA analysis toolkit" + homepage: "https://github.com/YangLab/CIRCexplorer2/" + documentation: "https://circexplorer2.readthedocs.io/en/latest/" + doi: "10.1101/gr.202895.115" + licence: ["MIT License"] + identifier: biotools:CIRCexplorer2 +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fusions: + type: file + description: BAM (BWA), BED (Segemehl), TXT (MapSplice), or Junction (STAR) + file. Aligner will be autodetected based on file suffix. + pattern: "*.{bam,junction,bed,txt}" +output: + - junction: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bed": + type: file + description: BED file + pattern: "*.bed" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@BarryDigby" +maintainers: + - "@BarryDigby" diff --git a/modules/nf-core/circexplorer2/parse/tests/main.nf.test b/modules/nf-core/circexplorer2/parse/tests/main.nf.test new file mode 100644 index 000000000..4768ab5dd --- /dev/null +++ b/modules/nf-core/circexplorer2/parse/tests/main.nf.test @@ -0,0 +1,62 @@ + +nextflow_process { + + name "Test Process CIRCEXPLORER2_PARSE" + script "../main.nf" + process "CIRCEXPLORER2_PARSE" + + tag "modules" + tag "modules_nfcore" + tag "circexplorer2" + tag "circexplorer2/parse" + + test("test-circexplorer2-parse") { + + when { + process { + """ + input[0] = [ + [ id:'fust1_3' ], + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/circexplorer2/fust1_3.Chimeric.out.junction") + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert file(process.out.junction[0][1]).text.contains('FUSIONJUNC') }, + { assert snapshot( + file(process.out.junction[0][1]).name, // unstable + process.out.versions + ).match() + } + ) + } + } + + test("test-circexplorer2-parse-stub") { + options '-stub' + when { + process { + """ + input[0] = [ + [ id:'fust1_3' ], + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/circexplorer2/fust1_3.Chimeric.out.junction") + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/circexplorer2/parse/tests/main.nf.test.snap b/modules/nf-core/circexplorer2/parse/tests/main.nf.test.snap new file mode 100644 index 000000000..f9b6869f7 --- /dev/null +++ b/modules/nf-core/circexplorer2/parse/tests/main.nf.test.snap @@ -0,0 +1,48 @@ +{ + "test-circexplorer2-parse-stub": { + "content": [ + { + "0": [ + [ + { + "id": "fust1_3" + }, + "fust1_3.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,6490a204cc08154871418e5fbb3aff17" + ], + "junction": [ + [ + { + "id": "fust1_3" + }, + "fust1_3.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,6490a204cc08154871418e5fbb3aff17" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-05T21:58:38.034614" + }, + "test-circexplorer2-parse": { + "content": [ + "fust1_3.bed", + [ + "versions.yml:md5,6490a204cc08154871418e5fbb3aff17" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-06T14:53:55.470118" + } +} \ No newline at end of file diff --git a/modules/nf-core/csvtk/join/environment.yml b/modules/nf-core/csvtk/join/environment.yml new file mode 100644 index 000000000..47679f18f --- /dev/null +++ b/modules/nf-core/csvtk/join/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - bioconda + - conda-forge + +dependencies: + - bioconda::csvtk=0.31.0 diff --git a/modules/nf-core/csvtk/join/main.nf b/modules/nf-core/csvtk/join/main.nf new file mode 100644 index 000000000..0bd6b2a54 --- /dev/null +++ b/modules/nf-core/csvtk/join/main.nf @@ -0,0 +1,49 @@ +process CSVTK_JOIN { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/csvtk:0.31.0--h9ee0642_0': + 'biocontainers/csvtk:0.31.0--h9ee0642_0' }" + + input: + tuple val(meta), path(csv) + + output: + tuple val(meta), path("${prefix}.${out_extension}"), emit: csv + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + out_extension = args.contains('--out-delimiter "\t"') || args.contains('-D "\t"') || args.contains("-D \$'\t'") ? "tsv" : "csv" + """ + csvtk \\ + join \\ + $args \\ + --num-cpus $task.cpus \\ + --out-file ${prefix}.${out_extension} \\ + $csv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + csvtk: \$(echo \$( csvtk version | sed -e "s/csvtk v//g" )) + END_VERSIONS + """ + + stub: + prefix = task.ext.prefix ?: "${meta.id}" + out_extension = args.contains('--out-delimiter "\t"') || args.contains('-D "\t"') || args.contains("-D \$'\t'") ? "tsv" : "csv" + """ + touch ${prefix}.${out_extension} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + csvtk: \$(echo \$( csvtk version | sed -e "s/csvtk v//g" )) + END_VERSIONS + """ +} diff --git a/modules/nf-core/csvtk/join/meta.yml b/modules/nf-core/csvtk/join/meta.yml new file mode 100644 index 000000000..d8671b176 --- /dev/null +++ b/modules/nf-core/csvtk/join/meta.yml @@ -0,0 +1,45 @@ +name: csvtk_join +description: Join two or more CSV (or TSV) tables by selected fields into a single + table +keywords: + - join + - tsv + - csv +tools: + - csvtk: + description: A cross-platform, efficient, practical CSV/TSV toolkit + homepage: http://bioinf.shenwei.me/csvtk + documentation: http://bioinf.shenwei.me/csvtk + tool_dev_url: https://github.com/shenwei356/csvtk + licence: ["MIT"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - csv: + type: file + description: CSV/TSV formatted files + pattern: "*.{csv,tsv}" +output: + - csv: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.${out_extension}: + type: file + description: Joined CSV/TSV file + pattern: "*.{csv,tsv}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "version.yml" +authors: + - "@anoronh4" +maintainers: + - "@anoronh4" diff --git a/modules/nf-core/csvtk/join/tests/main.nf.test b/modules/nf-core/csvtk/join/tests/main.nf.test new file mode 100644 index 000000000..3cf178c4f --- /dev/null +++ b/modules/nf-core/csvtk/join/tests/main.nf.test @@ -0,0 +1,64 @@ +nextflow_process { + + name "Test Process CSVTK_JOIN" + script "../main.nf" + process "CSVTK_JOIN" + + tag "modules" + tag "modules_nfcore" + tag "csvtk" + tag "csvtk/join" + + test("join - csv") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [ + file("https://github.com/nf-core/test-datasets/raw/bacass/bacass_hybrid.csv", checkIfExists: true), + file("https://github.com/nf-core/test-datasets/raw/bacass/bacass_short.csv", checkIfExists: true), + ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("join - csv - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [ + file("https://github.com/nf-core/test-datasets/raw/bacass/bacass_hybrid.csv", checkIfExists: true), + file("https://github.com/nf-core/test-datasets/raw/bacass/bacass_short.csv", checkIfExists: true), + ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/csvtk/join/tests/main.nf.test.snap b/modules/nf-core/csvtk/join/tests/main.nf.test.snap new file mode 100644 index 000000000..8ba7b8612 --- /dev/null +++ b/modules/nf-core/csvtk/join/tests/main.nf.test.snap @@ -0,0 +1,68 @@ +{ + "join - csv": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.csv:md5,d0ad82ca096c7e05eb9f9a04194c9e30" + ] + ], + "1": [ + "versions.yml:md5,b80d80628bb39bba336cff32fe502aac" + ], + "csv": [ + [ + { + "id": "test" + }, + "test.csv:md5,d0ad82ca096c7e05eb9f9a04194c9e30" + ] + ], + "versions": [ + "versions.yml:md5,b80d80628bb39bba336cff32fe502aac" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-02T06:18:42.09571517" + }, + "join - csv - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.csv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,b80d80628bb39bba336cff32fe502aac" + ], + "csv": [ + [ + { + "id": "test" + }, + "test.csv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,b80d80628bb39bba336cff32fe502aac" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-02T06:19:00.2453934" + } +} \ No newline at end of file diff --git a/modules/nf-core/csvtk/join/tests/nextflow.config b/modules/nf-core/csvtk/join/tests/nextflow.config new file mode 100644 index 000000000..1b14393a9 --- /dev/null +++ b/modules/nf-core/csvtk/join/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: CSVTK_JOIN { + ext.args = "--fields 'ID;ID' -p -e -d \"\t\" -D \",\"" + } +} diff --git a/modules/nf-core/csvtk/join/tests/tags.yml b/modules/nf-core/csvtk/join/tests/tags.yml new file mode 100644 index 000000000..6c3a0fa6b --- /dev/null +++ b/modules/nf-core/csvtk/join/tests/tags.yml @@ -0,0 +1,2 @@ +csvtk/join: + - "modules/nf-core/csvtk/join/**" diff --git a/modules/nf-core/csvtk/split/environment.yml b/modules/nf-core/csvtk/split/environment.yml new file mode 100644 index 000000000..52d488da4 --- /dev/null +++ b/modules/nf-core/csvtk/split/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - bioconda + - conda-forge +dependencies: + - bioconda::csvtk=0.31.0 diff --git a/modules/nf-core/csvtk/split/main.nf b/modules/nf-core/csvtk/split/main.nf new file mode 100644 index 000000000..26a9a1b64 --- /dev/null +++ b/modules/nf-core/csvtk/split/main.nf @@ -0,0 +1,56 @@ +process CSVTK_SPLIT { + tag "$meta.id" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/csvtk:0.31.0--h9ee0642_0' : + 'biocontainers/csvtk:0.31.0--h9ee0642_0' }" + + input: + tuple val(meta), path(csv) + val in_format + val out_format + + output: + tuple val(meta), path("*.${out_extension}"), emit: split_csv + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def delimiter = in_format == "tsv" ? "--tabs" : (in_format == "csv" ? "--delimiter ',' " : in_format) + def out_delimiter = out_format == "tsv" ? "--out-tabs" : (out_format == "csv" ? "--out-delimiter ',' " : out_format) + out_extension = out_format == "tsv" ? 'tsv' : 'csv' + """ + sed -i.bak '/^##/d' $csv + csvtk \\ + split \\ + $args \\ + --num-cpus $task.cpus \\ + $delimiter \\ + $out_delimiter \\ + $csv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + csvtk: \$(echo \$( csvtk version | sed -e 's/csvtk v//g' )) + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + out_extension = args.contains('--out-delimiter "\t"') || args.contains('-D "\t"') || args.contains("-D \$'\t'") ? "tsv" : "csv" + """ + touch ${prefix}.${out_extension} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + csvtk: \$(echo \$( csvtk version | sed -e "s/csvtk v//g" )) + END_VERSIONS + """ +} diff --git a/modules/nf-core/csvtk/split/meta.yml b/modules/nf-core/csvtk/split/meta.yml new file mode 100644 index 000000000..fc2205068 --- /dev/null +++ b/modules/nf-core/csvtk/split/meta.yml @@ -0,0 +1,53 @@ +name: csvtk_split +description: Splits CSV/TSV into multiple files according to column values +keywords: + - split + - csv + - tsv +tools: + - csvtk: + description: CSVTK is a cross-platform, efficient and practical CSV/TSV toolkit + that allows rapid data investigation and manipulation. + homepage: https://bioinf.shenwei.me/csvtk/ + documentation: https://bioinf.shenwei.me/csvtk/ + tool_dev_url: https://github.com/shenwei356/csvtk + licence: ["MIT"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - csv: + type: file + description: CSV/TSV file + pattern: "*.{csv,tsv}" + - - in_format: + type: string + description: Input format (csv, tab, or a delimiting character) + pattern: "*" + - - out_format: + type: string + description: Output format (csv, tab, or a delimiting character) + pattern: "*" +output: + - split_csv: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.${out_extension}": + type: file + description: Split CSV/TSV file + pattern: "*.{csv,tsv}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@SusiJo" +maintainers: + - "@SusiJo" diff --git a/modules/nf-core/csvtk/split/tests/main.nf.test b/modules/nf-core/csvtk/split/tests/main.nf.test new file mode 100644 index 000000000..f3c499266 --- /dev/null +++ b/modules/nf-core/csvtk/split/tests/main.nf.test @@ -0,0 +1,62 @@ +nextflow_process { + + name "Test Process CSVTK_SPLIT" + script "../main.nf" + process "CSVTK_SPLIT" + + tag "modules" + tag "modules_nfcore" + tag "csvtk" + tag "csvtk/split" + + test("split - csv") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [ file(params.modules_testdata_base_path + '/generic/tsv/test.tsv', checkIfExists: true) ] + ] + input[1] = "tsv" + input[2] = "tsv" + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("split - csv - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [ file(params.modules_testdata_base_path + '/generic/tsv/test.tsv', checkIfExists: true) ] + ] + input[1] = "tsv" + input[2] = "tsv" + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/csvtk/split/tests/main.nf.test.snap b/modules/nf-core/csvtk/split/tests/main.nf.test.snap new file mode 100644 index 000000000..bb18d6b0d --- /dev/null +++ b/modules/nf-core/csvtk/split/tests/main.nf.test.snap @@ -0,0 +1,80 @@ +{ + "split - csv - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.csv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,9695b1a727446fc930c3439f7fb8d462" + ], + "split_csv": [ + [ + { + "id": "test" + }, + "test.csv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,9695b1a727446fc930c3439f7fb8d462" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-02T06:17:06.047247227" + }, + "split - csv": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + [ + "test-1.tsv:md5,2827284f1a6f41dd14ef82fb6a36ebad", + "test-11.tsv:md5,6c5555d689c4e685d35d6e394ad6e1e6", + "test-2.tsv:md5,589a2add7f0b8e998d4959e5d883e7d5", + "test-4.tsv:md5,e51cd0bfc35f5353d1fb75f723772ed0", + "test-NA.tsv:md5,20afd42832c6cf5821f9862d285c9350" + ] + ] + ], + "1": [ + "versions.yml:md5,9695b1a727446fc930c3439f7fb8d462" + ], + "split_csv": [ + [ + { + "id": "test" + }, + [ + "test-1.tsv:md5,2827284f1a6f41dd14ef82fb6a36ebad", + "test-11.tsv:md5,6c5555d689c4e685d35d6e394ad6e1e6", + "test-2.tsv:md5,589a2add7f0b8e998d4959e5d883e7d5", + "test-4.tsv:md5,e51cd0bfc35f5353d1fb75f723772ed0", + "test-NA.tsv:md5,20afd42832c6cf5821f9862d285c9350" + ] + ] + ], + "versions": [ + "versions.yml:md5,9695b1a727446fc930c3439f7fb8d462" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-02T06:16:54.62614058" + } +} \ No newline at end of file diff --git a/modules/nf-core/csvtk/split/tests/nextflow.config b/modules/nf-core/csvtk/split/tests/nextflow.config new file mode 100644 index 000000000..8f5a6f7ee --- /dev/null +++ b/modules/nf-core/csvtk/split/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: CSVTK_SPLIT { + ext.args = "-C \'&\' --fields \'first_name\' " + } +} diff --git a/modules/nf-core/csvtk/split/tests/tags.yml b/modules/nf-core/csvtk/split/tests/tags.yml new file mode 100644 index 000000000..0d7dc029d --- /dev/null +++ b/modules/nf-core/csvtk/split/tests/tags.yml @@ -0,0 +1,2 @@ +csvtk/split: + - "modules/nf-core/csvtk/split/**" diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml new file mode 100644 index 000000000..70ee54e32 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::multiqc=1.20 diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf new file mode 100644 index 000000000..105f9265a --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf @@ -0,0 +1,24 @@ +process CUSTOM_DUMPSOFTWAREVERSIONS { + label 'process_single' + + // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/multiqc:1.20--pyhdfd78af_0' : + 'biocontainers/multiqc:1.20--pyhdfd78af_0' }" + + input: + path versions + + output: + path "software_versions.yml" , emit: yml + path "software_versions_mqc.yml", emit: mqc_yml + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + template 'dumpsoftwareversions.py' +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml new file mode 100644 index 000000000..dc1e412fb --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml @@ -0,0 +1,43 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json +name: custom_dumpsoftwareversions +description: Custom module used to dump software versions within the nf-core pipeline + template +keywords: + - custom + - dump + - version +tools: + - custom: + description: Custom module used to dump software versions within the nf-core pipeline + template + homepage: https://github.com/nf-core/tools + documentation: https://github.com/nf-core/tools + licence: ["MIT"] + identifier: "" +input: + - - versions: + type: file + description: YML file containing software versions + pattern: "*.yml" +output: + - yml: + - software_versions.yml: + type: file + description: Standard YML file containing software versions + pattern: "software_versions.yml" + - mqc_yml: + - software_versions_mqc.yml: + type: file + description: MultiQC custom content YML file containing software versions + pattern: "software_versions_mqc.yml" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@grst" +maintainers: + - "@drpatelh" + - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py new file mode 100755 index 000000000..b83b32c4d --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py @@ -0,0 +1,101 @@ +#!/usr/bin/env python + + +"""Provide functions to merge multiple versions.yml files.""" + +import platform +from textwrap import dedent + +import yaml + + +def _make_versions_html(versions): + """Generate a tabular HTML output of all versions for MultiQC.""" + html = [ + dedent( + """\\ + + + + + + + + + + """ + ) + ] + for process, tmp_versions in sorted(versions.items()): + html.append("") + for i, (tool, version) in enumerate(sorted(tmp_versions.items())): + html.append( + dedent( + f"""\\ + + + + + + """ + ) + ) + html.append("") + html.append("
Process Name Software Version
{process if (i == 0) else ''}{tool}{version}
") + return "\\n".join(html) + + +def main(): + """Load all version files and generate merged output.""" + versions_this_module = {} + versions_this_module["${task.process}"] = { + "python": platform.python_version(), + "yaml": yaml.__version__, + } + + with open("$versions") as f: + versions_by_process = yaml.load(f, Loader=yaml.BaseLoader) | versions_this_module + + # aggregate versions by the module name (derived from fully-qualified process name) + versions_by_module = {} + for process, process_versions in versions_by_process.items(): + module = process.split(":")[-1] + try: + if versions_by_module[module] != process_versions: + raise AssertionError( + "We assume that software versions are the same between all modules. " + "If you see this error-message it means you discovered an edge-case " + "and should open an issue in nf-core/tools. " + ) + except KeyError: + versions_by_module[module] = process_versions + + versions_by_module["Workflow"] = { + "Nextflow": "$workflow.nextflow.version", + "$workflow.manifest.name": "$workflow.manifest.version", + } + + versions_mqc = { + "id": "software_versions", + "section_name": "${workflow.manifest.name} Software Versions", + "section_href": "https://github.com/${workflow.manifest.name}", + "plot_type": "html", + "description": "are collected at run time from the software output.", + "data": _make_versions_html(versions_by_module), + } + + with open("software_versions.yml", "w") as f: + yaml.dump(versions_by_module, f, default_flow_style=False) + with open("software_versions_mqc.yml", "w") as f: + yaml.dump(versions_mqc, f, default_flow_style=False) + + with open("versions.yml", "w") as f: + yaml.dump(versions_this_module, f, default_flow_style=False) + + +if __name__ == "__main__": + main() diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test new file mode 100644 index 000000000..b1e1630bb --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test @@ -0,0 +1,43 @@ +nextflow_process { + + name "Test Process CUSTOM_DUMPSOFTWAREVERSIONS" + script "../main.nf" + process "CUSTOM_DUMPSOFTWAREVERSIONS" + tag "modules" + tag "modules_nfcore" + tag "custom" + tag "dumpsoftwareversions" + tag "custom/dumpsoftwareversions" + + test("Should run without failures") { + when { + process { + """ + def tool1_version = ''' + TOOL1: + tool1: 0.11.9 + '''.stripIndent() + + def tool2_version = ''' + TOOL2: + tool2: 1.9 + '''.stripIndent() + + input[0] = Channel.of(tool1_version, tool2_version).collectFile() + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.versions, + file(process.out.mqc_yml[0]).readLines()[0..10], + file(process.out.yml[0]).readLines()[0..7] + ).match() + } + ) + } + } +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap new file mode 100644 index 000000000..5f59a936d --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap @@ -0,0 +1,33 @@ +{ + "Should run without failures": { + "content": [ + [ + "versions.yml:md5,76d454d92244589d32455833f7c1ba6d" + ], + [ + "data: \"\\n\\n \\n \\n \\n \\n \\n \\n \\n\\", + " \\n\\n\\n \\n \\n\\", + " \\ \\n\\n\\n\\n \\n \\", + " \\ \\n \\n\\n\\n\\n\\", + " \\n\\n \\n \\n\\", + " \\ \\n\\n\\n\\n\\n\\n \\n\\", + " \\ \\n \\n\\n\\n\\n\\", + " \\n\\n \\n \\n\\" + ], + [ + "CUSTOM_DUMPSOFTWAREVERSIONS:", + " python: 3.11.7", + " yaml: 5.4.1", + "TOOL1:", + " tool1: 0.11.9", + "TOOL2:", + " tool2: '1.9'", + "Workflow:" + ] + ], + "timestamp": "2024-01-09T23:01:18.710682" + } +} \ No newline at end of file diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml new file mode 100644 index 000000000..405aa24ae --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml @@ -0,0 +1,2 @@ +custom/dumpsoftwareversions: + - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/modules/nf-core/custom/gtffilter/environment.yml b/modules/nf-core/custom/gtffilter/environment.yml new file mode 100644 index 000000000..1d80d11a9 --- /dev/null +++ b/modules/nf-core/custom/gtffilter/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::python=3.9.5 diff --git a/modules/nf-core/custom/gtffilter/main.nf b/modules/nf-core/custom/gtffilter/main.nf new file mode 100644 index 000000000..b682ff8c5 --- /dev/null +++ b/modules/nf-core/custom/gtffilter/main.nf @@ -0,0 +1,37 @@ +process CUSTOM_GTFFILTER { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/python:3.9--1' : + 'biocontainers/python:3.9--1' }" + + input: + tuple val(meta), path(gtf) + tuple val(meta2), path(fasta) + + output: + tuple val(meta), path("${prefix}.${suffix}"), emit: gtf + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "gtf" + (gtf.extension == 'gz' ? '.gz' : '') + template 'gtffilter.py' + + stub: + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "gtf" + (gtf.extension == 'gz' ? '.gz' : '') + """ + touch ${prefix}.${suffix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + python: \$(python --version 2>&1 | cut -d ' ' -f 2) + END_VERSIONS + """ +} diff --git a/modules/nf-core/custom/gtffilter/meta.yml b/modules/nf-core/custom/gtffilter/meta.yml new file mode 100644 index 000000000..672256494 --- /dev/null +++ b/modules/nf-core/custom/gtffilter/meta.yml @@ -0,0 +1,54 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json +name: "custom_gtffilter" +description: Filter a gtf file to keep only regions that are located on a chromosome + represented in a given fasta file +keywords: + - gtf + - fasta + - filter +tools: + - "gtffilter": + description: "Filter a gtf file to keep only regions that are located on a chromosome + represented in a given fasta file" + tool_dev_url: "https://github.com/nf-core/modules/blob/master/modules/nf-core/custom/gtffilter/main.nf" + + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. `[ id:'sample1' ]` + - gtf: + type: file + description: GTF file + pattern: "*.{gtf}" + - - meta2: + type: map + description: | + Groovy Map containing sample information + e.g. `[ id:'sample1' ]` + - fasta: + type: file + description: Genome fasta file + pattern: "*.{fasta,fa}" +output: + - gtf: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. `[ id:'sample1' ]` + - ${prefix}.${suffix}: + type: file + description: Filtered GTF file + pattern: "*.{gtf}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@nictru" +maintainers: + - "@nictru" diff --git a/modules/nf-core/custom/gtffilter/templates/gtffilter.py b/modules/nf-core/custom/gtffilter/templates/gtffilter.py new file mode 100644 index 000000000..0ac964e57 --- /dev/null +++ b/modules/nf-core/custom/gtffilter/templates/gtffilter.py @@ -0,0 +1,124 @@ +#!/usr/bin/env python + +# Written by Olga Botvinnik with subsequent reworking by Jonathan Manning and Nico Trummer. + +# MIT License + +# Permission is hereby granted, free of charge, to any person obtaining a copy +# of this software and associated documentation files (the "Software"), to deal +# in the Software without restriction, including without limitation the rights +# to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +# copies of the Software, and to permit persons to whom the Software is +# furnished to do so, subject to the following conditions: + +# The above copyright notice and this permission notice shall be included in all +# copies or substantial portions of the Software. + +# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +# SOFTWARE. + +import gzip +import logging +import platform +import re +import statistics +from typing import Set + +# Create a logger +logging.basicConfig(format="%(name)s - %(asctime)s %(levelname)s: %(message)s") +logger = logging.getLogger("fasta_gtf_filter") +logger.setLevel(logging.INFO) + + +def format_yaml_like(data: dict, indent: int = 0) -> str: + """Formats a dictionary to a YAML-like string. + + Args: + data (dict): The dictionary to format. + indent (int): The current indentation level. + + Returns: + str: A string formatted as YAML. + """ + yaml_str = "" + for key, value in data.items(): + spaces = " " * indent + if isinstance(value, dict): + yaml_str += f"{spaces}{key}:\\n{format_yaml_like(value, indent + 1)}" + else: + yaml_str += f"{spaces}{key}: {value}\\n" + return yaml_str + + +def extract_fasta_seq_names(fasta_name: str) -> Set[str]: + """Extracts the sequence names from a FASTA file.""" + + is_gz = fasta_name.endswith(".gz") + open_fn = gzip.open if is_gz else open + + with open_fn(fasta_name) as fasta: + sequences = set() + for line in fasta: + line = line.decode("utf-8") if is_gz else line + if line.startswith(">"): + sequences.add(line[1:].split(None, 1)[0]) + + return sequences + + +def tab_delimited(file: str) -> float: + """Check if file is tab-delimited and return median number of tabs.""" + with open(file) as f: + data = f.read(102400) + return statistics.median(line.count("\\t") for line in data.split("\\n")) + + +def filter_gtf(fasta: str, gtf_in: str, filtered_gtf_out: str, skip_transcript_id_check: bool) -> None: + """Filter GTF file based on FASTA sequence names.""" + if tab_delimited(gtf_in) != 8: + raise ValueError("Invalid GTF file: Expected 9 tab-separated columns.") + + seq_names_in_genome = extract_fasta_seq_names(fasta) + logger.info(f"Extracted chromosome sequence names from {fasta}") + logger.debug("All sequence IDs from FASTA: " + ", ".join(sorted(seq_names_in_genome))) + + seq_names_in_gtf = set() + try: + is_gz = gtf_in.endswith(".gz") + open_fn = gzip.open if is_gz else open + with open_fn(gtf_in) as gtf, open_fn(filtered_gtf_out, "wb" if is_gz else "w") as out: + line_count = 0 + for line in gtf: + line = line.decode("utf-8") if is_gz else line + seq_name = line.split("\\t")[0] + seq_names_in_gtf.add(seq_name) # Add sequence name to the set + + if seq_name in seq_names_in_genome: + if skip_transcript_id_check or re.search(r'transcript_id "([^"]+)"', line): + out.write(line.encode() if is_gz else line) + line_count += 1 + + if line_count == 0: + raise ValueError("All GTF lines removed by filters") + + except OSError as e: + logger.error(f"File operation failed: {e}") + return + + logger.debug("All sequence IDs from GTF: " + ", ".join(sorted(seq_names_in_gtf))) + logger.info(f"Extracted {line_count} matching sequences from {gtf_in} into {filtered_gtf_out}") + + +filter_gtf("${fasta}", "${gtf}", "${prefix}.${suffix}", False) + +# Versions + +versions = {"${task.process}": {"python": platform.python_version()}} + +with open("versions.yml", "w") as f: + f.write(format_yaml_like(versions)) diff --git a/modules/nf-core/custom/gtffilter/tests/main.nf.test b/modules/nf-core/custom/gtffilter/tests/main.nf.test new file mode 100644 index 000000000..252d11a16 --- /dev/null +++ b/modules/nf-core/custom/gtffilter/tests/main.nf.test @@ -0,0 +1,115 @@ +nextflow_process { + + name "Test Process CUSTOM_GTFFILTER" + script "../main.nf" + process "CUSTOM_GTFFILTER" + + tag "modules" + tag "modules_nfcore" + tag "custom" + tag "custom/gtffilter" + + test("test_custom_gtffilter") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ] + input[1] = [ + [ id: 'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_custom_gtffilter_gzip") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ] + input[1] = [ + [ id: 'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_custom_gtffilter - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ] + input[1] = [ + [ id: 'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_custom_gtffilter_gzip - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ] + input[1] = [ + [ id: 'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/custom/gtffilter/tests/main.nf.test.snap b/modules/nf-core/custom/gtffilter/tests/main.nf.test.snap new file mode 100644 index 000000000..787dd42e1 --- /dev/null +++ b/modules/nf-core/custom/gtffilter/tests/main.nf.test.snap @@ -0,0 +1,134 @@ +{ + "test_custom_gtffilter_gzip": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.gtf:md5,aa8b2aa1e0b5fbbba3b04d471e1b0535" + ] + ], + "1": [ + "versions.yml:md5,39c43040514c93566d2e3dca39e54cf2" + ], + "gtf": [ + [ + { + "id": "test" + }, + "test.gtf:md5,aa8b2aa1e0b5fbbba3b04d471e1b0535" + ] + ], + "versions": [ + "versions.yml:md5,39c43040514c93566d2e3dca39e54cf2" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-15T14:23:11.091273747" + }, + "test_custom_gtffilter": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.gtf:md5,aa8b2aa1e0b5fbbba3b04d471e1b0535" + ] + ], + "1": [ + "versions.yml:md5,39c43040514c93566d2e3dca39e54cf2" + ], + "gtf": [ + [ + { + "id": "test" + }, + "test.gtf:md5,aa8b2aa1e0b5fbbba3b04d471e1b0535" + ] + ], + "versions": [ + "versions.yml:md5,39c43040514c93566d2e3dca39e54cf2" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-15T14:23:03.654104046" + }, + "test_custom_gtffilter_gzip - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,4547ffaa530b6d65b2dd1f607d7f85e3" + ], + "gtf": [ + [ + { + "id": "test" + }, + "test.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,4547ffaa530b6d65b2dd1f607d7f85e3" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-15T14:23:24.216284615" + }, + "test_custom_gtffilter - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,4547ffaa530b6d65b2dd1f607d7f85e3" + ], + "gtf": [ + [ + { + "id": "test" + }, + "test.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,4547ffaa530b6d65b2dd1f607d7f85e3" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-15T14:23:17.765499066" + } +} \ No newline at end of file diff --git a/modules/nf-core/custom/gtffilter/tests/tags.yml b/modules/nf-core/custom/gtffilter/tests/tags.yml new file mode 100644 index 000000000..34dda2178 --- /dev/null +++ b/modules/nf-core/custom/gtffilter/tests/tags.yml @@ -0,0 +1,2 @@ +custom/gtffilter: + - "modules/nf-core/custom/gtffilter/**" diff --git a/modules/nf-core/custom/tx2gene/environment.yml b/modules/nf-core/custom/tx2gene/environment.yml new file mode 100644 index 000000000..9824d0c27 --- /dev/null +++ b/modules/nf-core/custom/tx2gene/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - python=3.10.4 diff --git a/modules/nf-core/custom/tx2gene/main.nf b/modules/nf-core/custom/tx2gene/main.nf new file mode 100644 index 000000000..eed5e97b1 --- /dev/null +++ b/modules/nf-core/custom/tx2gene/main.nf @@ -0,0 +1,36 @@ +process CUSTOM_TX2GENE { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/python:3.10.4' : + 'biocontainers/python:3.10.4' }" + + input: + tuple val(meta), path(gtf) + tuple val(meta2), path ("quants/*") + val quant_type + val id + val extra + + output: + tuple val(meta), path("*tx2gene.tsv"), emit: tx2gene + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + template 'tx2gene.py' + + stub: + """ + touch ${meta.id}.tx2gene.tsv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + python: \$(python --version | sed 's/Python //g') + END_VERSIONS + """ +} diff --git a/modules/nf-core/custom/tx2gene/meta.yml b/modules/nf-core/custom/tx2gene/meta.yml new file mode 100644 index 000000000..8254afa08 --- /dev/null +++ b/modules/nf-core/custom/tx2gene/meta.yml @@ -0,0 +1,65 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json +name: "custom_tx2gene" +description: Make a transcript/gene mapping from a GTF and cross-reference with transcript + quantifications. +keywords: + - gene + - gtf + - pseudoalignment + - transcript +tools: + - "custom": + description: | + "Custom module to create a transcript to gene mapping from a GTF and + check it against transcript quantifications" + tool_dev_url: "https://github.com/nf-core/modules/blob/master/modules/nf-core/custom/tx2gene/main.nf" + licence: ["MIT"] + identifier: "" + +input: + - - meta: + type: map + description: | + Groovy Map containing reference information related to the GTF file + e.g. `[ id:'yeast' ]` + - gtf: + type: file + description: An annotation file of the reference genome in GTF format + pattern: "*.gtf" + - - meta2: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - '"quants/*"': + type: file + description: quants file + - - quant_type: + type: string + description: Quantification type, 'kallisto' or 'salmon' + - - id: + type: string + description: Gene ID attribute in the GTF file (default= gene_id) + - - extra: + type: string + description: Extra gene attribute in the GTF file (default= gene_name) +output: + - tx2gene: + - meta: + type: map + description: | + Groovy Map containing reference information related to the GTF file + e.g. `[ id:'yeast' ]` + - "*tx2gene.tsv": + type: file + description: A transcript/ gene mapping table in TSV format + pattern: "*.tx2gene.tsv" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@pinin4fjords" +maintainers: + - "@pinin4fjords" diff --git a/modules/nf-core/custom/tx2gene/templates/tx2gene.py b/modules/nf-core/custom/tx2gene/templates/tx2gene.py new file mode 100755 index 000000000..4d769513d --- /dev/null +++ b/modules/nf-core/custom/tx2gene/templates/tx2gene.py @@ -0,0 +1,196 @@ +#!/usr/bin/env python3 + +# Written by Lorena Pantano with subsequent reworking by Jonathan Manning. Released under the MIT license. + +import glob +import logging +import os +import platform +import re +from collections import Counter, OrderedDict +from collections.abc import Set +from typing import Dict + +# Configure logging +logging.basicConfig(format="%(name)s - %(asctime)s %(levelname)s: %(message)s") +logger = logging.getLogger(__name__) +logger.setLevel(logging.INFO) + + +def format_yaml_like(data: dict, indent: int = 0) -> str: + """Formats a dictionary to a YAML-like string. + + Args: + data (dict): The dictionary to format. + indent (int): The current indentation level. + + Returns: + str: A string formatted as YAML. + """ + yaml_str = "" + for key, value in data.items(): + spaces = " " * indent + if isinstance(value, dict): + yaml_str += f"{spaces}{key}:\\n{format_yaml_like(value, indent + 1)}" + else: + yaml_str += f"{spaces}{key}: {value}\\n" + return yaml_str + + +def read_top_transcripts(quant_dir: str, file_pattern: str) -> Set[str]: + """ + Read the top 100 transcripts from the quantification file. + + Parameters: + quant_dir (str): Directory where quantification files are located. + file_pattern (str): Pattern to match quantification files. + + Returns: + set: A set containing the top 100 transcripts. + """ + try: + # Find the quantification file within the directory + quant_file_path = glob.glob(os.path.join(quant_dir, "*", file_pattern))[0] + with open(quant_file_path) as file_handle: + # Read the file and extract the top 100 transcripts + return {line.split()[0] for i, line in enumerate(file_handle) if i > 0 and i <= 100} + except IndexError: + # Log an error and raise a FileNotFoundError if the quant file does not exist + logger.error("No quantification files found.") + raise FileNotFoundError("Quantification file not found.") + + +def discover_transcript_attribute(gtf_file: str, transcripts: Set[str]) -> str: + """ + Discover the attribute in the GTF that corresponds to transcripts, prioritizing 'transcript_id'. + + Parameters: + gtf_file (str): Path to the GTF file. + transcripts (Set[str]): A set of transcripts to match in the GTF file. + + Returns: + str: The attribute name that corresponds to transcripts in the GTF file. + """ + + votes = Counter() + with open(gtf_file) as inh: + # Read GTF file, skipping header lines + for line in filter(lambda x: not x.startswith("#"), inh): + cols = line.split("\\t") + + # Use regular expression to correctly split the attributes string + attributes_str = cols[8] + attributes = dict(re.findall(r'(\\S+) "(.*?)(? Dict[str, str]: + """ + Parse the attributes column of a GTF file. + + :param attributes_text: The attributes column as a string. + :return: A dictionary of the attributes. + """ + # Split the attributes string by semicolon and strip whitespace + attributes = attributes_text.strip().split(";") + attr_dict = OrderedDict() + + # Iterate over each attribute pair + for attribute in attributes: + # Split the attribute into key and value, ensuring there are two parts + parts = attribute.strip().split(" ", 1) + if len(parts) == 2: + key, value = parts + # Remove any double quotes from the value + value = value.replace('"', "") + attr_dict[key] = value + + return attr_dict + + +def map_transcripts_to_gene( + quant_type: str, + gtf_file: str, + quant_dir: str, + gene_id: str, + extra_id_field: str, + output_file: str, +) -> bool: + """ + Map transcripts to gene names and write the output to a file. + + Parameters: + quant_type (str): The quantification method used (e.g., 'salmon'). + gtf_file (str): Path to the GTF file. + quant_dir (str): Directory where quantification files are located. + gene_id (str): The gene ID attribute in the GTF file. + extra_id_field (str): Additional ID field in the GTF file. + output_file (str): The output file path. + + Returns: + bool: True if the operation was successful, False otherwise. + """ + # Read the top transcripts based on quantification type + transcripts = read_top_transcripts(quant_dir, "quant.sf" if quant_type == "salmon" else "abundance.tsv") + # Discover the attribute that corresponds to transcripts in the GTF + transcript_attribute = discover_transcript_attribute(gtf_file, transcripts) + + # Open GTF and output file to write the mappings + # Initialize the set to track seen combinations + seen = set() + + with open(gtf_file) as inh, open(output_file, "w") as output_handle: + output_handle.write(f"{transcript_attribute}\\t{gene_id}\\t{extra_id_field}\\n") + # Parse each line of the GTF, mapping transcripts to genes + for line in filter(lambda x: not x.startswith("#"), inh): + cols = line.split("\\t") + attr_dict = parse_attributes(cols[8]) + if gene_id in attr_dict and transcript_attribute in attr_dict: + # Create a unique identifier for the transcript-gene combination + transcript_gene_pair = ( + attr_dict[transcript_attribute], + attr_dict[gene_id], + ) + + # Check if the combination has already been seen + if transcript_gene_pair not in seen: + # If it's a new combination, write it to the output and add to the seen set + extra_id = attr_dict.get(extra_id_field, attr_dict[gene_id]) + output_handle.write(f"{attr_dict[transcript_attribute]}\\t{attr_dict[gene_id]}\\t{extra_id}\\n") + seen.add(transcript_gene_pair) + + return True + + +# Main function to parse arguments and call the mapping function +if __name__ == "__main__": + if "${task.ext.prefix}" != "null": + prefix = "${task.ext.prefix}." + elif "$meta.id" != "null": + prefix = "${meta.id}." + else: + prefix = "" + + if not map_transcripts_to_gene("$quant_type", "$gtf", "quants", "$id", "$extra", f"{prefix}tx2gene.tsv"): + logger.error("Failed to map transcripts to genes.") + + # Write the versions + versions_this_module = {} + versions_this_module["${task.process}"] = {"python": platform.python_version()} + with open("versions.yml", "w") as f: + f.write(format_yaml_like(versions_this_module)) diff --git a/modules/nf-core/custom/tx2gene/tests/main.nf.test b/modules/nf-core/custom/tx2gene/tests/main.nf.test new file mode 100644 index 000000000..4cbb8d4ef --- /dev/null +++ b/modules/nf-core/custom/tx2gene/tests/main.nf.test @@ -0,0 +1,92 @@ +nextflow_process { + + name "Test Process CUSTOM_TX2GENE" + script "../main.nf" + process "CUSTOM_TX2GENE" + + tag "modules" + tag "modules_nfcore" + tag "custom" + tag "custom/tx2gene" + tag "untar" + + test("saccharomyces_cerevisiae - gtf") { + + setup { + run("UNTAR") { + script "../../../untar/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true) + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/genome_gfp.gtf', checkIfExists: true) + ]) + input[1] = UNTAR.out.untar.map { meta, dir -> [ meta, dir.listFiles().collect() ] } + input[2] = 'kallisto' + input[3] = 'gene_id' + input[4] = 'gene_name' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("saccharomyces_cerevisiae - gtf - stub") { + + options "-stub" + + setup { + run("UNTAR") { + script "../../../untar/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true) + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/genome_gfp.gtf', checkIfExists: true) + ]) + input[1] = UNTAR.out.untar.map { meta, dir -> [ meta, dir.listFiles().collect() ] } + input[2] = 'kallisto' + input[3] = 'gene_id' + input[4] = 'gene_name' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap b/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap new file mode 100644 index 000000000..2be5fe547 --- /dev/null +++ b/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap @@ -0,0 +1,68 @@ +{ + "saccharomyces_cerevisiae - gtf": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.tx2gene.tsv:md5,0e2418a69d2eba45097ebffc2f700bfe" + ] + ], + "1": [ + "versions.yml:md5,e504b95d76ef4cf65ba0b38cddce2840" + ], + "tx2gene": [ + [ + { + "id": "test" + }, + "test.tx2gene.tsv:md5,0e2418a69d2eba45097ebffc2f700bfe" + ] + ], + "versions": [ + "versions.yml:md5,e504b95d76ef4cf65ba0b38cddce2840" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T10:24:12.19104487" + }, + "saccharomyces_cerevisiae - gtf - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.tx2gene.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,48194bffef8cb833e82e31166f3d486c" + ], + "tx2gene": [ + [ + { + "id": "test" + }, + "test.tx2gene.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,48194bffef8cb833e82e31166f3d486c" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T10:24:24.729694098" + } +} \ No newline at end of file diff --git a/modules/nf-core/custom/tx2gene/tests/tags.yml b/modules/nf-core/custom/tx2gene/tests/tags.yml new file mode 100644 index 000000000..493fbc3b1 --- /dev/null +++ b/modules/nf-core/custom/tx2gene/tests/tags.yml @@ -0,0 +1,2 @@ +custom/tx2gene: + - "modules/nf-core/custom/tx2gene/**" diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml new file mode 100644 index 000000000..f9f54ee9b --- /dev/null +++ b/modules/nf-core/fastqc/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf new file mode 100644 index 000000000..033f4154a --- /dev/null +++ b/modules/nf-core/fastqc/main.nf @@ -0,0 +1,64 @@ +process FASTQC { + tag "${meta.id}" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : + 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" + + input: + tuple val(meta), path(reads) + + output: + tuple val(meta), path("*.html"), emit: html + tuple val(meta), path("*.zip") , emit: zip + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + // Make list of old name and new name pairs to use for renaming in the bash while loop + def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[ reads, "${prefix}.${reads.extension}" ]] : reads.withIndex().collect { entry, index -> [ entry, "${prefix}_${index + 1}.${entry.extension}" ] } + def rename_to = old_new_pairs*.join(' ').join(' ') + def renamed_files = old_new_pairs.collect{ _old_name, new_name -> new_name }.join(' ') + + // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) + // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 + // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label + def memory_in_mb = task.memory ? task.memory.toUnit('MB').toFloat() / task.cpus : null + // FastQC memory value allowed range (100 - 10000) + def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) + + """ + printf "%s %s\\n" ${rename_to} | while read old_name new_name; do + [ -f "\${new_name}" ] || ln -s \$old_name \$new_name + done + + fastqc \\ + ${args} \\ + --threads ${task.cpus} \\ + --memory ${fastqc_memory} \\ + ${renamed_files} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.html + touch ${prefix}.zip + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) + END_VERSIONS + """ +} diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml new file mode 100644 index 000000000..2b2e62b8a --- /dev/null +++ b/modules/nf-core/fastqc/meta.yml @@ -0,0 +1,67 @@ +name: fastqc +description: Run FastQC on sequenced reads +keywords: + - quality control + - qc + - adapters + - fastq +tools: + - fastqc: + description: | + FastQC gives general quality metrics about your reads. + It provides information about the quality score distribution + across your reads, the per base sequence content (%A/C/G/T). + + You get information about adapter contamination and other + overrepresented sequences. + homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ + documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/ + licence: ["GPL-2.0-only"] + identifier: biotools:fastqc +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. +output: + - html: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.html": + type: file + description: FastQC report + pattern: "*_{fastqc.html}" + - zip: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.zip": + type: file + description: FastQC report archive + pattern: "*_{fastqc.zip}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@grst" + - "@ewels" + - "@FelixKrueger" +maintainers: + - "@drpatelh" + - "@grst" + - "@ewels" + - "@FelixKrueger" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test new file mode 100644 index 000000000..e9d79a074 --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -0,0 +1,309 @@ +nextflow_process { + + name "Test Process FASTQC" + script "../main.nf" + process "FASTQC" + + tag "modules" + tag "modules_nfcore" + tag "fastqc" + + test("sarscov2 single-end [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id: 'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 paired-end [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("") }, + { assert path(process.out.html[0][1][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 interleaved [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 paired-end [bam]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 multiple [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("") }, + { assert path(process.out.html[0][1][1]).text.contains("") }, + { assert path(process.out.html[0][1][2]).text.contains("") }, + { assert path(process.out.html[0][1][3]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 custom_prefix") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 single-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id: 'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 interleaved [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 multiple [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 custom_prefix - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap new file mode 100644 index 000000000..d5db3092f --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -0,0 +1,392 @@ +{ + "sarscov2 custom_prefix": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:16.374038" + }, + "sarscov2 single-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:24.993809" + }, + "sarscov2 custom_prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:03:10.93942" + }, + "sarscov2 interleaved [fastq]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:42.355718" + }, + "sarscov2 paired-end [bam]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:53.276274" + }, + "sarscov2 multiple [fastq]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:05.527626" + }, + "sarscov2 paired-end [fastq]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:31.188871" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:34.273566" + }, + "sarscov2 multiple [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:03:02.304411" + }, + "sarscov2 single-end [fastq]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:19.095607" + }, + "sarscov2 interleaved [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:44.640184" + }, + "sarscov2 paired-end [bam] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:53.550742" + } +} \ No newline at end of file diff --git a/modules/nf-core/gawk/environment.yml b/modules/nf-core/gawk/environment.yml new file mode 100644 index 000000000..f52109e83 --- /dev/null +++ b/modules/nf-core/gawk/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::gawk=5.3.0 diff --git a/modules/nf-core/gawk/main.nf b/modules/nf-core/gawk/main.nf new file mode 100644 index 000000000..11e0be48f --- /dev/null +++ b/modules/nf-core/gawk/main.nf @@ -0,0 +1,70 @@ +process GAWK { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/gawk:5.3.0' : + 'biocontainers/gawk:5.3.0' }" + + input: + tuple val(meta), path(input, arity: '0..*') + path(program_file) + val(disable_redirect_output) + + output: + tuple val(meta), path("${prefix}.${suffix}"), emit: output + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' // args is used for the main arguments of the tool + def args2 = task.ext.args2 ?: '' // args2 is used to specify a program when no program file has been given + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "${input.collect{ it.getExtension()}.get(0)}" // use the first extension of the input files + + program = program_file ? "-f ${program_file}" : "${args2}" + lst_gz = input.findResults{ it.getExtension().endsWith("gz") ? it.toString() : null } + unzip = lst_gz ? "gunzip -q -f ${lst_gz.join(" ")}" : "" + input_cmd = input.collect { it.toString() - ~/\.gz$/ }.join(" ") + output_cmd = suffix.endsWith("gz") ? "| gzip > ${prefix}.${suffix}" : "> ${prefix}.${suffix}" + output = disable_redirect_output ? "" : output_cmd + cleanup = lst_gz ? "rm ${lst_gz.collect{ it - ~/\.gz$/ }.join(" ")}" : "" + + input.collect{ + assert it.name != "${prefix}.${suffix}" : "Input and output names are the same, set prefix in module configuration to disambiguate!" + } + + """ + ${unzip} + + awk \\ + ${args} \\ + ${program} \\ + ${input_cmd} \\ + ${output} + + ${cleanup} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gawk: \$(awk -Wversion | sed '1!d; s/.*Awk //; s/,.*//') + END_VERSIONS + """ + + stub: + prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "${input.getExtension()}" + def create_cmd = suffix.endsWith("gz") ? "echo '' | gzip >" : "touch" + + """ + ${create_cmd} ${prefix}.${suffix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gawk: \$(awk -Wversion | sed '1!d; s/.*Awk //; s/,.*//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/gawk/meta.yml b/modules/nf-core/gawk/meta.yml new file mode 100644 index 000000000..4a97ea72d --- /dev/null +++ b/modules/nf-core/gawk/meta.yml @@ -0,0 +1,62 @@ +name: "gawk" +description: | + If you are like many computer users, you would frequently like to make changes in various text files + wherever certain patterns appear, or extract data from parts of certain lines while discarding the rest. + The job is easy with awk, especially the GNU implementation gawk. +keywords: + - gawk + - awk + - txt + - text + - file parsing +tools: + - "gawk": + description: "GNU awk" + homepage: "https://www.gnu.org/software/gawk/" + documentation: "https://www.gnu.org/software/gawk/manual/" + tool_dev_url: "https://www.gnu.org/prep/ftp.html" + licence: ["GPL v3"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: The input file - Specify the logic that needs to be executed on + this file on the `ext.args2` or in the program file. + If the files have a `.gz` extension, they will be unzipped using `zcat`. + pattern: "*" + - - program_file: + type: file + description: Optional file containing logic for awk to execute. If you don't + wish to use a file, you can use `ext.args2` to specify the logic. + pattern: "*" + - - disable_redirect_output: + type: boolean + description: Disable the redirection of awk output to a given file. This is + useful if you want to use awk's built-in redirect to write files instead + of the shell's redirect. +output: + - output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.${suffix}: + type: file + description: The output file - specify the name of this file using `ext.prefix` + and the extension using `ext.suffix` + pattern: "*" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@nvnieuwk" +maintainers: + - "@nvnieuwk" diff --git a/modules/nf-core/gawk/tests/main.nf.test b/modules/nf-core/gawk/tests/main.nf.test new file mode 100644 index 000000000..54462271d --- /dev/null +++ b/modules/nf-core/gawk/tests/main.nf.test @@ -0,0 +1,198 @@ +nextflow_process { + + name "Test Process GAWK" + script "../main.nf" + process "GAWK" + + tag "modules" + tag "modules_nfcore" + tag "gawk" + + config "./nextflow.config" + + test("Convert fasta to bed") { + when { + params { + gawk_suffix = "bed" + gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }\'' + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[1] = [] + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Convert fasta to bed with program file") { + when { + params { + gawk_suffix = "bed" + gawk_args2 = "" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[1] = Channel.of('BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }').collectFile(name:"program.awk") + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Convert fasta to bed using awk redirect instead of shell redirect") { + when { + params { + gawk_suffix = "bed" + gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 > "test.bed" }\'' + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[1] = [] + input[2] = true + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Extract first column from multiple files") { + when { + params { + gawk_suffix = "bed" + gawk_args2 = "" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [file(params.modules_testdata_base_path + 'generic/txt/hello.txt', checkIfExists: true), + file(params.modules_testdata_base_path + 'generic/txt/species_names.txt', checkIfExists: true)] + ] + input[1] = Channel.of('BEGIN {FS=" "}; {print \$1}').collectFile(name:"program.awk") + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Unzip files before processing") { + when { + params { + gawk_suffix = "bed" + gawk_args2 = "" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/vcf/NA12878_chrM.vcf.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/vcf/NA24385_sv.vcf.gz', checkIfExists: true)] + ] + input[1] = Channel.of('/^#CHROM/ { print \$1, \$10 }').collectFile(name:"column_header.awk") + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Compress after processing") { + when { + params { + gawk_suffix = "txt.gz" + gawk_args2 = '\'BEGIN { FS = OFS = "\t"}; { print \$1, "0", \$2 }\'' + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + input[1] = [] + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Input and output files are similar") { + when { + params { + gawk_suffix = "txt" + gawk_args = "" + gawk_args2 = "" + } + process { + """ + input[0] = [ + [ id:'hello' ], // meta map + [file(params.modules_testdata_base_path + 'generic/txt/hello.txt', checkIfExists: true), + file(params.modules_testdata_base_path + 'generic/txt/species_names.txt', checkIfExists: true)] + ] + input[1] = Channel.of('BEGIN {FS=" "}; {print \$1}').collectFile(name:"program.awk") + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.failed }, + { assert process.errorReport.contains("Input and output names are the same, set prefix in module configuration to disambiguate!") } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/gawk/tests/main.nf.test.snap b/modules/nf-core/gawk/tests/main.nf.test.snap new file mode 100644 index 000000000..d8e8ac755 --- /dev/null +++ b/modules/nf-core/gawk/tests/main.nf.test.snap @@ -0,0 +1,200 @@ +{ + "Compress after processing": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.txt.gz:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "1": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ], + "output": [ + [ + { + "id": "test" + }, + "test.txt.gz:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "versions": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.1" + }, + "timestamp": "2024-11-27T17:11:20.054143406" + }, + "Convert fasta to bed": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "1": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ], + "output": [ + [ + { + "id": "test" + }, + "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "versions": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T13:14:02.347809811" + }, + "Convert fasta to bed with program file": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "1": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ], + "output": [ + [ + { + "id": "test" + }, + "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "versions": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T13:14:11.894616209" + }, + "Extract first column from multiple files": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed:md5,566c51674bd643227bb2d83e0963376d" + ] + ], + "1": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ], + "output": [ + [ + { + "id": "test" + }, + "test.bed:md5,566c51674bd643227bb2d83e0963376d" + ] + ], + "versions": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T22:04:47.729300129" + }, + "Unzip files before processing": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed:md5,1e31ebd4a060aab5433bbbd9ab24e403" + ] + ], + "1": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ], + "output": [ + [ + { + "id": "test" + }, + "test.bed:md5,1e31ebd4a060aab5433bbbd9ab24e403" + ] + ], + "versions": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T22:08:19.533527657" + }, + "Convert fasta to bed using awk redirect instead of shell redirect": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "1": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ], + "output": [ + [ + { + "id": "test" + }, + "test.bed:md5,87a15eb9c2ff20ccd5cd8735a28708f7" + ] + ], + "versions": [ + "versions.yml:md5,842acc9870dc8ac280954047cb2aa23a" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-03-05T08:31:09.88842854" + } +} \ No newline at end of file diff --git a/modules/nf-core/gawk/tests/nextflow.config b/modules/nf-core/gawk/tests/nextflow.config new file mode 100644 index 000000000..895709a76 --- /dev/null +++ b/modules/nf-core/gawk/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + withName: GAWK { + ext.suffix = params.gawk_suffix + ext.args2 = params.gawk_args2 + } +} diff --git a/modules/nf-core/gawk/tests/tags.yml b/modules/nf-core/gawk/tests/tags.yml new file mode 100644 index 000000000..72e4531d2 --- /dev/null +++ b/modules/nf-core/gawk/tests/tags.yml @@ -0,0 +1,2 @@ +gawk: + - "modules/nf-core/gawk/**" diff --git a/modules/nf-core/gffread/environment.yml b/modules/nf-core/gffread/environment.yml new file mode 100644 index 000000000..46c5faece --- /dev/null +++ b/modules/nf-core/gffread/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::gffread=0.12.7 diff --git a/modules/nf-core/gffread/main.nf b/modules/nf-core/gffread/main.nf new file mode 100644 index 000000000..da55cbab7 --- /dev/null +++ b/modules/nf-core/gffread/main.nf @@ -0,0 +1,60 @@ +process GFFREAD { + tag "$meta.id" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/gffread:0.12.7--hdcf5f25_4' : + 'biocontainers/gffread:0.12.7--hdcf5f25_4' }" + + input: + tuple val(meta), path(gff) + path fasta + + output: + tuple val(meta), path("*.gtf") , emit: gtf , optional: true + tuple val(meta), path("*.gff3") , emit: gffread_gff , optional: true + tuple val(meta), path("*.fasta"), emit: gffread_fasta , optional: true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def extension = args.contains("-T") ? 'gtf' : ( ( ['-w', '-x', '-y' ].any { args.contains(it) } ) ? 'fasta' : 'gff3' ) + def fasta_arg = fasta ? "-g $fasta" : '' + def output_name = "${prefix}.${extension}" + def output = extension == "fasta" ? "$output_name" : "-o $output_name" + def args_sorted = args.replaceAll(/(.*)(-[wxy])(.*)/) { all, pre, param, post -> "$pre $post $param" }.trim() + // args_sorted = Move '-w', '-x', and '-y' to the end of the args string as gffread expects the file name after these parameters + if ( "$output_name" in [ "$gff", "$fasta" ] ) error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + gffread \\ + $gff \\ + $fasta_arg \\ + $args_sorted \\ + $output + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gffread: \$(gffread --version 2>&1) + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def extension = args.contains("-T") ? 'gtf' : ( ( ['-w', '-x', '-y' ].any { args.contains(it) } ) ? 'fasta' : 'gff3' ) + def output_name = "${prefix}.${extension}" + if ( "$output_name" in [ "$gff", "$fasta" ] ) error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + touch $output_name + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gffread: \$(gffread --version 2>&1) + END_VERSIONS + """ +} diff --git a/modules/nf-core/gffread/meta.yml b/modules/nf-core/gffread/meta.yml new file mode 100644 index 000000000..bebe7f575 --- /dev/null +++ b/modules/nf-core/gffread/meta.yml @@ -0,0 +1,75 @@ +name: gffread +description: Validate, filter, convert and perform various other operations on GFF + files +keywords: + - gff + - conversion + - validation +tools: + - gffread: + description: GFF/GTF utility providing format conversions, region filtering, FASTA + sequence extraction and more. + homepage: http://ccb.jhu.edu/software/stringtie/gff.shtml#gffread + documentation: http://ccb.jhu.edu/software/stringtie/gff.shtml#gffread + tool_dev_url: https://github.com/gpertea/gffread + doi: 10.12688/f1000research.23297.1 + licence: ["MIT"] + identifier: biotools:gffread +input: + - - meta: + type: map + description: | + Groovy Map containing meta data + e.g. [ id:'test' ] + - gff: + type: file + description: A reference file in either the GFF3, GFF2 or GTF format. + pattern: "*.{gff, gtf}" + - - fasta: + type: file + description: A multi-fasta file with the genomic sequences + pattern: "*.{fasta,fa,faa,fas,fsa}" +output: + - gtf: + - meta: + type: map + description: | + Groovy Map containing meta data + e.g. [ id:'test' ] + - "*.gtf": + type: file + description: GTF file resulting from the conversion of the GFF input file if + '-T' argument is present + pattern: "*.{gtf}" + - gffread_gff: + - meta: + type: map + description: | + Groovy Map containing meta data + e.g. [ id:'test' ] + - "*.gff3": + type: file + description: GFF3 file resulting from the conversion of the GFF input file if + '-T' argument is absent + pattern: "*.gff3" + - gffread_fasta: + - meta: + type: map + description: | + Groovy Map containing meta data + e.g. [ id:'test' ] + - "*.fasta": + type: file + description: Fasta file produced when either of '-w', '-x', '-y' parameters + is present + pattern: "*.fasta" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@edmundmiller" +maintainers: + - "@edmundmiller" + - "@gallvp" diff --git a/modules/nf-core/gffread/tests/main.nf.test b/modules/nf-core/gffread/tests/main.nf.test new file mode 100644 index 000000000..d039f367c --- /dev/null +++ b/modules/nf-core/gffread/tests/main.nf.test @@ -0,0 +1,224 @@ +nextflow_process { + + name "Test Process GFFREAD" + script "../main.nf" + process "GFFREAD" + + tag "gffread" + tag "modules_nfcore" + tag "modules" + + test("sarscov2-gff3-gtf") { + + config "./nextflow.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gff3", checkIfExists: true) + ] + input[1] = [] + + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert process.out.gffread_gff == [] }, + { assert process.out.gffread_fasta == [] } + ) + } + + } + + test("sarscov2-gff3-gtf-stub") { + + options '-stub' + config "./nextflow.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gff3", checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert process.out.gffread_gff == [] }, + { assert process.out.gffread_fasta == [] } + ) + } + + } + + test("sarscov2-gff3-gff3") { + + config "./nextflow-gff3.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gff3", checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert process.out.gtf == [] }, + { assert process.out.gffread_fasta == [] } + ) + } + + } + + test("sarscov2-gff3-gff3-stub") { + + options '-stub' + config "./nextflow-gff3.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gff3", checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert process.out.gtf == [] }, + { assert process.out.gffread_fasta == [] } + ) + } + + } + + test("sarscov2-gff3-fasta") { + + config "./nextflow-fasta.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gff3", checkIfExists: true) + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert process.out.gtf == [] }, + { assert process.out.gffread_gff == [] } + ) + } + + } + + test("sarscov2-gff3-fasta-stub") { + + options '-stub' + config "./nextflow-fasta.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gff3", checkIfExists: true) + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert process.out.gtf == [] }, + { assert process.out.gffread_gff == [] } + ) + } + + } + + test("sarscov2-gff3-fasta-fail-catch") { + + options '-stub' + config "./nextflow-fasta.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [id: 'genome'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gff3", checkIfExists: true) + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true) + """ + } + } + + then { + assertAll ( + { assert ! process.success }, + { assert process.stdout.toString().contains("Input and output names are the same") } + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/gffread/tests/main.nf.test.snap b/modules/nf-core/gffread/tests/main.nf.test.snap new file mode 100644 index 000000000..15262320d --- /dev/null +++ b/modules/nf-core/gffread/tests/main.nf.test.snap @@ -0,0 +1,272 @@ +{ + "sarscov2-gff3-gtf": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.gtf:md5,1ea0ae98d3388e0576407dc4a24ef428" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ], + "gffread_fasta": [ + + ], + "gffread_gff": [ + + ], + "gtf": [ + [ + { + "id": "test" + }, + "test.gtf:md5,1ea0ae98d3388e0576407dc4a24ef428" + ] + ], + "versions": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-09T10:48:56.496187" + }, + "sarscov2-gff3-gff3": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "test.gff3:md5,c4e5da6267c6bee5899a2c204ae1ad91" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ], + "gffread_fasta": [ + + ], + "gffread_gff": [ + [ + { + "id": "test" + }, + "test.gff3:md5,c4e5da6267c6bee5899a2c204ae1ad91" + ] + ], + "gtf": [ + + ], + "versions": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-09T10:49:00.892782" + }, + "sarscov2-gff3-gtf-stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ], + "gffread_fasta": [ + + ], + "gffread_gff": [ + + ], + "gtf": [ + [ + { + "id": "test" + }, + "test.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-09T11:11:26.975666" + }, + "sarscov2-gff3-fasta-stub": { + "content": [ + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test" + }, + "test.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ], + "gffread_fasta": [ + [ + { + "id": "test" + }, + "test.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gffread_gff": [ + + ], + "gtf": [ + + ], + "versions": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-09T11:11:44.34792" + }, + "sarscov2-gff3-gff3-stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "test.gff3:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ], + "gffread_fasta": [ + + ], + "gffread_gff": [ + [ + { + "id": "test" + }, + "test.gff3:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gtf": [ + + ], + "versions": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-09T11:11:35.221671" + }, + "sarscov2-gff3-fasta": { + "content": [ + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test" + }, + "test.fasta:md5,5f8108fb51739a0588ccf0a251de919a" + ] + ], + "3": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ], + "gffread_fasta": [ + [ + { + "id": "test" + }, + "test.fasta:md5,5f8108fb51739a0588ccf0a251de919a" + ] + ], + "gffread_gff": [ + + ], + "gtf": [ + + ], + "versions": [ + "versions.yml:md5,05f671c6c6e530acedad0af0a5948dbd" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-09T10:54:02.88143" + } +} \ No newline at end of file diff --git a/modules/nf-core/gffread/tests/nextflow-fasta.config b/modules/nf-core/gffread/tests/nextflow-fasta.config new file mode 100644 index 000000000..ac6cb1484 --- /dev/null +++ b/modules/nf-core/gffread/tests/nextflow-fasta.config @@ -0,0 +1,5 @@ +process { + withName: GFFREAD { + ext.args = '-w -S' + } +} diff --git a/modules/nf-core/gffread/tests/nextflow-gff3.config b/modules/nf-core/gffread/tests/nextflow-gff3.config new file mode 100644 index 000000000..afe0830e5 --- /dev/null +++ b/modules/nf-core/gffread/tests/nextflow-gff3.config @@ -0,0 +1,5 @@ +process { + withName: GFFREAD { + ext.args = '' + } +} diff --git a/modules/nf-core/gffread/tests/nextflow.config b/modules/nf-core/gffread/tests/nextflow.config new file mode 100644 index 000000000..74b25094f --- /dev/null +++ b/modules/nf-core/gffread/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: GFFREAD { + ext.args = '-T' + } +} diff --git a/modules/nf-core/gffread/tests/tags.yml b/modules/nf-core/gffread/tests/tags.yml new file mode 100644 index 000000000..055760656 --- /dev/null +++ b/modules/nf-core/gffread/tests/tags.yml @@ -0,0 +1,2 @@ +gffread: + - modules/nf-core/gffread/** diff --git a/modules/nf-core/gnu/sort/environment.yml b/modules/nf-core/gnu/sort/environment.yml new file mode 100644 index 000000000..babcfb551 --- /dev/null +++ b/modules/nf-core/gnu/sort/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::coreutils=9.3 diff --git a/modules/nf-core/gnu/sort/main.nf b/modules/nf-core/gnu/sort/main.nf new file mode 100644 index 000000000..e1167666f --- /dev/null +++ b/modules/nf-core/gnu/sort/main.nf @@ -0,0 +1,51 @@ +process GNU_SORT { + tag "$meta.id" + label "process_low" + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/coreutils:9.3': + 'biocontainers/coreutils:9.3' }" + + input: + tuple val(meta), path(input) + + output: + tuple val(meta), file( "${output_file}" ) , emit: sorted + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "${input.extension}" + output_file = "${prefix}.${suffix}" + def VERSION = "9.3" // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + if ("$input" == "$output_file") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + sort ${args} ${input} > ${output_file} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + coreutils: $VERSION + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "${input.extension}" + output_file = "${prefix}.${suffix}" + def VERSION = "9.3" + + if ("$input" == "$output_file") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + touch ${output_file} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + coreutils: $VERSION + END_VERSIONS + """ +} diff --git a/modules/nf-core/gnu/sort/meta.yml b/modules/nf-core/gnu/sort/meta.yml new file mode 100644 index 000000000..c555dbb5c --- /dev/null +++ b/modules/nf-core/gnu/sort/meta.yml @@ -0,0 +1,40 @@ +name: "gnu_sort" +description: | + Writes a sorted concatenation of file/s +keywords: + - GNU + - sort + - merge compare +tools: + - sort: + description: "Writes a sorted concatenation of file/s" + homepage: "https://github.com/vgl-hub/gfastats" + documentation: "https://www.gnu.org/software/coreutils/manual/html_node/sort-invocation.html" + licence: ["GPL"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: Draft assembly file + pattern: "*.{txt,bed,interval,genome,bins}" +output: + - sorted: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@DLBPointon" +maintainers: + - "@DLBPointon" diff --git a/modules/nf-core/gnu/sort/tests/main.nf.test b/modules/nf-core/gnu/sort/tests/main.nf.test new file mode 100644 index 000000000..e40301871 --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/main.nf.test @@ -0,0 +1,120 @@ +nextflow_process { + + name "Test Process GNU_SORT" + script "modules/nf-core/gnu/sort/main.nf" + process "GNU_SORT" + + tag "modules" + tag "modules_nfcore" + tag "gnu" + tag "gnu/sort" + + test("unsorted_genome_sort") { + config "./sort_simple_bed.config" + + when { + process { + """ + input[0] = [ + [id:'genome_test'], + file(params.test_data['generic']['unsorted_data']['unsorted_text']['genome_file'], + checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.sorted[0][1]).name + ).match("genome_sort") + } + ) + } + + } + + test("unsorted_intervals_sort") { + config "./sort_simple_bed.config" + when { + process { + """ + input[0] = [ + [id:'test'], + file(params.test_data['generic']['unsorted_data']['unsorted_text']['intervals'], + checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.sorted[0][1]).name + ).match("interval_sort") + } + ) + } + + } + + test("unsorted_csv_sort") { + config "./sort_complex.config" + + when { + process { + """ + input[0] = [ + [id:'test'], + file(params.test_data['generic']['unsorted_data']['unsorted_text']['numbers_csv'], + checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.sorted[0][1]).name + ).match("csv_sort") + } + ) + } + + } + + test("unsorted_csv_sort_stub") { + config "./sort_complex.config" + options "-stub" + + when { + process { + """ + input[0] = [ + [id:'test'], + file(params.test_data['generic']['unsorted_data']['unsorted_text']['numbers_csv'], + checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + +} diff --git a/modules/nf-core/gnu/sort/tests/main.nf.test.snap b/modules/nf-core/gnu/sort/tests/main.nf.test.snap new file mode 100644 index 000000000..63891bc4b --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/main.nf.test.snap @@ -0,0 +1,164 @@ +{ + "unsorted_csv_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.csv.sorted:md5,0b52d1b4c4a0c6e972c6f94aafd75a1d" + ] + ], + "1": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test.csv.sorted:md5,0b52d1b4c4a0c6e972c6f94aafd75a1d" + ] + ], + "versions": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:44.714632791" + }, + "interval_sort": { + "content": [ + "test.bed.sorted" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:37.962807086" + }, + "unsorted_csv_sort_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.csv.sorted:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test.csv.sorted:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:51.456258705" + }, + "csv_sort": { + "content": [ + "test.csv.sorted" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:44.725431761" + }, + "unsorted_genome_sort": { + "content": [ + { + "0": [ + [ + { + "id": "genome_test" + }, + "genome_test.bed.sorted:md5,fd97f7efafdbbfa71d9b560f10b4b048" + ] + ], + "1": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ], + "sorted": [ + [ + { + "id": "genome_test" + }, + "genome_test.bed.sorted:md5,fd97f7efafdbbfa71d9b560f10b4b048" + ] + ], + "versions": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:31.041778719" + }, + "genome_sort": { + "content": [ + "genome_test.bed.sorted" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:31.060201722" + }, + "unsorted_intervals_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed.sorted:md5,abbce903ef263d38b2f71856387799ab" + ] + ], + "1": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test.bed.sorted:md5,abbce903ef263d38b2f71856387799ab" + ] + ], + "versions": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:37.951397547" + } +} \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/tests/sort_complex.config b/modules/nf-core/gnu/sort/tests/sort_complex.config new file mode 100644 index 000000000..103eaaf6f --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/sort_complex.config @@ -0,0 +1,6 @@ +process { + withName: GNU_SORT { + ext.args = { "-t ';' -g -k 1,1 -k 2,2" } + ext.suffix = { "csv.sorted" } + } +} \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/tests/sort_simple_bed.config b/modules/nf-core/gnu/sort/tests/sort_simple_bed.config new file mode 100644 index 000000000..d7d52e0f2 --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/sort_simple_bed.config @@ -0,0 +1,6 @@ +process { + withName: GNU_SORT { + ext.args = { "-k1,1 -k2,2n" } + ext.suffix = { "bed.sorted" } + } +} \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/tests/sort_simple_genome.config b/modules/nf-core/gnu/sort/tests/sort_simple_genome.config new file mode 100644 index 000000000..4dcec3855 --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/sort_simple_genome.config @@ -0,0 +1,6 @@ +process { + withName: GNU_SORT { + ext.args = { "-k1,1 -k2,2n" } + ext.suffix = { "genome.sorted" } + } +} \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/tests/tags.yml b/modules/nf-core/gnu/sort/tests/tags.yml new file mode 100644 index 000000000..ac40e376d --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/tags.yml @@ -0,0 +1,2 @@ +gnu/sort: + - "modules/nf-core/gnu/sort/**" diff --git a/modules/nf-core/hisat2/align/environment.yml b/modules/nf-core/hisat2/align/environment.yml new file mode 100644 index 000000000..804be5ef8 --- /dev/null +++ b/modules/nf-core/hisat2/align/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::hisat2=2.2.1 + - bioconda::samtools=1.16.1 diff --git a/modules/nf-core/hisat2/align/main.nf b/modules/nf-core/hisat2/align/main.nf new file mode 100644 index 000000000..f45f9bccb --- /dev/null +++ b/modules/nf-core/hisat2/align/main.nf @@ -0,0 +1,109 @@ +process HISAT2_ALIGN { + tag "$meta.id" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/mulled-v2-a97e90b3b802d1da3d6958e0867610c718cb5eb1:2cdf6bf1e92acbeb9b2834b1c58754167173a410-0' : + 'biocontainers/mulled-v2-a97e90b3b802d1da3d6958e0867610c718cb5eb1:2cdf6bf1e92acbeb9b2834b1c58754167173a410-0' }" + + input: + tuple val(meta), path(reads) + tuple val(meta2), path(index) + tuple val(meta3), path(splicesites) + + output: + tuple val(meta), path("*.bam") , emit: bam + tuple val(meta), path("*.log") , emit: summary + tuple val(meta), path("*fastq.gz"), optional:true, emit: fastq + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + + def strandedness = '' + if (meta.strandedness == 'forward') { + strandedness = meta.single_end ? '--rna-strandness F' : '--rna-strandness FR' + } else if (meta.strandedness == 'reverse') { + strandedness = meta.single_end ? '--rna-strandness R' : '--rna-strandness RF' + } + ss = "$splicesites" ? "--known-splicesite-infile $splicesites" : '' + def seq_center = params.seq_center ? "--rg-id ${prefix} --rg SM:$prefix --rg CN:${params.seq_center.replaceAll('\\s','_')}" : "--rg-id ${prefix} --rg SM:$prefix" + if (meta.single_end) { + def unaligned = params.save_unaligned ? "--un-gz ${prefix}.unmapped.fastq.gz" : '' + """ + INDEX=`find -L ./ -name "*.1.ht2" | sed 's/\\.1.ht2\$//'` + hisat2 \\ + -x \$INDEX \\ + -U $reads \\ + $strandedness \\ + $ss \\ + --summary-file ${prefix}.hisat2.summary.log \\ + --threads $task.cpus \\ + $seq_center \\ + $unaligned \\ + $args \\ + | samtools view -bS -F 4 -F 256 - > ${prefix}.bam + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + hisat2: \$(hisat2 --version | grep -o 'version [^ ]*' | cut -d ' ' -f 2) + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + } else { + def unaligned = params.save_unaligned ? "--un-conc-gz ${prefix}.unmapped.fastq.gz" : '' + """ + INDEX=`find -L ./ -name "*.1.ht2" | sed 's/\\.1.ht2\$//'` + hisat2 \\ + -x \$INDEX \\ + -1 ${reads[0]} \\ + -2 ${reads[1]} \\ + $strandedness \\ + $ss \\ + --summary-file ${prefix}.hisat2.summary.log \\ + --threads $task.cpus \\ + $seq_center \\ + $unaligned \\ + --no-mixed \\ + --no-discordant \\ + $args \\ + | samtools view -bS -F 4 -F 8 -F 256 - > ${prefix}.bam + + if [ -f ${prefix}.unmapped.fastq.1.gz ]; then + mv ${prefix}.unmapped.fastq.1.gz ${prefix}.unmapped_1.fastq.gz + fi + if [ -f ${prefix}.unmapped.fastq.2.gz ]; then + mv ${prefix}.unmapped.fastq.2.gz ${prefix}.unmapped_2.fastq.gz + fi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + hisat2: \$(hisat2 --version | grep -o 'version [^ ]*' | cut -d ' ' -f 2) + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + } + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def unaligned = params.save_unaligned ? "echo '' | gzip > ${prefix}.unmapped_1.fastq.gz \n echo '' | gzip > ${prefix}.unmapped_2.fastq.gz" : '' + """ + ${unaligned} + + touch ${prefix}.hisat2.summary.log + touch ${prefix}.bam + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + hisat2: \$(hisat2 --version | grep -o 'version [^ ]*' | cut -d ' ' -f 2) + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + +} diff --git a/modules/nf-core/hisat2/align/meta.yml b/modules/nf-core/hisat2/align/meta.yml new file mode 100644 index 000000000..3416c87aa --- /dev/null +++ b/modules/nf-core/hisat2/align/meta.yml @@ -0,0 +1,88 @@ +name: hisat2_align +description: Align RNA-Seq reads to a reference with HISAT2 +keywords: + - align + - fasta + - genome + - reference +tools: + - hisat2: + description: HISAT2 is a fast and sensitive alignment program for mapping next-generation + sequencing reads (both DNA and RNA) to a population of human genomes as well + as to a single reference genome. + homepage: https://daehwankimlab.github.io/hisat2/ + documentation: https://daehwankimlab.github.io/hisat2/manual/ + doi: "10.1038/s41587-019-0201-4" + licence: ["MIT"] + identifier: biotools:hisat2 +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - index: + type: file + description: HISAT2 genome index file + pattern: "*.ht2" + - - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - splicesites: + type: file + description: Splices sites in gtf file + pattern: "*.{txt}" +output: + - bam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bam": + type: file + description: Output BAM file containing read alignments + pattern: "*.{bam}" + - summary: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.log": + type: file + description: Alignment log + pattern: "*.log" + - fastq: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*fastq.gz": + type: file + description: Output FastQ file + pattern: "*fastq.gz" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@ntoda03" + - "@ramprasadn" +maintainers: + - "@ntoda03" + - "@ramprasadn" diff --git a/modules/nf-core/hisat2/align/tests/main.nf.test b/modules/nf-core/hisat2/align/tests/main.nf.test new file mode 100644 index 000000000..396757d7b --- /dev/null +++ b/modules/nf-core/hisat2/align/tests/main.nf.test @@ -0,0 +1,420 @@ +nextflow_process { + + name "Test Process HISAT2_ALIGN" + script "../main.nf" + process "HISAT2_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "hisat2" + tag "hisat2/align" + tag "hisat2/build" + tag "hisat2/extractsplicesites" + + test("Single-End") { + + setup { + run("HISAT2_EXTRACTSPLICESITES") { + script "../../extractsplicesites/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + """ + } + } + + run("HISAT2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = Channel.of([ [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + input[1] = HISAT2_BUILD.out.index + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.summary).match("se_summary") }, + { assert snapshot(process.out.fastq).match("se_fastq") }, + { assert snapshot(process.out.versions).match("se_versions") } + ) + } + } + + test("Single-End - stub") { + options "-stub" + + setup { + run("HISAT2_EXTRACTSPLICESITES") { + script "../../extractsplicesites/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + """ + } + } + + run("HISAT2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = Channel.of([ [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + input[1] = HISAT2_BUILD.out.index + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Paired-End") { + + setup { + run("HISAT2_EXTRACTSPLICESITES") { + script "../../extractsplicesites/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + """ + } + } + + run("HISAT2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = Channel.of([ [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = HISAT2_BUILD.out.index + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.summary).match("pe_summary") }, + { assert snapshot(process.out.fastq).match("pe_fastq") }, + { assert snapshot(process.out.versions).match("pe_versions") } + ) + } + } + + test("Paired-End - stub") { + options "-stub" + + setup { + run("HISAT2_EXTRACTSPLICESITES") { + script "../../extractsplicesites/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + """ + } + } + + run("HISAT2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = Channel.of([ [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = HISAT2_BUILD.out.index + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Single-End No Splice Sites") { + + setup { + run("HISAT2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = [[:],[]] + input[2] = [[:],[]] + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = HISAT2_BUILD.out.index + input[2] = [[:],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.summary).match("se_no_ss_summary") }, + { assert snapshot(process.out.fastq).match("se_no_ss_fastq") }, + { assert snapshot(process.out.versions).match("se_no_ss_versions") } + ) + } + } + + test("Single-End No Splice Sites - stub") { + options "-stub" + + setup { + run("HISAT2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = [[:],[]] + input[2] = [[:],[]] + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = HISAT2_BUILD.out.index + input[2] = [[:],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Paired-End No Splice Sites") { + + setup { + run("HISAT2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = [[:],[]] + input[2] = [[:],[]] + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = HISAT2_BUILD.out.index + input[2] = [[:],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.summary).match("pe_no_ss_summary") }, + { assert snapshot(process.out.fastq).match("pe_no_ss_fastq") }, + { assert snapshot(process.out.versions).match("pe_no_ss_versions") } + ) + } + } + + test("Paired-End No Splice Sites - stub") { + options "-stub" + + setup { + run("HISAT2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = [[:],[]] + input[2] = [[:],[]] + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = HISAT2_BUILD.out.index + input[2] = [[:],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/hisat2/align/tests/main.nf.test.snap b/modules/nf-core/hisat2/align/tests/main.nf.test.snap new file mode 100644 index 000000000..ff670d452 --- /dev/null +++ b/modules/nf-core/hisat2/align/tests/main.nf.test.snap @@ -0,0 +1,406 @@ +{ + "se_versions": { + "content": [ + [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:08:33.735489" + }, + "Paired-End - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + + ], + "summary": [ + [ + { + "id": "test", + "single_end": false + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:14.35626" + }, + "Single-End - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + + ], + "summary": [ + [ + { + "id": "test", + "single_end": true + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:08:47.404885" + }, + "pe_no_ss_versions": { + "content": [ + [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:52.076955" + }, + "Paired-End No Splice Sites - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + + ], + "summary": [ + [ + { + "id": "test", + "single_end": false + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:10:03.739697" + }, + "pe_no_ss_summary": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.hisat2.summary.log:md5,9839b31db795958cc4b70711a3414e9c" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:52.068244" + }, + "pe_no_ss_fastq": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:52.072985" + }, + "se_summary": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.hisat2.summary.log:md5,7b8a9e61b7646da1089b041333c41a87" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:08:33.727355" + }, + "pe_summary": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.hisat2.summary.log:md5,9839b31db795958cc4b70711a3414e9c" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:01.495439" + }, + "pe_fastq": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:01.500755" + }, + "se_fastq": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:08:33.732523" + }, + "se_no_ss_summary": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.hisat2.summary.log:md5,7b8a9e61b7646da1089b041333c41a87" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:26.851884" + }, + "se_no_ss_versions": { + "content": [ + [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:26.89234" + }, + "se_no_ss_fastq": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:26.871369" + }, + "Single-End No Splice Sites - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + + ], + "summary": [ + [ + { + "id": "test", + "single_end": true + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:39.544807" + }, + "pe_versions": { + "content": [ + [ + "versions.yml:md5,ceb638f44ebdaf09ba1f5c5c409585e2" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T09:09:01.506346" + } +} \ No newline at end of file diff --git a/modules/nf-core/hisat2/align/tests/tags.yml b/modules/nf-core/hisat2/align/tests/tags.yml new file mode 100644 index 000000000..3a46cc896 --- /dev/null +++ b/modules/nf-core/hisat2/align/tests/tags.yml @@ -0,0 +1,4 @@ +hisat2/align: + - modules/nf-core/hisat2/align/** + - modules/nf-core/hisat2/build/** + - modules/nf-core/hisat2/extractsplicesites/** diff --git a/modules/nf-core/hisat2/build/environment.yml b/modules/nf-core/hisat2/build/environment.yml new file mode 100644 index 000000000..246a78af3 --- /dev/null +++ b/modules/nf-core/hisat2/build/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::hisat2=2.2.1 diff --git a/modules/nf-core/hisat2/build/main.nf b/modules/nf-core/hisat2/build/main.nf new file mode 100644 index 000000000..7a5f28ba5 --- /dev/null +++ b/modules/nf-core/hisat2/build/main.nf @@ -0,0 +1,72 @@ +process HISAT2_BUILD { + tag "$fasta" + label 'process_high' + label 'process_high_memory' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/hisat2:2.2.1--h1b792b2_3' : + 'biocontainers/hisat2:2.2.1--h1b792b2_3' }" + + input: + tuple val(meta), path(fasta) + tuple val(meta2), path(gtf) + tuple val(meta3), path(splicesites) + + output: + tuple val(meta), path("hisat2") , emit: index + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def avail_mem = 0 + if (!task.memory) { + log.info "[HISAT2 index build] Available memory not known - defaulting to 0. Specify process memory requirements to change this." + } else { + log.info "[HISAT2 index build] Available memory: ${task.memory}" + avail_mem = task.memory.toGiga() + } + + def ss = '' + def exon = '' + def extract_exons = '' + def hisat2_build_memory = params.hisat2_build_memory ? (params.hisat2_build_memory as MemoryUnit).toGiga() : 0 + if (avail_mem >= hisat2_build_memory) { + log.info "[HISAT2 index build] At least ${hisat2_build_memory} GB available, so using splice sites and exons to build HISAT2 index" + extract_exons = gtf ? "hisat2_extract_exons.py $gtf > ${gtf.baseName}.exons.txt" : "" + ss = splicesites ? "--ss $splicesites" : "" + exon = gtf ? "--exon ${gtf.baseName}.exons.txt" : "" + } else { + log.info "[HISAT2 index build] Less than ${hisat2_build_memory} GB available, so NOT using splice sites and exons to build HISAT2 index." + log.info "[HISAT2 index build] Use --hisat2_build_memory [small number] to skip this check." + } + """ + mkdir hisat2 + $extract_exons + hisat2-build \\ + -p $task.cpus \\ + $ss \\ + $exon \\ + $args \\ + $fasta \\ + hisat2/${fasta.baseName} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + hisat2: \$(hisat2 --version | grep -o 'version [^ ]*' | cut -d ' ' -f 2) + END_VERSIONS + """ + + stub: + """ + mkdir hisat2 + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + hisat2: \$(hisat2 --version | grep -o 'version [^ ]*' | cut -d ' ' -f 2) + END_VERSIONS + """ +} diff --git a/modules/nf-core/hisat2/build/meta.yml b/modules/nf-core/hisat2/build/meta.yml new file mode 100644 index 000000000..3272f8e05 --- /dev/null +++ b/modules/nf-core/hisat2/build/meta.yml @@ -0,0 +1,66 @@ +name: hisat2_build +description: Builds HISAT2 index for reference genome +keywords: + - build + - index + - fasta + - genome + - reference +tools: + - hisat2: + description: HISAT2 is a fast and sensitive alignment program for mapping next-generation + sequencing reads (both DNA and RNA) to a population of human genomes as well + as to a single reference genome. + homepage: https://daehwankimlab.github.io/hisat2/ + documentation: https://daehwankimlab.github.io/hisat2/manual/ + doi: "10.1038/s41587-019-0201-4" + licence: ["MIT"] + identifier: biotools:hisat2 +input: + - - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - fasta: + type: file + description: Reference fasta file + pattern: "*.{fa,fasta,fna}" + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - gtf: + type: file + description: Reference gtf annotation file + pattern: "*.{gtf}" + - - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - splicesites: + type: file + description: Splices sites in gtf file + pattern: "*.{txt}" +output: + - index: + - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - hisat2: + type: file + description: HISAT2 genome index file + pattern: "*.ht2" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@ntoda03" +maintainers: + - "@ntoda03" diff --git a/modules/nf-core/hisat2/build/tests/main.nf.test b/modules/nf-core/hisat2/build/tests/main.nf.test new file mode 100644 index 000000000..e19692c4f --- /dev/null +++ b/modules/nf-core/hisat2/build/tests/main.nf.test @@ -0,0 +1,98 @@ +nextflow_process { + + name "Test Process HISAT2_BUILD" + script "../main.nf" + process "HISAT2_BUILD" + tag "modules" + tag "modules_nfcore" + tag "hisat2" + tag "hisat2/build" + tag "hisat2/extractsplicesites" + + test("Should run without failures") { + + setup { + run("HISAT2_EXTRACTSPLICESITES") { + script "../../extractsplicesites/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = Channel.of([ [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("Should run without failures - stub") { + + options "-stub" + + setup { + run("HISAT2_EXTRACTSPLICESITES") { + script "../../extractsplicesites/main.nf" + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[1] = Channel.of([ [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + input[2] = HISAT2_EXTRACTSPLICESITES.out.txt + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/hisat2/build/tests/main.nf.test.snap b/modules/nf-core/hisat2/build/tests/main.nf.test.snap new file mode 100644 index 000000000..68fc7ffba --- /dev/null +++ b/modules/nf-core/hisat2/build/tests/main.nf.test.snap @@ -0,0 +1,90 @@ +{ + "Should run without failures - stub": { + "content": [ + { + "0": [ + [ + { + "id": "genome" + }, + [ + + ] + ] + ], + "1": [ + "versions.yml:md5,e36ef3cd73d19ccf2378c9358fe942c0" + ], + "index": [ + [ + { + "id": "genome" + }, + [ + + ] + ] + ], + "versions": [ + "versions.yml:md5,e36ef3cd73d19ccf2378c9358fe942c0" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-20T18:18:08.896422" + }, + "Should run without failures": { + "content": [ + { + "0": [ + [ + { + "id": "genome" + }, + [ + "genome.1.ht2:md5,057cfa8a22b97ee9cff4c8d342498803", + "genome.2.ht2:md5,47b153cd1319abc88dda532462651fcf", + "genome.3.ht2:md5,4ed93abba181d8dfab2e303e33114777", + "genome.4.ht2:md5,c25be5f8b0378abf7a58c8a880b87626", + "genome.5.ht2:md5,91198831aaba993acac1734138c5f173", + "genome.6.ht2:md5,265e1284ce85686516fae5d35540994a", + "genome.7.ht2:md5,9013eccd91ad614d7893c739275a394f", + "genome.8.ht2:md5,33cdeccccebe80329f1fdbee7f5874cb" + ] + ] + ], + "1": [ + "versions.yml:md5,e36ef3cd73d19ccf2378c9358fe942c0" + ], + "index": [ + [ + { + "id": "genome" + }, + [ + "genome.1.ht2:md5,057cfa8a22b97ee9cff4c8d342498803", + "genome.2.ht2:md5,47b153cd1319abc88dda532462651fcf", + "genome.3.ht2:md5,4ed93abba181d8dfab2e303e33114777", + "genome.4.ht2:md5,c25be5f8b0378abf7a58c8a880b87626", + "genome.5.ht2:md5,91198831aaba993acac1734138c5f173", + "genome.6.ht2:md5,265e1284ce85686516fae5d35540994a", + "genome.7.ht2:md5,9013eccd91ad614d7893c739275a394f", + "genome.8.ht2:md5,33cdeccccebe80329f1fdbee7f5874cb" + ] + ] + ], + "versions": [ + "versions.yml:md5,e36ef3cd73d19ccf2378c9358fe942c0" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2023-10-16T14:42:22.381609786" + } +} \ No newline at end of file diff --git a/modules/nf-core/hisat2/build/tests/tags.yml b/modules/nf-core/hisat2/build/tests/tags.yml new file mode 100644 index 000000000..a7faecb27 --- /dev/null +++ b/modules/nf-core/hisat2/build/tests/tags.yml @@ -0,0 +1,3 @@ +hisat2/build: + - modules/nf-core/hisat2/build/** + - modules/nf-core/hisat2/extractsplicesites/** diff --git a/modules/nf-core/hisat2/extractsplicesites/environment.yml b/modules/nf-core/hisat2/extractsplicesites/environment.yml new file mode 100644 index 000000000..246a78af3 --- /dev/null +++ b/modules/nf-core/hisat2/extractsplicesites/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::hisat2=2.2.1 diff --git a/modules/nf-core/hisat2/extractsplicesites/main.nf b/modules/nf-core/hisat2/extractsplicesites/main.nf new file mode 100644 index 000000000..82d2cfbac --- /dev/null +++ b/modules/nf-core/hisat2/extractsplicesites/main.nf @@ -0,0 +1,39 @@ +process HISAT2_EXTRACTSPLICESITES { + tag "$gtf" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/hisat2:2.2.1--h1b792b2_3' : + 'biocontainers/hisat2:2.2.1--h1b792b2_3' }" + + input: + tuple val(meta), path(gtf) + + output: + tuple val(meta), path("*.splice_sites.txt"), emit: txt + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + """ + hisat2_extract_splice_sites.py $gtf > ${gtf.baseName}.splice_sites.txt + cat <<-END_VERSIONS > versions.yml + "${task.process}": + hisat2: \$(hisat2 --version | grep -o 'version [^ ]*' | cut -d ' ' -f 2) + END_VERSIONS + """ + + stub: + """ + touch ${gtf.baseName}.splice_sites.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + hisat2: \$(hisat2 --version | grep -o 'version [^ ]*' | cut -d ' ' -f 2) + END_VERSIONS + """ +} diff --git a/modules/nf-core/hisat2/extractsplicesites/meta.yml b/modules/nf-core/hisat2/extractsplicesites/meta.yml new file mode 100644 index 000000000..c1bdc9e65 --- /dev/null +++ b/modules/nf-core/hisat2/extractsplicesites/meta.yml @@ -0,0 +1,49 @@ +name: hisat2_extractsplicesites +description: Extracts splicing sites from a gtf files +keywords: + - splicing + - gtf + - genome + - reference +tools: + - hisat2: + description: HISAT2 is a fast and sensitive alignment program for mapping next-generation + sequencing reads (both DNA and RNA) to a population of human genomes as well + as to a single reference genome. + homepage: https://daehwankimlab.github.io/hisat2/ + documentation: https://daehwankimlab.github.io/hisat2/manual/ + doi: "10.1038/s41587-019-0201-4" + licence: ["MIT"] + identifier: biotools:hisat2 +input: + - - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - gtf: + type: file + description: Reference gtf annotation file + pattern: "*.{gtf}" +output: + - txt: + - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - "*.splice_sites.txt": + type: file + description: Splice sites in txt file + pattern: "*.txt" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@ntoda03" + - "@ramprasadn" +maintainers: + - "@ntoda03" + - "@ramprasadn" diff --git a/modules/nf-core/hisat2/extractsplicesites/tests/main.nf.test b/modules/nf-core/hisat2/extractsplicesites/tests/main.nf.test new file mode 100644 index 000000000..14129cfff --- /dev/null +++ b/modules/nf-core/hisat2/extractsplicesites/tests/main.nf.test @@ -0,0 +1,61 @@ +nextflow_process { + + name "Test Process HISAT2_EXTRACTSPLICESITES" + script "../main.nf" + process "HISAT2_EXTRACTSPLICESITES" + tag "modules" + tag "modules_nfcore" + tag "hisat2" + tag "hisat2/extractsplicesites" + + test("Should run without failures") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path("${process.out.txt[0][1]}").exists() }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("test - stub") { + + options "-stub" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [id:'genome'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/hisat2/extractsplicesites/tests/main.nf.test.snap b/modules/nf-core/hisat2/extractsplicesites/tests/main.nf.test.snap new file mode 100644 index 000000000..1dcd8af23 --- /dev/null +++ b/modules/nf-core/hisat2/extractsplicesites/tests/main.nf.test.snap @@ -0,0 +1,47 @@ +{ + "test - stub": { + "content": [ + { + "0": [ + [ + { + "id": "genome" + }, + "genome.splice_sites.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,eeea7231fe197810659b8bad4133aff2" + ], + "txt": [ + [ + { + "id": "genome" + }, + "genome.splice_sites.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,eeea7231fe197810659b8bad4133aff2" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-20T17:34:13.229903" + }, + "Should run without failures": { + "content": [ + [ + "versions.yml:md5,eeea7231fe197810659b8bad4133aff2" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-01-18T20:56:30.71763" + } +} \ No newline at end of file diff --git a/modules/nf-core/hisat2/extractsplicesites/tests/tags.yml b/modules/nf-core/hisat2/extractsplicesites/tests/tags.yml new file mode 100644 index 000000000..4b0ed4010 --- /dev/null +++ b/modules/nf-core/hisat2/extractsplicesites/tests/tags.yml @@ -0,0 +1,2 @@ +hisat2/extractsplicesites: + - modules/nf-core/hisat2/extractsplicesites/** diff --git a/modules/nf-core/miranda/environment.yml b/modules/nf-core/miranda/environment.yml new file mode 100644 index 000000000..cc57c51b7 --- /dev/null +++ b/modules/nf-core/miranda/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::miranda=3.3a diff --git a/modules/nf-core/miranda/main.nf b/modules/nf-core/miranda/main.nf new file mode 100644 index 000000000..47a98253e --- /dev/null +++ b/modules/nf-core/miranda/main.nf @@ -0,0 +1,50 @@ +process MIRANDA { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/miranda:3.3a--h779adbc_3': + 'biocontainers/miranda:3.3a--h779adbc_3' }" + + input: + tuple val(meta), path(query) + path(mirbase) + + output: + tuple val(meta), path("*.txt"), emit: txt + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + """ + miranda \\ + $mirbase \\ + $query \\ + $args \\ + -out ${prefix}.out + + echo "miRNA\tTarget\tScore\tEnergy_KcalMol\tQuery_Start\tQuery_End\tSubject_Start\tSubject_End\tAln_len\tSubject_Identity\tQuery_Identity" > ${prefix}.txt + grep -A 1 "Scores for this hit:" ${prefix}.out | sort | grep ">" | cut -c 2- | tr ' ' '\t' >> ${prefix}.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + miranda: \$(echo \$(miranda -v | sed -n 4p | sed 's/^.*miranda v//; s/microRNA.*\$//' )) + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + miranda: \$(echo \$(miranda -v | sed -n 4p | sed 's/^.*miranda v//; s/microRNA.*\$//' )) + END_VERSIONS + """ +} diff --git a/modules/nf-core/miranda/meta.yml b/modules/nf-core/miranda/meta.yml new file mode 100644 index 000000000..ecfd2e59b --- /dev/null +++ b/modules/nf-core/miranda/meta.yml @@ -0,0 +1,48 @@ +name: "miranda" +description: miRanda is an algorithm for finding genomic targets for microRNAs +keywords: + - microrna + - mirna + - target prediction +tools: + - "miranda": + description: "An algorithm for finding genomic targets for microRNAs" + homepage: "https://cbio.mskcc.org/miRNA2003/miranda.html" + documentation: "https://cbio.mskcc.org/miRNA2003/miranda.html" + doi: "10.1186/gb-2003-5-1-r1" + licence: ["GNU Public License"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - query: + type: file + description: FASTA file containing the microRNA query sequences + pattern: "*.{fa,fasta}" + - - mirbase: + type: file + description: FASTA file containing the sequence(s) to be scanned + pattern: "*.{fa,fasta}" +output: + - txt: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.txt": + type: file + description: Reformatted TXT file containing microRNA targets + pattern: "*.{txt}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@BarryDigby" +maintainers: + - "@BarryDigby" diff --git a/modules/nf-core/miranda/tests/main.nf.test b/modules/nf-core/miranda/tests/main.nf.test new file mode 100644 index 000000000..d2851388c --- /dev/null +++ b/modules/nf-core/miranda/tests/main.nf.test @@ -0,0 +1,69 @@ + +nextflow_process { + + name "Test Process MIRANDA" + script "../main.nf" + process "MIRANDA" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "miranda" + + test("test-miranda") { + + when { + process { + """ + input[0] = [ + [ id:'cel_N2_1' ], + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/miranda/cel_N2_1.fa") + ] + + input[1] = [ + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/miranda/mature.fa") + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.txt[0][1]).readLines()[3..7], + process.out.versions + ).match() + } + ) + } + } + + test("test-miranda-stub") { + options '-stub' + when { + process { + """ + input[0] = [ + [ id:'cel_N2_1' ], + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/miranda/cel_N2_1.fa") + ] + + input[1] = [ + file("https://raw.githubusercontent.com/nf-core/test-datasets/circrna/miranda/mature.fa") + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/miranda/tests/main.nf.test.snap b/modules/nf-core/miranda/tests/main.nf.test.snap new file mode 100644 index 000000000..4dbe00098 --- /dev/null +++ b/modules/nf-core/miranda/tests/main.nf.test.snap @@ -0,0 +1,54 @@ +{ + "test-miranda-stub": { + "content": [ + { + "0": [ + [ + { + "id": "cel_N2_1" + }, + "cel_N2_1.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,de51ea2acd3e2978e5057257b4b74e04" + ], + "txt": [ + [ + { + "id": "cel_N2_1" + }, + "cel_N2_1.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,de51ea2acd3e2978e5057257b4b74e04" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T21:43:19.841963" + }, + "test-miranda": { + "content": [ + [ + "cel-miR-1-3p\tchrI:3749429-3751849:-\t141.00\t-11.70\t2\t14\t323\t343\t12\t75.00%\t75.00%", + "cel-miR-1-5p\tchrI:2478229-2478802:-\t146.00\t-13.27\t2\t11\t296\t317\t9\t88.89%\t100.00%", + "cel-miR-1018\tchrI:1838160-1839382:+\t150.00\t-13.18\t2\t20\t333\t356\t20\t70.00%\t70.00%", + "cel-miR-1018\tchrI:2258516-2259521:-\t146.00\t-13.35\t2\t16\t425\t448\t16\t75.00%\t75.00%", + "cel-miR-1018\tchrI:2478229-2478802:-\t151.00\t-13.50\t2\t20\t110\t131\t18\t66.67%\t72.22%" + ], + [ + "versions.yml:md5,de51ea2acd3e2978e5057257b4b74e04" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T21:43:15.719084" + } +} \ No newline at end of file diff --git a/modules/nf-core/miranda/tests/nextflow.config b/modules/nf-core/miranda/tests/nextflow.config new file mode 100644 index 000000000..bc14a0731 --- /dev/null +++ b/modules/nf-core/miranda/tests/nextflow.config @@ -0,0 +1,8 @@ +process { + withName: MIRANDA { + ext.args = [ + "-strict", + "-quiet" + ].join(' ').trim() + } +} diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml new file mode 100644 index 000000000..c3b3413fa --- /dev/null +++ b/modules/nf-core/multiqc/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::multiqc=1.27 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf new file mode 100644 index 000000000..58d9313c6 --- /dev/null +++ b/modules/nf-core/multiqc/main.nf @@ -0,0 +1,63 @@ +process MULTIQC { + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/multiqc:1.27--pyhdfd78af_0' : + 'biocontainers/multiqc:1.27--pyhdfd78af_0' }" + + input: + path multiqc_files, stageAs: "?/*" + path(multiqc_config) + path(extra_multiqc_config) + path(multiqc_logo) + path(replace_names) + path(sample_names) + + output: + path "*multiqc_report.html", emit: report + path "*_data" , emit: data + path "*_plots" , optional:true, emit: plots + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ? "--filename ${task.ext.prefix}.html" : '' + def config = multiqc_config ? "--config $multiqc_config" : '' + def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' + def logo = multiqc_logo ? "--cl-config 'custom_logo: \"${multiqc_logo}\"'" : '' + def replace = replace_names ? "--replace-names ${replace_names}" : '' + def samples = sample_names ? "--sample-names ${sample_names}" : '' + """ + multiqc \\ + --force \\ + $args \\ + $config \\ + $prefix \\ + $extra_config \\ + $logo \\ + $replace \\ + $samples \\ + . + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + multiqc: \$( multiqc --version | sed -e "s/multiqc, version //g" ) + END_VERSIONS + """ + + stub: + """ + mkdir multiqc_data + mkdir multiqc_plots + touch multiqc_report.html + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + multiqc: \$( multiqc --version | sed -e "s/multiqc, version //g" ) + END_VERSIONS + """ +} diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml new file mode 100644 index 000000000..b16c18792 --- /dev/null +++ b/modules/nf-core/multiqc/meta.yml @@ -0,0 +1,78 @@ +name: multiqc +description: Aggregate results from bioinformatics analyses across many samples into + a single report +keywords: + - QC + - bioinformatics tools + - Beautiful stand-alone HTML report +tools: + - multiqc: + description: | + MultiQC searches a given directory for analysis logs and compiles a HTML report. + It's a general use tool, perfect for summarising the output from numerous bioinformatics tools. + homepage: https://multiqc.info/ + documentation: https://multiqc.info/docs/ + licence: ["GPL-3.0-or-later"] + identifier: biotools:multiqc +input: + - - multiqc_files: + type: file + description: | + List of reports / files recognised by MultiQC, for example the html and zip output of FastQC + - - multiqc_config: + type: file + description: Optional config yml for MultiQC + pattern: "*.{yml,yaml}" + - - extra_multiqc_config: + type: file + description: Second optional config yml for MultiQC. Will override common sections + in multiqc_config. + pattern: "*.{yml,yaml}" + - - multiqc_logo: + type: file + description: Optional logo file for MultiQC + pattern: "*.{png}" + - - replace_names: + type: file + description: | + Optional two-column sample renaming file. First column a set of + patterns, second column a set of corresponding replacements. Passed via + MultiQC's `--replace-names` option. + pattern: "*.{tsv}" + - - sample_names: + type: file + description: | + Optional TSV file with headers, passed to the MultiQC --sample_names + argument. + pattern: "*.{tsv}" +output: + - report: + - "*multiqc_report.html": + type: file + description: MultiQC report file + pattern: "multiqc_report.html" + - data: + - "*_data": + type: directory + description: MultiQC data dir + pattern: "multiqc_data" + - plots: + - "*_plots": + type: file + description: Plots created by MultiQC + pattern: "*_data" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@abhi18av" + - "@bunop" + - "@drpatelh" + - "@jfy133" +maintainers: + - "@abhi18av" + - "@bunop" + - "@drpatelh" + - "@jfy133" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test new file mode 100644 index 000000000..33316a7dd --- /dev/null +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -0,0 +1,92 @@ +nextflow_process { + + name "Test Process MULTIQC" + script "../main.nf" + process "MULTIQC" + + tag "modules" + tag "modules_nfcore" + tag "multiqc" + + config "./nextflow.config" + + test("sarscov2 single-end [fastqc]") { + + when { + process { + """ + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) + input[1] = [] + input[2] = [] + input[3] = [] + input[4] = [] + input[5] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, + { assert process.out.data[0] ==~ ".*/multiqc_data" }, + { assert snapshot(process.out.versions).match("multiqc_versions_single") } + ) + } + + } + + test("sarscov2 single-end [fastqc] [config]") { + + when { + process { + """ + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) + input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) + input[2] = [] + input[3] = [] + input[4] = [] + input[5] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, + { assert process.out.data[0] ==~ ".*/multiqc_data" }, + { assert snapshot(process.out.versions).match("multiqc_versions_config") } + ) + } + } + + test("sarscov2 single-end [fastqc] - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) + input[1] = [] + input[2] = [] + input[3] = [] + input[4] = [] + input[5] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.report.collect { file(it).getName() } + + process.out.data.collect { file(it).getName() } + + process.out.plots.collect { file(it).getName() } + + process.out.versions ).match("multiqc_stub") } + ) + } + + } +} diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap new file mode 100644 index 000000000..7b7c13220 --- /dev/null +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -0,0 +1,41 @@ +{ + "multiqc_versions_single": { + "content": [ + [ + "versions.yml:md5,8f3b8c1cec5388cf2708be948c9fa42f" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-01-27T09:29:57.631982377" + }, + "multiqc_stub": { + "content": [ + [ + "multiqc_report.html", + "multiqc_data", + "multiqc_plots", + "versions.yml:md5,8f3b8c1cec5388cf2708be948c9fa42f" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-01-27T09:30:34.743726958" + }, + "multiqc_versions_config": { + "content": [ + [ + "versions.yml:md5,8f3b8c1cec5388cf2708be948c9fa42f" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.4" + }, + "timestamp": "2025-01-27T09:30:21.44383553" + } +} \ No newline at end of file diff --git a/modules/nf-core/multiqc/tests/nextflow.config b/modules/nf-core/multiqc/tests/nextflow.config new file mode 100644 index 000000000..c537a6a3e --- /dev/null +++ b/modules/nf-core/multiqc/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'MULTIQC' { + ext.prefix = null + } +} diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml new file mode 100644 index 000000000..bea6c0d37 --- /dev/null +++ b/modules/nf-core/multiqc/tests/tags.yml @@ -0,0 +1,2 @@ +multiqc: + - modules/nf-core/multiqc/** diff --git a/modules/nf-core/samtools/faidx/environment.yml b/modules/nf-core/samtools/faidx/environment.yml new file mode 100644 index 000000000..62054fc97 --- /dev/null +++ b/modules/nf-core/samtools/faidx/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/faidx/main.nf b/modules/nf-core/samtools/faidx/main.nf new file mode 100644 index 000000000..28c0a81cf --- /dev/null +++ b/modules/nf-core/samtools/faidx/main.nf @@ -0,0 +1,50 @@ +process SAMTOOLS_FAIDX { + tag "$fasta" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" + + input: + tuple val(meta), path(fasta) + tuple val(meta2), path(fai) + + output: + tuple val(meta), path ("*.{fa,fasta}") , emit: fa , optional: true + tuple val(meta), path ("*.fai") , emit: fai, optional: true + tuple val(meta), path ("*.gzi") , emit: gzi, optional: true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + """ + samtools \\ + faidx \\ + $fasta \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def match = (task.ext.args =~ /-o(?:utput)?\s(.*)\s?/).findAll() + def fastacmd = match[0] ? "touch ${match[0][1]}" : '' + """ + ${fastacmd} + touch ${fasta}.fai + + cat <<-END_VERSIONS > versions.yml + + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/samtools/faidx/meta.yml b/modules/nf-core/samtools/faidx/meta.yml new file mode 100644 index 000000000..6721b2cb8 --- /dev/null +++ b/modules/nf-core/samtools/faidx/meta.yml @@ -0,0 +1,80 @@ +name: samtools_faidx +description: Index FASTA file +keywords: + - index + - fasta + - faidx +tools: + - samtools: + description: | + SAMtools is a set of utilities for interacting with and post-processing + short DNA sequence read alignments in the SAM, BAM and CRAM formats, written by Heng Li. + These files are generated as output by short read aligners like BWA. + homepage: http://www.htslib.org/ + documentation: http://www.htslib.org/doc/samtools.html + doi: 10.1093/bioinformatics/btp352 + licence: ["MIT"] + identifier: biotools:samtools +input: + - - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - fasta: + type: file + description: FASTA file + pattern: "*.{fa,fasta}" + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - fai: + type: file + description: FASTA index file + pattern: "*.{fai}" +output: + - fa: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.{fa,fasta}": + type: file + description: FASTA file + pattern: "*.{fa}" + - fai: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.fai": + type: file + description: FASTA index file + pattern: "*.{fai}" + - gzi: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.gzi": + type: file + description: Optional gzip index file for compressed inputs + pattern: "*.gzi" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@ewels" + - "@phue" +maintainers: + - "@drpatelh" + - "@ewels" + - "@phue" diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test b/modules/nf-core/samtools/faidx/tests/main.nf.test new file mode 100644 index 000000000..17244ef2e --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test @@ -0,0 +1,122 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FAIDX" + script "../main.nf" + process "SAMTOOLS_FAIDX" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/faidx" + + test("test_samtools_faidx") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_bgzip") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true)] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_fasta") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_stub_fasta") { + + config "./nextflow2.config" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_stub_fai") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test.snap b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap new file mode 100644 index 000000000..1bbb3ec2b --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap @@ -0,0 +1,249 @@ +{ + "test_samtools_faidx": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:57:47.450887871" + }, + "test_samtools_faidx_bgzip": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:04.804905659" + }, + "test_samtools_faidx_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36" + ] + ], + "fai": [ + + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:23.831268154" + }, + "test_samtools_faidx_stub_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "fai": [ + + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:35.600243706" + }, + "test_samtools_faidx_stub_fai": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:54.705460167" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/nextflow.config b/modules/nf-core/samtools/faidx/tests/nextflow.config new file mode 100644 index 000000000..f76a3ba09 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_FAIDX { + ext.args = 'MT192765.1 -o extract.fa' + } + +} diff --git a/modules/nf-core/samtools/faidx/tests/nextflow2.config b/modules/nf-core/samtools/faidx/tests/nextflow2.config new file mode 100644 index 000000000..33ebbd5df --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/nextflow2.config @@ -0,0 +1,6 @@ +process { + + withName: SAMTOOLS_FAIDX { + ext.args = '-o extract.fa' + } +} diff --git a/modules/nf-core/samtools/faidx/tests/tags.yml b/modules/nf-core/samtools/faidx/tests/tags.yml new file mode 100644 index 000000000..e4a839481 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/faidx: + - modules/nf-core/samtools/faidx/** diff --git a/modules/nf-core/samtools/flagstat/environment.yml b/modules/nf-core/samtools/flagstat/environment.yml new file mode 100644 index 000000000..62054fc97 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf new file mode 100644 index 000000000..c23f3a5cf --- /dev/null +++ b/modules/nf-core/samtools/flagstat/main.nf @@ -0,0 +1,45 @@ +process SAMTOOLS_FLAGSTAT { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" + + input: + tuple val(meta), path(bam), path(bai) + + output: + tuple val(meta), path("*.flagstat"), emit: flagstat + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + samtools \\ + flagstat \\ + --threads ${task.cpus} \\ + $bam \\ + > ${prefix}.flagstat + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.flagstat + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/samtools/flagstat/meta.yml b/modules/nf-core/samtools/flagstat/meta.yml new file mode 100644 index 000000000..cdc4c2544 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/meta.yml @@ -0,0 +1,55 @@ +name: samtools_flagstat +description: Counts the number of alignments in a BAM/CRAM/SAM file for each FLAG + type +keywords: + - stats + - mapping + - counts + - bam + - sam + - cram +tools: + - samtools: + description: | + SAMtools is a set of utilities for interacting with and post-processing + short DNA sequence read alignments in the SAM, BAM and CRAM formats, written by Heng Li. + These files are generated as output by short read aligners like BWA. + homepage: http://www.htslib.org/ + documentation: http://www.htslib.org/doc/samtools.html + doi: 10.1093/bioinformatics/btp352 + licence: ["MIT"] + identifier: biotools:samtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - bai: + type: file + description: Index for BAM/CRAM/SAM file + pattern: "*.{bai,crai,sai}" +output: + - flagstat: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.flagstat": + type: file + description: File containing samtools flagstat output + pattern: "*.{flagstat}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test new file mode 100644 index 000000000..3b648a37d --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test @@ -0,0 +1,56 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FLAGSTAT" + script "../main.nf" + process "SAMTOOLS_FLAGSTAT" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/flagstat" + + test("BAM") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("BAM - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap new file mode 100644 index 000000000..04c3852b2 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap @@ -0,0 +1,72 @@ +{ + "BAM - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,108a155f2d4a99f50bf3176904208d27" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,108a155f2d4a99f50bf3176904208d27" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:02:58.866491759" + }, + "BAM": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + "1": [ + "versions.yml:md5,108a155f2d4a99f50bf3176904208d27" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + "versions": [ + "versions.yml:md5,108a155f2d4a99f50bf3176904208d27" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:02:47.383332837" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/flagstat/tests/tags.yml b/modules/nf-core/samtools/flagstat/tests/tags.yml new file mode 100644 index 000000000..2d2b7255e --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/flagstat: + - modules/nf-core/samtools/flagstat/** diff --git a/modules/nf-core/samtools/idxstats/environment.yml b/modules/nf-core/samtools/idxstats/environment.yml new file mode 100644 index 000000000..62054fc97 --- /dev/null +++ b/modules/nf-core/samtools/idxstats/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/idxstats/main.nf b/modules/nf-core/samtools/idxstats/main.nf new file mode 100644 index 000000000..e2bb6b20c --- /dev/null +++ b/modules/nf-core/samtools/idxstats/main.nf @@ -0,0 +1,47 @@ +process SAMTOOLS_IDXSTATS { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" + + input: + tuple val(meta), path(bam), path(bai) + + output: + tuple val(meta), path("*.idxstats"), emit: idxstats + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + samtools \\ + idxstats \\ + --threads ${task.cpus-1} \\ + $bam \\ + > ${prefix}.idxstats + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + touch ${prefix}.idxstats + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/samtools/idxstats/meta.yml b/modules/nf-core/samtools/idxstats/meta.yml new file mode 100644 index 000000000..f0a6bcb2a --- /dev/null +++ b/modules/nf-core/samtools/idxstats/meta.yml @@ -0,0 +1,55 @@ +name: samtools_idxstats +description: Reports alignment summary statistics for a BAM/CRAM/SAM file +keywords: + - stats + - mapping + - counts + - chromosome + - bam + - sam + - cram +tools: + - samtools: + description: | + SAMtools is a set of utilities for interacting with and post-processing + short DNA sequence read alignments in the SAM, BAM and CRAM formats, written by Heng Li. + These files are generated as output by short read aligners like BWA. + homepage: http://www.htslib.org/ + documentation: http://www.htslib.org/doc/samtools.html + doi: 10.1093/bioinformatics/btp352 + licence: ["MIT"] + identifier: biotools:samtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - bai: + type: file + description: Index for BAM/CRAM/SAM file + pattern: "*.{bai,crai,sai}" +output: + - idxstats: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.idxstats": + type: file + description: File containing samtools idxstats output + pattern: "*.{idxstats}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test new file mode 100644 index 000000000..5fd1fc78e --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test @@ -0,0 +1,53 @@ +nextflow_process { + + name "Test Process SAMTOOLS_IDXSTATS" + script "../main.nf" + process "SAMTOOLS_IDXSTATS" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/idxstats" + + test("bam") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("bam - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + }} diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap new file mode 100644 index 000000000..2cc89a3b8 --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap @@ -0,0 +1,72 @@ +{ + "bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,c8d7394830c3c1e5be150589571534fb" + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,c8d7394830c3c1e5be150589571534fb" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:11:56.466856235" + }, + "bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ], + "1": [ + "versions.yml:md5,c8d7394830c3c1e5be150589571534fb" + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ], + "versions": [ + "versions.yml:md5,c8d7394830c3c1e5be150589571534fb" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:11:46.311550359" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/idxstats/tests/tags.yml b/modules/nf-core/samtools/idxstats/tests/tags.yml new file mode 100644 index 000000000..d3057c61f --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/idxstats: + - modules/nf-core/samtools/idxstats/** diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml new file mode 100644 index 000000000..62054fc97 --- /dev/null +++ b/modules/nf-core/samtools/index/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf new file mode 100644 index 000000000..311756102 --- /dev/null +++ b/modules/nf-core/samtools/index/main.nf @@ -0,0 +1,49 @@ +process SAMTOOLS_INDEX { + tag "$meta.id" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" + + input: + tuple val(meta), path(input) + + output: + tuple val(meta), path("*.bai") , optional:true, emit: bai + tuple val(meta), path("*.csi") , optional:true, emit: csi + tuple val(meta), path("*.crai"), optional:true, emit: crai + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + """ + samtools \\ + index \\ + -@ ${task.cpus-1} \\ + $args \\ + $input + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + def extension = file(input).getExtension() == 'cram' ? + "crai" : args.contains("-c") ? "csi" : "bai" + """ + touch ${input}.${extension} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml new file mode 100644 index 000000000..db8df0d50 --- /dev/null +++ b/modules/nf-core/samtools/index/meta.yml @@ -0,0 +1,71 @@ +name: samtools_index +description: Index SAM/BAM/CRAM file +keywords: + - index + - bam + - sam + - cram +tools: + - samtools: + description: | + SAMtools is a set of utilities for interacting with and post-processing + short DNA sequence read alignments in the SAM, BAM and CRAM formats, written by Heng Li. + These files are generated as output by short read aligners like BWA. + homepage: http://www.htslib.org/ + documentation: http://www.htslib.org/doc/samtools.html + doi: 10.1093/bioinformatics/btp352 + licence: ["MIT"] + identifier: biotools:samtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: input file +output: + - bai: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bai": + type: file + description: BAM/CRAM/SAM index file + pattern: "*.{bai,crai,sai}" + - csi: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.csi": + type: file + description: CSI index file + pattern: "*.{csi}" + - crai: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.crai": + type: file + description: BAM/CRAM/SAM index file + pattern: "*.{bai,crai,sai}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@ewels" + - "@maxulysse" +maintainers: + - "@drpatelh" + - "@ewels" + - "@maxulysse" diff --git a/modules/nf-core/samtools/index/tests/csi.nextflow.config b/modules/nf-core/samtools/index/tests/csi.nextflow.config new file mode 100644 index 000000000..0ed260efa --- /dev/null +++ b/modules/nf-core/samtools/index/tests/csi.nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_INDEX { + ext.args = '-c' + } + +} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test new file mode 100644 index 000000000..ca34fb5cd --- /dev/null +++ b/modules/nf-core/samtools/index/tests/main.nf.test @@ -0,0 +1,140 @@ +nextflow_process { + + name "Test Process SAMTOOLS_INDEX" + script "../main.nf" + process "SAMTOOLS_INDEX" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/index" + + test("bai") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("crai") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("csi") { + config "./csi.nextflow.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.csi[0][1]).name, + process.out.versions + ).match() } + ) + } + } + + test("bai - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("crai - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("csi - stub") { + options "-stub" + config "./csi.nextflow.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap new file mode 100644 index 000000000..72d65e81a --- /dev/null +++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap @@ -0,0 +1,250 @@ +{ + "csi - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + + ], + "crai": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:21:25.261127166" + }, + "crai - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:21:12.653194876" + }, + "bai - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:21:01.854932651" + }, + "csi": { + "content": [ + "test.paired_end.sorted.bam.csi", + [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:20:51.485364222" + }, + "crai": { + "content": [ + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:20:40.518873972" + }, + "bai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ], + "crai": [ + + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,5e09a6fdf76de396728f877193d72315" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:20:21.184050361" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/index/tests/tags.yml b/modules/nf-core/samtools/index/tests/tags.yml new file mode 100644 index 000000000..e0f58a7a3 --- /dev/null +++ b/modules/nf-core/samtools/index/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/index: + - modules/nf-core/samtools/index/** diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml new file mode 100644 index 000000000..62054fc97 --- /dev/null +++ b/modules/nf-core/samtools/sort/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf new file mode 100644 index 000000000..caf3c61a8 --- /dev/null +++ b/modules/nf-core/samtools/sort/main.nf @@ -0,0 +1,72 @@ +process SAMTOOLS_SORT { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" + + input: + tuple val(meta) , path(bam) + tuple val(meta2), path(fasta) + + output: + tuple val(meta), path("*.bam"), emit: bam, optional: true + tuple val(meta), path("*.cram"), emit: cram, optional: true + tuple val(meta), path("*.crai"), emit: crai, optional: true + tuple val(meta), path("*.csi"), emit: csi, optional: true + path "versions.yml", emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def extension = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt cram") ? "cram" : + "bam" + def reference = fasta ? "--reference ${fasta}" : "" + if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + + """ + samtools cat \\ + ${bam} \\ + | \\ + samtools sort \\ + $args \\ + -T ${prefix} \\ + --threads $task.cpus \\ + ${reference} \\ + -o ${prefix}.${extension} \\ + - + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def extension = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt cram") ? "cram" : + "bam" + """ + touch ${prefix}.${extension} + if [ "${extension}" == "bam" ]; + then + touch ${prefix}.${extension}.csi + elif [ "${extension}" == "cram" ]; + then + touch ${prefix}.${extension}.crai + fi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/samtools/sort/meta.yml b/modules/nf-core/samtools/sort/meta.yml new file mode 100644 index 000000000..a9dbec5a8 --- /dev/null +++ b/modules/nf-core/samtools/sort/meta.yml @@ -0,0 +1,92 @@ +name: samtools_sort +description: Sort SAM/BAM/CRAM file +keywords: + - sort + - bam + - sam + - cram +tools: + - samtools: + description: | + SAMtools is a set of utilities for interacting with and post-processing + short DNA sequence read alignments in the SAM, BAM and CRAM formats, written by Heng Li. + These files are generated as output by short read aligners like BWA. + homepage: http://www.htslib.org/ + documentation: http://www.htslib.org/doc/samtools.html + doi: 10.1093/bioinformatics/btp352 + licence: ["MIT"] + identifier: biotools:samtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: BAM/CRAM/SAM file(s) + pattern: "*.{bam,cram,sam}" + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - fasta: + type: file + description: Reference genome FASTA file + pattern: "*.{fa,fasta,fna}" + optional: true +output: + - bam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bam": + type: file + description: Sorted BAM file + pattern: "*.{bam}" + - cram: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.cram": + type: file + description: Sorted CRAM file + pattern: "*.{cram}" + - crai: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.crai": + type: file + description: CRAM index file (optional) + pattern: "*.crai" + - csi: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.csi": + type: file + description: BAM index file (optional) + pattern: "*.csi" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@ewels" + - "@matthdsm" +maintainers: + - "@drpatelh" + - "@ewels" + - "@matthdsm" diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test new file mode 100644 index 000000000..b05e6691b --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/main.nf.test @@ -0,0 +1,192 @@ +nextflow_process { + + name "Test Process SAMTOOLS_SORT" + script "../main.nf" + process "SAMTOOLS_SORT" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/sort" + + test("bam") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + process.out.bam, + process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.versions + ).match()} + ) + } + } + + test("multiple bam") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + process.out.bam, + process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.versions + ).match()} + ) + } + } + + test("cram") { + + config "./nextflow_cram.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + process.out.cram.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.crai.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.versions + ).match()} + ) + } + } + + test("bam - stub") { + + options "-stub" + config "./nextflow.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("multiple bam - stub") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("cram - stub") { + + options "-stub" + config "./nextflow_cram.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap new file mode 100644 index 000000000..469891fe3 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap @@ -0,0 +1,287 @@ +{ + "cram": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram.crai" + ] + ], + [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:49:58.207549273" + }, + "bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:50:08.630951018" + }, + "cram - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ], + "bam": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:50:19.061912443" + }, + "multiple bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi" + ] + ], + [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.09.0" + }, + "timestamp": "2024-10-08T11:59:55.479443" + }, + "multiple bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi:md5,d185916eaff9afeb4d0aeab3310371f9" + ] + ], + "4": [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi:md5,d185916eaff9afeb4d0aeab3310371f9" + ] + ], + "versions": [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.09.0" + }, + "timestamp": "2024-10-08T11:36:13.781404" + }, + "bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,34aa85e86abefe637f7a4a9887f016fc" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi" + ] + ], + [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.09.0" + }, + "timestamp": "2024-10-08T11:59:46.372244" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/tests/nextflow.config b/modules/nf-core/samtools/sort/tests/nextflow.config new file mode 100644 index 000000000..f642771f5 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/nextflow.config @@ -0,0 +1,8 @@ +process { + + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + ext.args = "--write-index" + } + +} diff --git a/modules/nf-core/samtools/sort/tests/nextflow_cram.config b/modules/nf-core/samtools/sort/tests/nextflow_cram.config new file mode 100644 index 000000000..3a8c0188b --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/nextflow_cram.config @@ -0,0 +1,8 @@ +process { + + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + ext.args = "--write-index --output-fmt cram" + } + +} diff --git a/modules/nf-core/samtools/sort/tests/tags.yml b/modules/nf-core/samtools/sort/tests/tags.yml new file mode 100644 index 000000000..cd63ea208 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/tags.yml @@ -0,0 +1,3 @@ +samtools/sort: + - modules/nf-core/samtools/sort/** + - tests/modules/nf-core/samtools/sort/** diff --git a/modules/nf-core/samtools/stats/environment.yml b/modules/nf-core/samtools/stats/environment.yml new file mode 100644 index 000000000..62054fc97 --- /dev/null +++ b/modules/nf-core/samtools/stats/environment.yml @@ -0,0 +1,8 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf new file mode 100644 index 000000000..4443948b7 --- /dev/null +++ b/modules/nf-core/samtools/stats/main.nf @@ -0,0 +1,48 @@ +process SAMTOOLS_STATS { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" + + input: + tuple val(meta), path(input), path(input_index) + tuple val(meta2), path(fasta) + + output: + tuple val(meta), path("*.stats"), emit: stats + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def prefix = task.ext.prefix ?: "${meta.id}" + def reference = fasta ? "--reference ${fasta}" : "" + """ + samtools \\ + stats \\ + --threads ${task.cpus} \\ + ${reference} \\ + ${input} \\ + > ${prefix}.stats + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.stats + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/samtools/stats/meta.yml b/modules/nf-core/samtools/stats/meta.yml new file mode 100644 index 000000000..77b020f76 --- /dev/null +++ b/modules/nf-core/samtools/stats/meta.yml @@ -0,0 +1,66 @@ +name: samtools_stats +description: Produces comprehensive statistics from SAM/BAM/CRAM file +keywords: + - statistics + - counts + - bam + - sam + - cram +tools: + - samtools: + description: | + SAMtools is a set of utilities for interacting with and post-processing + short DNA sequence read alignments in the SAM, BAM and CRAM formats, written by Heng Li. + These files are generated as output by short read aligners like BWA. + homepage: http://www.htslib.org/ + documentation: http://www.htslib.org/doc/samtools.html + doi: 10.1093/bioinformatics/btp352 + licence: ["MIT"] + identifier: biotools:samtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM file from alignment + pattern: "*.{bam,cram}" + - input_index: + type: file + description: BAI/CRAI file from alignment + pattern: "*.{bai,crai}" + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] + - fasta: + type: file + description: Reference file the CRAM was created with (optional) + pattern: "*.{fasta,fa}" +output: + - stats: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.stats": + type: file + description: File containing samtools stats output + pattern: "*.{stats}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@FriederikeHanssen" + - "@ramprasadn" +maintainers: + - "@drpatelh" + - "@FriederikeHanssen" + - "@ramprasadn" diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test new file mode 100644 index 000000000..5bc893095 --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/main.nf.test @@ -0,0 +1,113 @@ +nextflow_process { + + name "Test Process SAMTOOLS_STATS" + script "../main.nf" + process "SAMTOOLS_STATS" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/stats" + + test("bam") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + } + + test("cram") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + } + + test("bam - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + } + + test("cram - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + } +} diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap new file mode 100644 index 000000000..df507be7a --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/main.nf.test.snap @@ -0,0 +1,142 @@ +{ + "cram": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,a27fe55e49a341f92379bb20a65c6a06" + ] + ], + "1": [ + "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,a27fe55e49a341f92379bb20a65c6a06" + ] + ], + "versions": [ + "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:29:16.767396182" + }, + "bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:29:29.721580274" + }, + "cram - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:29:53.567964304" + }, + "bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d53a2584376d78942839e9933a34d11b" + ] + ], + "1": [ + "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d53a2584376d78942839e9933a34d11b" + ] + ], + "versions": [ + "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:28:50.73610604" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/stats/tests/tags.yml b/modules/nf-core/samtools/stats/tests/tags.yml new file mode 100644 index 000000000..7c28e30f3 --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/stats: + - modules/nf-core/samtools/stats/** diff --git a/modules/nf-core/samtools/view/environment.yml b/modules/nf-core/samtools/view/environment.yml new file mode 100644 index 000000000..8cae5712d --- /dev/null +++ b/modules/nf-core/samtools/view/environment.yml @@ -0,0 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + # renovate: datasource=conda depName=bioconda/htslib + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf new file mode 100644 index 000000000..4f69a94bc --- /dev/null +++ b/modules/nf-core/samtools/view/main.nf @@ -0,0 +1,77 @@ +process SAMTOOLS_VIEW { + tag "$meta.id" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" + + input: + tuple val(meta), path(input), path(index) + tuple val(meta2), path(fasta) + path qname + + output: + tuple val(meta), path("${prefix}.bam"), emit: bam, optional: true + tuple val(meta), path("${prefix}.cram"), emit: cram, optional: true + tuple val(meta), path("${prefix}.sam"), emit: sam, optional: true + tuple val(meta), path("${prefix}.${file_type}.bai"), emit: bai, optional: true + tuple val(meta), path("${prefix}.${file_type}.csi"), emit: csi, optional: true + tuple val(meta), path("${prefix}.${file_type}.crai"), emit: crai, optional: true + tuple val(meta), path("${prefix}.unselected.${file_type}"), emit: unselected, optional: true + tuple val(meta), path("${prefix}.unselected.${file_type}.{bai,csi,crsi}"), emit: unselected_index, optional: true + path "versions.yml", emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def args2 = task.ext.args2 ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def reference = fasta ? "--reference ${fasta}" : "" + file_type = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt bam") ? "bam" : + args.contains("--output-fmt cram") ? "cram" : + input.getExtension() + readnames = qname ? "--qname-file ${qname} --output-unselected ${prefix}.unselected.${file_type}": "" + if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ + samtools \\ + view \\ + --threads ${task.cpus-1} \\ + ${reference} \\ + ${readnames} \\ + $args \\ + -o ${prefix}.${file_type} \\ + $input \\ + $args2 + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + file_type = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt bam") ? "bam" : + args.contains("--output-fmt cram") ? "cram" : + input.getExtension() + if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + + index = args.contains("--write-index") ? "touch ${prefix}.${file_type}.csi" : "" + + """ + touch ${prefix}.${file_type} + ${index} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/samtools/view/meta.yml b/modules/nf-core/samtools/view/meta.yml new file mode 100644 index 000000000..caa7b0150 --- /dev/null +++ b/modules/nf-core/samtools/view/meta.yml @@ -0,0 +1,141 @@ +name: samtools_view +description: filter/convert SAM/BAM/CRAM file +keywords: + - view + - bam + - sam + - cram +tools: + - samtools: + description: | + SAMtools is a set of utilities for interacting with and post-processing + short DNA sequence read alignments in the SAM, BAM and CRAM formats, written by Heng Li. + These files are generated as output by short read aligners like BWA. + homepage: http://www.htslib.org/ + documentation: http://www.htslib.org/doc/samtools.html + doi: 10.1093/bioinformatics/btp352 + licence: ["MIT"] + identifier: biotools:samtools +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - index: + type: file + description: BAM.BAI/BAM.CSI/CRAM.CRAI file (optional) + pattern: "*.{.bai,.csi,.crai}" + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - fasta: + type: file + description: Reference file the CRAM was created with (optional) + pattern: "*.{fasta,fa}" + - - qname: + type: file + description: Optional file with read names to output only select alignments + pattern: "*.{txt,list}" +output: + - bam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.bam: + type: file + description: optional filtered/converted BAM file + pattern: "*.{bam}" + - cram: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.cram: + type: file + description: optional filtered/converted CRAM file + pattern: "*.{cram}" + - sam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.sam: + type: file + description: optional filtered/converted SAM file + pattern: "*.{sam}" + - bai: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.${file_type}.bai: + type: file + description: optional BAM file index + pattern: "*.{bai}" + - csi: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.${file_type}.csi: + type: file + description: optional tabix BAM file index + pattern: "*.{csi}" + - crai: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.${file_type}.crai: + type: file + description: optional CRAM file index + pattern: "*.{crai}" + - unselected: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.unselected.${file_type}: + type: file + description: optional file with unselected alignments + pattern: "*.unselected.{bam,cram,sam}" + - unselected_index: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.unselected.${file_type}.{bai,csi,crsi}: + type: file + description: index for the "unselected" file + pattern: "*.unselected.{bai,csi,crai}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@joseespinosa" + - "@FriederikeHanssen" + - "@priyanka-surana" +maintainers: + - "@drpatelh" + - "@joseespinosa" + - "@FriederikeHanssen" + - "@priyanka-surana" diff --git a/modules/nf-core/samtools/view/tests/bam.config b/modules/nf-core/samtools/view/tests/bam.config new file mode 100644 index 000000000..c10d10811 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/bam.config @@ -0,0 +1,3 @@ +process { + ext.args = "--output-fmt bam" +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/bam_index.config b/modules/nf-core/samtools/view/tests/bam_index.config new file mode 100644 index 000000000..771ae033a --- /dev/null +++ b/modules/nf-core/samtools/view/tests/bam_index.config @@ -0,0 +1,3 @@ +process { + ext.args = "--output-fmt bam --write-index" +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/main.nf.test b/modules/nf-core/samtools/view/tests/main.nf.test new file mode 100644 index 000000000..37b81a916 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/main.nf.test @@ -0,0 +1,214 @@ +nextflow_process { + + name "Test Process SAMTOOLS_VIEW" + script "../main.nf" + process "SAMTOOLS_VIEW" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/view" + + test("bam") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("bam_bam") }, + { assert snapshot(process.out.bai).match("bam_bai") }, + { assert snapshot(process.out.crai).match("bam_crai") }, + { assert snapshot(process.out.cram).match("bam_cram") }, + { assert snapshot(process.out.csi).match("bam_csi") }, + { assert snapshot(process.out.sam).match("bam_sam") }, + { assert snapshot(process.out.versions).match("bam_versions") } + ) + } + } + + test("cram") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.cram[0][1]).name).match("cram_cram") }, + { assert snapshot(process.out.bai).match("cram_bai") }, + { assert snapshot(process.out.bam).match("cram_bam") }, + { assert snapshot(process.out.crai).match("cram_crai") }, + { assert snapshot(process.out.csi).match("cram_csi") }, + { assert snapshot(process.out.sam).match("cram_sam") }, + { assert snapshot(process.out.versions).match("cram_versions") } + ) + } + } + + test("cram_to_bam") { + + config "./bam.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + [] + ]) + input[1] = Channel.of([ + [ id:'genome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("cram_to_bam_bam") }, + { assert snapshot(process.out.bai).match("cram_to_bam_bai") }, + { assert snapshot(process.out.crai).match("cram_to_bam_crai") }, + { assert snapshot(process.out.cram).match("cram_to_bam_cram") }, + { assert snapshot(process.out.csi).match("cram_to_bam_csi") }, + { assert snapshot(process.out.sam).match("cram_to_bam_sam") }, + { assert snapshot(process.out.versions).match("cram_to_bam_versions") } + ) + } + } + + test("cram_to_bam_index") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + [] + ]) + input[1] = Channel.of([ + [ id:'genome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("cram_to_bam_index_bam") }, + { assert snapshot(file(process.out.csi[0][1]).name).match("cram_to_bam_index_csi") }, + { assert snapshot(process.out.bai).match("cram_to_bam_index_bai") }, + { assert snapshot(process.out.crai).match("cram_to_bam_index_crai") }, + { assert snapshot(process.out.cram).match("cram_to_bam_index_cram") }, + { assert snapshot(process.out.sam).match("cram_to_bam_index_sam") }, + { assert snapshot(process.out.versions).match("cram_to_bam_index_versions") } + ) + } + } + + test("cram_to_bam_index_qname") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + [] + ]) + input[1] = Channel.of([ + [ id:'genome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of("testN:2817", "testN:2814").collectFile(name: "readnames.list", newLine: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("cram_to_bam_index_qname_bam") }, + { assert snapshot(file(process.out.csi[0][1]).name).match("cram_to_bam_index_qname_csi") }, + { assert snapshot(process.out.bai).match("cram_to_bam_index_qname_bai") }, + { assert snapshot(process.out.crai).match("cram_to_bam_index_qname_crai") }, + { assert snapshot(process.out.cram).match("cram_to_bam_index_qname_cram") }, + { assert snapshot(process.out.sam).match("cram_to_bam_index_qname_sam") }, + { assert snapshot(file(process.out.unselected[0][1]).name).match("cram_to_bam_index_qname_unselected") }, + { assert snapshot(file(process.out.unselected_index[0][1]).name).match("cram_to_bam_index_qname_unselected_csi") }, + { assert snapshot(process.out.versions).match("cram_to_bam_index_qname_versions") } + ) + } + } + + test("bam_stub") { + + options "-stub" + config "./bam_index.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true), + [] + ]) + input[1] = [[],[]] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("bam_stub_bam") }, + { assert snapshot(file(process.out.csi[0][1]).name).match("bam_stub_csi") }, + { assert snapshot(process.out.bai).match("bam_stub_bai") }, + { assert snapshot(process.out.crai).match("bam_stub_crai") }, + { assert snapshot(process.out.cram).match("bam_stub_cram") }, + { assert snapshot(process.out.sam).match("bam_stub_sam") }, + { assert snapshot(process.out.versions).match("bam_stub_versions") } + ) + } + } +} diff --git a/modules/nf-core/samtools/view/tests/main.nf.test.snap b/modules/nf-core/samtools/view/tests/main.nf.test.snap new file mode 100644 index 000000000..63849b037 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/main.nf.test.snap @@ -0,0 +1,528 @@ +{ + "bam_bam": { + "content": [ + "test.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:51.256068" + }, + "cram_to_bam_index_csi": { + "content": [ + "test.bam.csi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:12.958617" + }, + "bam_stub_bam": { + "content": [ + "test.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:32.065301" + }, + "bam_bai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:51.258578" + }, + "bam_stub_bai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:32.071284" + }, + "bam_stub_versions": { + "content": [ + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:26:24.461775464" + }, + "cram_to_bam_index_cram": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:12.972288" + }, + "cram_to_bam_sam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:04.999247" + }, + "cram_to_bam_index_sam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:12.976457" + }, + "cram_crai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:56.497581" + }, + "cram_csi": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:56.50038" + }, + "cram_to_bam_cram": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:04.992239" + }, + "cram_to_bam_index_qname_csi": { + "content": [ + "test.bam.csi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.325496" + }, + "bam_stub_sam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:32.079529" + }, + "cram_cram": { + "content": [ + "test.cram" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:56.490286" + }, + "cram_to_bam_index_qname_unselected_csi": { + "content": [ + "test.unselected.bam.csi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.328458" + }, + "bam_csi": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:51.262882" + }, + "cram_to_bam_crai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:04.989247" + }, + "cram_to_bam_index_crai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:12.967681" + }, + "cram_to_bam_index_qname_versions": { + "content": [ + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:25:51.953436682" + }, + "cram_to_bam_bam": { + "content": [ + "test.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:04.982361" + }, + "cram_to_bam_index_bam": { + "content": [ + "test.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:12.95456" + }, + "cram_to_bam_index_versions": { + "content": [ + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:25:14.475388399" + }, + "cram_to_bam_bai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:04.98601" + }, + "cram_to_bam_versions": { + "content": [ + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:24:49.673441798" + }, + "cram_bam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:56.495512" + }, + "bam_stub_cram": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:32.076908" + }, + "cram_to_bam_index_qname_bai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.328458" + }, + "cram_to_bam_index_qname_crai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.330789" + }, + "cram_bai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:56.493129" + }, + "bam_stub_crai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:32.074313" + }, + "cram_to_bam_index_qname_bam": { + "content": [ + "test.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.322874" + }, + "cram_to_bam_index_qname_unselected": { + "content": [ + "test.unselected.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.322874" + }, + "cram_to_bam_index_qname_unselected_csi": { + "content": [ + "test.unselected.bam.csi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.328458" + }, + "bam_versions": { + "content": [ + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:23:27.151650338" + }, + "cram_to_bam_index_qname_cram": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.333248" + }, + "bam_crai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:51.259774" + }, + "bam_cram": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:51.261287" + }, + "cram_to_bam_csi": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:04.995454" + }, + "cram_sam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:56.502625" + }, + "cram_versions": { + "content": [ + [ + "versions.yml:md5,176db5ec46b965219604bcdbb3ef9e07" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T09:24:12.95416913" + }, + "cram_to_bam_index_qname_unselected": { + "content": [ + "test.unselected.bam" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.322874" + }, + "bam_sam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:37:51.264651" + }, + "cram_to_bam_index_bai": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:12.962863" + }, + "cram_to_bam_index_qname_sam": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:23.337634" + }, + "bam_stub_csi": { + "content": [ + "test.bam.csi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.04.3" + }, + "timestamp": "2024-02-12T19:38:32.068596" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/tags.yml b/modules/nf-core/samtools/view/tests/tags.yml new file mode 100644 index 000000000..4fdf1dd12 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/view: + - "modules/nf-core/samtools/view/**" diff --git a/modules/nf-core/segemehl/align/environment.yml b/modules/nf-core/segemehl/align/environment.yml new file mode 100644 index 000000000..9efa92cb8 --- /dev/null +++ b/modules/nf-core/segemehl/align/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::segemehl=0.3.4 diff --git a/modules/nf-core/segemehl/align/main.nf b/modules/nf-core/segemehl/align/main.nf new file mode 100644 index 000000000..fa829a73a --- /dev/null +++ b/modules/nf-core/segemehl/align/main.nf @@ -0,0 +1,59 @@ +process SEGEMEHL_ALIGN { + tag "$meta.id" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/segemehl:0.3.4--hc2ea5fd_5': + 'biocontainers/segemehl:0.3.4--hc2ea5fd_5' }" + + input: + tuple val(meta), path(reads) + path(fasta) + path(index) + + output: + tuple val(meta), path("${prefix}/${prefix}.${suffix}"), emit: alignment + tuple val(meta), path("${prefix}/${prefix}.trns.txt") , emit: trans_alignments, optional: true + tuple val(meta), path("${prefix}/${prefix}.mult.bed") , emit: multi_bed, optional: true + tuple val(meta), path("${prefix}/${prefix}.sngl.bed") , emit: single_bed, optional: true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def reads = meta.single_end ? "-q ${reads}" : "-q ${reads[0]} -p ${reads[1]}" + suffix = ( args.contains("-b") || args.contains("--bamabafixoida") ) ? "bam" : "sam" + """ + mkdir -p $prefix + + segemehl.x \\ + -t $task.cpus \\ + -d $fasta \\ + -i $index \\ + $reads \\ + $args \\ + -o ${prefix}/${prefix}.${suffix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + segemehl: \$(echo \$(segemehl.x 2>&1 | grep "ge5dee" | awk -F Z '{print substr(\$1, 2, 6)}' )) + END_VERSIONS + """ + + stub: + prefix = task.ext.prefix ?: "${meta.id}" + suffix = ( args.contains("-b") || args.contains("--bamabafixoida") ) ? "bam" : "sam" + """ + mkdir -p $prefix + touch ${prefix}/${prefix}.${suffix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + segemehl: \$(echo \$(segemehl.x 2>&1 | grep "ge5dee" | awk -F Z '{print substr(\$1, 2, 6)}' )) + END_VERSIONS + """ +} diff --git a/modules/nf-core/segemehl/align/meta.yml b/modules/nf-core/segemehl/align/meta.yml new file mode 100644 index 000000000..46b0084b6 --- /dev/null +++ b/modules/nf-core/segemehl/align/meta.yml @@ -0,0 +1,96 @@ +name: "segemehl_align" +description: A multi-split mapping algorithm for circular RNA, splicing, trans-splicing + and fusion detection +keywords: + - alignment + - circrna + - splicing + - fusions +tools: + - "segemehl": + description: "A multi-split mapping algorithm for circular RNA, splicing, trans-splicing + and fusion detection" + homepage: "https://www.bioinf.uni-leipzig.de/Software/segemehl/" + documentation: "https://www.bioinf.uni-leipzig.de/Software/segemehl/" + doi: "10.1186/gb-2014-15-2-r34" + licence: ["GPL v3"] + identifier: biotools:segemehl +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: FASTA or FASTQ files + pattern: "*.{fa,fasta,fq,fastq,fq.gz,fastq.gz}" + - - fasta: + type: file + description: Reference genome FASTA file used to construct Segemehl + pattern: "*.{fa,fasta}" + - - index: + type: file + description: Segemehl Index file from SEGEMEHL_INDEX + pattern: "*.idx" +output: + - alignment: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}/${prefix}.${suffix}: + type: file + description: | + File containing genomic alignments in SAM format + (please add "-b" flag to task.ext.args for BAM) + pattern: "*.{sam,bam}" + - trans_alignments: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}/${prefix}.trns.txt: + type: file + description: | + Custom text file containing all single split alignments predicted to be in trans + (optional, only if -S flag is set in task.ext.args) + pattern: "*.trns.txt" + - multi_bed: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}/${prefix}.mult.bed: + type: file + description: | + Bed file containing all splice events predicted + in the split read alignments. + (optional, only if -S flag is set in task.ext.args) + pattern: "*.mult.bed" + - single_bed: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}/${prefix}.sngl.bed: + type: file + description: | + Bed file containing all single splice events predicted + in the split read alignments. + (optional, only if -S flag is set in task.ext.args) + pattern: "*.sngl.bed" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@BarryDigby" + - "@nictru" +maintainers: + - "@nictru" diff --git a/modules/nf-core/segemehl/align/tests/main.nf.test b/modules/nf-core/segemehl/align/tests/main.nf.test new file mode 100644 index 000000000..c1b4921e7 --- /dev/null +++ b/modules/nf-core/segemehl/align/tests/main.nf.test @@ -0,0 +1,140 @@ +nextflow_process { + + name "Test Process SEGEMEHL_ALIGN" + script "../main.nf" + process "SEGEMEHL_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "segemehl" + tag "segemehl/align" + tag "segemehl/index" + + setup { + run("SEGEMEHL_INDEX") { + script "../../../segemehl/index/main.nf" + process { + """ + input[0] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + } + + test("homo_sapiens - single_end") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = SEGEMEHL_INDEX.out.index + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.alignment[0][1]).exists() }, + { assert snapshot(process.out.versions).match("homo_sapiens - single_end - versions") } + ) + } + } + + test("homo_sapiens - paired_end") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = SEGEMEHL_INDEX.out.index + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.alignment[0][1]).exists() }, + { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - versions") } + ) + } + } + + test("homo_sapiens - split - single_end") { + config "./split.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = SEGEMEHL_INDEX.out.index + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.alignment[0][1]).exists() }, + { assert path(process.out.trans_alignments[0][1]).exists() }, + { assert path(process.out.multi_bed[0][1]).exists() }, + { assert path(process.out.single_bed[0][1]).exists() }, + { assert snapshot(process.out.versions).match("homo_sapiens - split - single_end - versions") } + ) + } + } + + test("homo_sapiens - split - paired_end") { + config "./split.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = SEGEMEHL_INDEX.out.index + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.alignment[0][1]).exists() }, + { assert path(process.out.trans_alignments[0][1]).exists() }, + { assert path(process.out.multi_bed[0][1]).exists() }, + { assert path(process.out.single_bed[0][1]).exists() }, + { assert snapshot(process.out.versions).match("homo_sapiens - split - paired_end - versions") } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/segemehl/align/tests/main.nf.test.snap b/modules/nf-core/segemehl/align/tests/main.nf.test.snap new file mode 100644 index 000000000..c914bc3d1 --- /dev/null +++ b/modules/nf-core/segemehl/align/tests/main.nf.test.snap @@ -0,0 +1,50 @@ +{ + "homo_sapiens - paired_end - versions": { + "content": [ + [ + "versions.yml:md5,0c6afcd6ae65e27a0ea87f5b42c853eb" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-05-30T12:58:05.434115758" + }, + "homo_sapiens - single_end - versions": { + "content": [ + [ + "versions.yml:md5,0c6afcd6ae65e27a0ea87f5b42c853eb" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-05-30T12:57:56.488707635" + }, + "homo_sapiens - split - single_end - versions": { + "content": [ + [ + "versions.yml:md5,0c6afcd6ae65e27a0ea87f5b42c853eb" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-05-30T13:06:11.217385877" + }, + "homo_sapiens - split - paired_end - versions": { + "content": [ + [ + "versions.yml:md5,0c6afcd6ae65e27a0ea87f5b42c853eb" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-05-30T13:06:29.757385118" + } +} \ No newline at end of file diff --git a/modules/nf-core/segemehl/align/tests/split.config b/modules/nf-core/segemehl/align/tests/split.config new file mode 100644 index 000000000..d4f6aab83 --- /dev/null +++ b/modules/nf-core/segemehl/align/tests/split.config @@ -0,0 +1,5 @@ +process{ + withName: SEGEMEHL_ALIGN { + ext.args = "-S" + } +} \ No newline at end of file diff --git a/modules/nf-core/segemehl/align/tests/tags.yml b/modules/nf-core/segemehl/align/tests/tags.yml new file mode 100644 index 000000000..6e7bf26ee --- /dev/null +++ b/modules/nf-core/segemehl/align/tests/tags.yml @@ -0,0 +1,2 @@ +segemehl/align: + - modules/nf-core/segemehl/align/** diff --git a/modules/nf-core/segemehl/index/environment.yml b/modules/nf-core/segemehl/index/environment.yml new file mode 100644 index 000000000..9efa92cb8 --- /dev/null +++ b/modules/nf-core/segemehl/index/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::segemehl=0.3.4 diff --git a/modules/nf-core/segemehl/index/main.nf b/modules/nf-core/segemehl/index/main.nf new file mode 100644 index 000000000..ea912c6ef --- /dev/null +++ b/modules/nf-core/segemehl/index/main.nf @@ -0,0 +1,46 @@ +process SEGEMEHL_INDEX { + tag "$fasta" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/segemehl:0.3.4--hc2ea5fd_5': + 'biocontainers/segemehl:0.3.4--hc2ea5fd_5' }" + + input: + path fasta + + output: + path "*.idx", emit: index + path "versions.yml", emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = "${fasta.baseName}" + """ + segemehl.x \\ + -t $task.cpus \\ + -d $fasta \\ + -x ${prefix}.idx \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + segemehl: \$(echo \$(segemehl.x 2>&1 | grep "ge5dee" | awk -F Z '{print substr(\$1, 2, 6)}' )) + END_VERSIONS + """ + + stub: + def prefix = "${fasta.baseName}" + """ + touch ${prefix}.idx + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + segemehl: \$(echo \$(segemehl.x 2>&1 | grep "ge5dee" | awk -F Z '{print substr(\$1, 2, 6)}' )) + END_VERSIONS + """ +} diff --git a/modules/nf-core/segemehl/index/meta.yml b/modules/nf-core/segemehl/index/meta.yml new file mode 100644 index 000000000..d6c1d983f --- /dev/null +++ b/modules/nf-core/segemehl/index/meta.yml @@ -0,0 +1,36 @@ +name: "segemehl_index" +description: Generate genome indices for segemehl align +keywords: + - index + - circrna + - splicing + - fusions +tools: + - "segemehl": + description: "A multi-split mapping algorithm for circular RNA, splicing, trans-splicing + and fusion detection" + homepage: "https://www.bioinf.uni-leipzig.de/Software/segemehl/" + documentation: "https://www.bioinf.uni-leipzig.de/Software/segemehl/" + doi: "10.1186/gb-2014-15-2-r34" + licence: ["GPL v3"] + identifier: biotools:segemehl +input: + - - fasta: + type: file + description: Reference genome FASTA file + pattern: "*.{fa,fasta}" +output: + - index: + - "*.idx": + type: file + description: Segemehl index file + pattern: "*.{idx}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@BarryDigby" +maintainers: + - "@BarryDigby" diff --git a/modules/nf-core/segemehl/index/tests/main.nf.test b/modules/nf-core/segemehl/index/tests/main.nf.test new file mode 100644 index 000000000..fd6e8f29f --- /dev/null +++ b/modules/nf-core/segemehl/index/tests/main.nf.test @@ -0,0 +1,51 @@ + +nextflow_process { + + name "Test Process SEGEMEHL_INDEX" + script "../main.nf" + process "SEGEMEHL_INDEX" + + tag "modules" + tag "modules_nfcore" + tag "segemehl" + tag "segemehl/index" + + test("test-segemehl-index") { + + when { + process { + """ + input[0] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test-segemehl-index-stub") { + options '-stub' + when { + process { + """ + input[0] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/segemehl/index/tests/main.nf.test.snap b/modules/nf-core/segemehl/index/tests/main.nf.test.snap new file mode 100644 index 000000000..bfa7722ac --- /dev/null +++ b/modules/nf-core/segemehl/index/tests/main.nf.test.snap @@ -0,0 +1,48 @@ +{ + "test-segemehl-index-stub": { + "content": [ + { + "0": [ + "genome.idx:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "1": [ + "versions.yml:md5,76eb929943ccee1b62861cad308a8134" + ], + "index": [ + "genome.idx:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "versions": [ + "versions.yml:md5,76eb929943ccee1b62861cad308a8134" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-27T13:29:45.186954" + }, + "test-segemehl-index": { + "content": [ + { + "0": [ + "genome.idx:md5,56e4f41aa2cdcded4195750c1a6fd352" + ], + "1": [ + "versions.yml:md5,76eb929943ccee1b62861cad308a8134" + ], + "index": [ + "genome.idx:md5,56e4f41aa2cdcded4195750c1a6fd352" + ], + "versions": [ + "versions.yml:md5,76eb929943ccee1b62861cad308a8134" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-27T13:29:40.984698" + } +} \ No newline at end of file diff --git a/modules/nf-core/star/align/environment.yml b/modules/nf-core/star/align/environment.yml new file mode 100644 index 000000000..91e37ae12 --- /dev/null +++ b/modules/nf-core/star/align/environment.yml @@ -0,0 +1,11 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda + +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 + - bioconda::star=2.7.11b + - conda-forge::gawk=5.1.0 diff --git a/modules/nf-core/star/align/main.nf b/modules/nf-core/star/align/main.nf new file mode 100644 index 000000000..22a52184d --- /dev/null +++ b/modules/nf-core/star/align/main.nf @@ -0,0 +1,111 @@ +process STAR_ALIGN { + tag "$meta.id" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/26/268b4c9c6cbf8fa6606c9b7fd4fafce18bf2c931d1a809a0ce51b105ec06c89d/data' : + 'community.wave.seqera.io/library/htslib_samtools_star_gawk:ae438e9a604351a4' }" + + input: + tuple val(meta), path(reads, stageAs: "input*/*") + tuple val(meta2), path(index) + tuple val(meta3), path(gtf) + val star_ignore_sjdbgtf + val seq_platform + val seq_center + + output: + tuple val(meta), path('*Log.final.out') , emit: log_final + tuple val(meta), path('*Log.out') , emit: log_out + tuple val(meta), path('*Log.progress.out'), emit: log_progress + path "versions.yml" , emit: versions + + tuple val(meta), path('*d.out.bam') , optional:true, emit: bam + tuple val(meta), path("${prefix}.sortedByCoord.out.bam") , optional:true, emit: bam_sorted + tuple val(meta), path("${prefix}.Aligned.sortedByCoord.out.bam") , optional:true, emit: bam_sorted_aligned + tuple val(meta), path('*toTranscriptome.out.bam') , optional:true, emit: bam_transcript + tuple val(meta), path('*Aligned.unsort.out.bam') , optional:true, emit: bam_unsorted + tuple val(meta), path('*fastq.gz') , optional:true, emit: fastq + tuple val(meta), path('*.tab') , optional:true, emit: tab + tuple val(meta), path('*.SJ.out.tab') , optional:true, emit: spl_junc_tab + tuple val(meta), path('*.ReadsPerGene.out.tab') , optional:true, emit: read_per_gene_tab + tuple val(meta), path('*.out.junction') , optional:true, emit: junction + tuple val(meta), path('*.out.sam') , optional:true, emit: sam + tuple val(meta), path('*.wig') , optional:true, emit: wig + tuple val(meta), path('*.bg') , optional:true, emit: bedgraph + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def reads1 = [] + def reads2 = [] + meta.single_end ? [reads].flatten().each{reads1 << it} : reads.eachWithIndex{ v, ix -> ( ix & 1 ? reads2 : reads1) << v } + def ignore_gtf = star_ignore_sjdbgtf ? '' : "--sjdbGTFfile $gtf" + def seq_platform_arg = seq_platform ? "'PL:$seq_platform'" : "" + def seq_center_arg = seq_center ? "'CN:$seq_center'" : "" + attrRG = args.contains("--outSAMattrRGline") ? "" : "--outSAMattrRGline 'ID:$prefix' $seq_center_arg 'SM:$prefix' $seq_platform_arg" + def out_sam_type = (args.contains('--outSAMtype')) ? '' : '--outSAMtype BAM Unsorted' + mv_unsorted_bam = (args.contains('--outSAMtype BAM Unsorted SortedByCoordinate')) ? "mv ${prefix}.Aligned.out.bam ${prefix}.Aligned.unsort.out.bam" : '' + """ + STAR \\ + --genomeDir $index \\ + --readFilesIn ${reads1.join(",")} ${reads2.join(",")} \\ + --runThreadN $task.cpus \\ + --outFileNamePrefix $prefix. \\ + $out_sam_type \\ + $ignore_gtf \\ + $attrRG \\ + $args + + $mv_unsorted_bam + + if [ -f ${prefix}.Unmapped.out.mate1 ]; then + mv ${prefix}.Unmapped.out.mate1 ${prefix}.unmapped_1.fastq + gzip ${prefix}.unmapped_1.fastq + fi + if [ -f ${prefix}.Unmapped.out.mate2 ]; then + mv ${prefix}.Unmapped.out.mate2 ${prefix}.unmapped_2.fastq + gzip ${prefix}.unmapped_2.fastq + fi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') + END_VERSIONS + """ + + stub: + prefix = task.ext.prefix ?: "${meta.id}" + """ + echo "" | gzip > ${prefix}.unmapped_1.fastq.gz + echo "" | gzip > ${prefix}.unmapped_2.fastq.gz + touch ${prefix}Xd.out.bam + touch ${prefix}.Log.final.out + touch ${prefix}.Log.out + touch ${prefix}.Log.progress.out + touch ${prefix}.sortedByCoord.out.bam + touch ${prefix}.toTranscriptome.out.bam + touch ${prefix}.Aligned.unsort.out.bam + touch ${prefix}.Aligned.sortedByCoord.out.bam + touch ${prefix}.tab + touch ${prefix}.SJ.out.tab + touch ${prefix}.ReadsPerGene.out.tab + touch ${prefix}.Chimeric.out.junction + touch ${prefix}.out.sam + touch ${prefix}.Signal.UniqueMultiple.str1.out.wig + touch ${prefix}.Signal.UniqueMultiple.str1.out.bg + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/star/align/meta.yml b/modules/nf-core/star/align/meta.yml new file mode 100644 index 000000000..5cfe763e3 --- /dev/null +++ b/modules/nf-core/star/align/meta.yml @@ -0,0 +1,230 @@ +name: star_align +description: Align reads to a reference genome using STAR +keywords: + - align + - fasta + - genome + - reference +tools: + - star: + description: | + STAR is a software package for mapping DNA sequences against + a large reference genome, such as the human genome. + homepage: https://github.com/alexdobin/STAR + manual: https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf + doi: 10.1093/bioinformatics/bts635 + licence: ["MIT"] + identifier: biotools:star +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - index: + type: directory + description: STAR genome index + pattern: "star" + - - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - gtf: + type: file + description: Annotation GTF file + pattern: "*.{gtf}" + - - star_ignore_sjdbgtf: + type: boolean + description: Ignore annotation GTF file + - - seq_platform: + type: string + description: Sequencing platform + - - seq_center: + type: string + description: Sequencing center +output: + - log_final: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*Log.final.out": + type: file + description: STAR final log file + pattern: "*Log.final.out" + - log_out: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*Log.out": + type: file + description: STAR lot out file + pattern: "*Log.out" + - log_progress: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*Log.progress.out": + type: file + description: STAR log progress file + pattern: "*Log.progress.out" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" + - bam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*d.out.bam": + type: file + description: Output BAM file containing read alignments + pattern: "*.{bam}" + - bam_sorted: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.sortedByCoord.out.bam: + type: file + description: Sorted BAM file of read alignments (optional) + pattern: "*sortedByCoord.out.bam" + - bam_sorted_aligned: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${prefix}.Aligned.sortedByCoord.out.bam: + type: file + description: Sorted BAM file of read alignments (optional) + pattern: "*.Aligned.sortedByCoord.out.bam" + - bam_transcript: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*toTranscriptome.out.bam": + type: file + description: Output BAM file of transcriptome alignment (optional) + pattern: "*toTranscriptome.out.bam" + - bam_unsorted: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*Aligned.unsort.out.bam": + type: file + description: Unsorted BAM file of read alignments (optional) + pattern: "*Aligned.unsort.out.bam" + - fastq: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*fastq.gz": + type: file + description: Unmapped FastQ files (optional) + pattern: "*fastq.gz" + - tab: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.tab": + type: file + description: STAR output tab file(s) (optional) + pattern: "*.tab" + - spl_junc_tab: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.SJ.out.tab": + type: file + description: STAR output splice junction tab file + pattern: "*.SJ.out.tab" + - read_per_gene_tab: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.ReadsPerGene.out.tab": + type: file + description: STAR output read per gene tab file + pattern: "*.ReadsPerGene.out.tab" + - junction: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.out.junction": + type: file + description: STAR chimeric junction output file (optional) + pattern: "*.out.junction" + - sam: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*.out.sam" + - "*.out.sam": + type: file + description: STAR output SAM file(s) (optional) + pattern: "*.out.sam" + - wig: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.wig": + type: file + description: STAR output wiggle format file(s) (optional) + pattern: "*.wig" + - bedgraph: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bg": + type: file + description: STAR output bedGraph format file(s) (optional) + pattern: "*.bg" +authors: + - "@kevinmenden" + - "@drpatelh" + - "@praveenraj2018" +maintainers: + - "@kevinmenden" + - "@drpatelh" + - "@praveenraj2018" diff --git a/modules/nf-core/star/align/tests/main.nf.test b/modules/nf-core/star/align/tests/main.nf.test new file mode 100644 index 000000000..a62c17db0 --- /dev/null +++ b/modules/nf-core/star/align/tests/main.nf.test @@ -0,0 +1,593 @@ +nextflow_process { + + name "Test Process STAR_ALIGN" + script "../main.nf" + process "STAR_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "star" + tag "star/align" + tag "star/genomegenerate" + + test("homo_sapiens - single_end") { + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + bam(process.out.bam[0][1]).getReadsMD5(), + bam(process.out.bam_sorted_aligned[0][1]).getReadsMD5(), + process.out.bedgraph, + process.out.fastq, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end") { + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + bam(process.out.bam[0][1]).getReadsMD5(), + bam(process.out.bam_sorted_aligned[0][1]).getReadsMD5(), + process.out.bedgraph, + process.out.fastq, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - arriba") { + config "./nextflow.arriba.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.bedgraph, + process.out.fastq, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - starfusion") { + config "./nextflow.starfusion.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + file(process.out.junction[0][1]).name, + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.bedgraph, + process.out.fastq, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - multiple") { + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + bam(process.out.bam[0][1]).getReadsMD5(), + bam(process.out.bam_sorted_aligned[0][1]).getReadsMD5(), + process.out.bedgraph, + process.out.fastq, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - single_end - stub") { + options "-stub" + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens - paired_end - stub") { + options "-stub" + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens - paired_end - arriba - stub") { + options "-stub" + config "./nextflow.arriba.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens - paired_end - starfusion - stub") { + options "-stub" + config "./nextflow.starfusion.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens - paired_end - multiple - stub") { + options "-stub" + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/star/align/tests/main.nf.test.snap b/modules/nf-core/star/align/tests/main.nf.test.snap new file mode 100644 index 000000000..a1ec3a3d0 --- /dev/null +++ b/modules/nf-core/star/align/tests/main.nf.test.snap @@ -0,0 +1,1913 @@ +{ + "homo_sapiens - single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": true + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": true + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "16": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": true + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_sorted_aligned": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": true + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": true + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "wig": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:28:39.242074494" + }, + "homo_sapiens - paired_end - arriba - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "16": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_sorted_aligned": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "wig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:29:08.392620556" + }, + "homo_sapiens - single_end": { + "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", + "9f76be49a6607613a64f760101bdddce", + "9f76be49a6607613a64f760101bdddce", + [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Signal.Unique.str1.out.bg:md5,c56fc1472776fb927eaf62d973da5f9a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,e93373cf6f2a2a9506e2efdb260cdd4f" + ] + ] + ], + [ + + ], + [ + + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" + ] + ], + [ + + ], + [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:21:34.549483887" + }, + "homo_sapiens - paired_end": { + "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", + "db9a8324b5163b025bcc0c33e848486", + "db9a8324b5163b025bcc0c33e848486", + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6" + ] + ] + ], + [ + + ], + [ + + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + ] + ], + [ + + ], + [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:22:17.011253146" + }, + "homo_sapiens - paired_end - multiple - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "16": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_sorted_aligned": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "wig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:29:31.072104862" + }, + "homo_sapiens - paired_end - multiple": { + "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", + "3e54e45f5dc3e9c1f2fc55bc41531a87", + "3e54e45f5dc3e9c1f2fc55bc41531a87", + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6" + ] + ] + ], + [ + + ], + [ + + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" + ] + ], + [ + + ], + [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:28:26.645008336" + }, + "homo_sapiens - paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "16": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_sorted_aligned": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "wig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:28:53.816280805" + }, + "homo_sapiens - paired_end - starfusion": { + "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", + "test.Chimeric.out.junction", + "caee9dcda13882d4913456973c25b57a", + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" + ] + ], + [ + + ], + [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:27:14.136111964" + }, + "homo_sapiens - paired_end - arriba": { + "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", + "1a3abe88fb2490589c58497d39921bcc", + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" + ] + ], + [ + + ], + [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:24:00.829462526" + }, + "homo_sapiens - paired_end - starfusion - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "16": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_sorted_aligned": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,b416145d7b5b8a080e832a7f7cde4c44" + ], + "wig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:29:20.015372487" + } +} \ No newline at end of file diff --git a/modules/nf-core/star/align/tests/nextflow.arriba.config b/modules/nf-core/star/align/tests/nextflow.arriba.config new file mode 100644 index 000000000..cf09323fc --- /dev/null +++ b/modules/nf-core/star/align/tests/nextflow.arriba.config @@ -0,0 +1,11 @@ +process { + + withName: STAR_GENOMEGENERATE { + ext.args = '--genomeSAindexNbases 9' + } + + withName: STAR_ALIGN { + ext.args = '--readFilesCommand zcat --outSAMtype BAM Unsorted --outSAMunmapped Within --outBAMcompression 0 --outFilterMultimapNmax 50 --peOverlapNbasesMin 10 --alignSplicedMateMapLminOverLmate 0.5 --alignSJstitchMismatchNmax 5 -1 5 5 --chimSegmentMin 10 --chimOutType WithinBAM HardClip --chimJunctionOverhangMin 10 --chimScoreDropMax 30 --chimScoreJunctionNonGTAG 0 --chimScoreSeparation 1 --chimSegmentReadGapMax 3 --chimMultimapNmax 50' + } + +} diff --git a/modules/nf-core/star/align/tests/nextflow.config b/modules/nf-core/star/align/tests/nextflow.config new file mode 100644 index 000000000..18bc2ee8a --- /dev/null +++ b/modules/nf-core/star/align/tests/nextflow.config @@ -0,0 +1,11 @@ +process { + + withName: STAR_GENOMEGENERATE { + ext.args = '--genomeSAindexNbases 9' + } + + withName: STAR_ALIGN { + ext.args = '--readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --outWigType bedGraph --outWigStrand Unstranded' + } + +} diff --git a/modules/nf-core/star/align/tests/nextflow.starfusion.config b/modules/nf-core/star/align/tests/nextflow.starfusion.config new file mode 100644 index 000000000..7880bfcf5 --- /dev/null +++ b/modules/nf-core/star/align/tests/nextflow.starfusion.config @@ -0,0 +1,11 @@ +process { + + withName: STAR_GENOMEGENERATE { + ext.args = '--genomeSAindexNbases 9' + } + + withName: STAR_ALIGN { + ext.args = '--readFilesCommand zcat --outSAMtype BAM Unsorted --outReadsUnmapped None --twopassMode Basic --outSAMstrandField intronMotif --outSAMunmapped Within --chimSegmentMin 12 --chimJunctionOverhangMin 8 --chimOutJunctionFormat 1 --alignSJDBoverhangMin 10 --alignMatesGapMax 100000 --alignIntronMax 100000 --alignSJstitchMismatchNmax 5 -1 5 5 --chimMultimapScoreRange 3 --chimScoreJunctionNonGTAG -4 --chimMultimapNmax 20 --chimNonchimScoreDropMin 10 --peOverlapNbasesMin 12 --peOverlapMMp 0.1 --alignInsertionFlush Right --alignSplicedMateMapLminOverLmate 0 --alignSplicedMateMapLmin 30' + } + +} diff --git a/modules/nf-core/star/align/tests/tags.yml b/modules/nf-core/star/align/tests/tags.yml new file mode 100644 index 000000000..8beace16e --- /dev/null +++ b/modules/nf-core/star/align/tests/tags.yml @@ -0,0 +1,2 @@ +star/align: + - modules/nf-core/star/align/** diff --git a/modules/nf-core/star/genomegenerate/environment.yml b/modules/nf-core/star/genomegenerate/environment.yml new file mode 100644 index 000000000..91e37ae12 --- /dev/null +++ b/modules/nf-core/star/genomegenerate/environment.yml @@ -0,0 +1,11 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda + +dependencies: + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 + - bioconda::star=2.7.11b + - conda-forge::gawk=5.1.0 diff --git a/modules/nf-core/star/genomegenerate/main.nf b/modules/nf-core/star/genomegenerate/main.nf new file mode 100644 index 000000000..4eb95654b --- /dev/null +++ b/modules/nf-core/star/genomegenerate/main.nf @@ -0,0 +1,119 @@ +process STAR_GENOMEGENERATE { + tag "$fasta" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/26/268b4c9c6cbf8fa6606c9b7fd4fafce18bf2c931d1a809a0ce51b105ec06c89d/data' : + 'community.wave.seqera.io/library/htslib_samtools_star_gawk:ae438e9a604351a4' }" + + input: + tuple val(meta), path(fasta) + tuple val(meta2), path(gtf) + + output: + tuple val(meta), path("star") , emit: index + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def args_list = args.tokenize() + def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : '' + def include_gtf = gtf ? "--sjdbGTFfile $gtf" : '' + if (args_list.contains('--genomeSAindexNbases')) { + """ + mkdir star + STAR \\ + --runMode genomeGenerate \\ + --genomeDir star/ \\ + --genomeFastaFiles $fasta \\ + $include_gtf \\ + --runThreadN $task.cpus \\ + $memory \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') + END_VERSIONS + """ + } else { + """ + samtools faidx $fasta + NUM_BASES=`gawk '{sum = sum + \$2}END{if ((log(sum)/log(2))/2 - 1 > 14) {printf "%.0f", 14} else {printf "%.0f", (log(sum)/log(2))/2 - 1}}' ${fasta}.fai` + + mkdir star + STAR \\ + --runMode genomeGenerate \\ + --genomeDir star/ \\ + --genomeFastaFiles $fasta \\ + $include_gtf \\ + --runThreadN $task.cpus \\ + --genomeSAindexNbases \$NUM_BASES \\ + $memory \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') + END_VERSIONS + """ + } + + stub: + if (gtf) { + """ + mkdir star + touch star/Genome + touch star/Log.out + touch star/SA + touch star/SAindex + touch star/chrLength.txt + touch star/chrName.txt + touch star/chrNameLength.txt + touch star/chrStart.txt + touch star/exonGeTrInfo.tab + touch star/exonInfo.tab + touch star/geneInfo.tab + touch star/genomeParameters.txt + touch star/sjdbInfo.txt + touch star/sjdbList.fromGTF.out.tab + touch star/sjdbList.out.tab + touch star/transcriptInfo.tab + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') + END_VERSIONS + """ + } else { + """ + mkdir star + touch star/Genome + touch star/Log.out + touch star/SA + touch star/SAindex + touch star/chrLength.txt + touch star/chrName.txt + touch star/chrNameLength.txt + touch star/chrStart.txt + touch star/genomeParameters.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') + END_VERSIONS + """ + } +} diff --git a/modules/nf-core/star/genomegenerate/meta.yml b/modules/nf-core/star/genomegenerate/meta.yml new file mode 100644 index 000000000..33c1f65f3 --- /dev/null +++ b/modules/nf-core/star/genomegenerate/meta.yml @@ -0,0 +1,56 @@ +name: star_genomegenerate +description: Create index for STAR +keywords: + - index + - fasta + - genome + - reference +tools: + - star: + description: | + STAR is a software package for mapping DNA sequences against + a large reference genome, such as the human genome. + homepage: https://github.com/alexdobin/STAR + manual: https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf + doi: 10.1093/bioinformatics/bts635 + licence: ["MIT"] + identifier: biotools:star +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Fasta file of the reference genome + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - gtf: + type: file + description: GTF file of the reference genome +output: + - index: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - star: + type: directory + description: Folder containing the star index files + pattern: "star" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@kevinmenden" + - "@drpatelh" +maintainers: + - "@kevinmenden" + - "@drpatelh" diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test b/modules/nf-core/star/genomegenerate/tests/main.nf.test new file mode 100644 index 000000000..4d619c473 --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test @@ -0,0 +1,114 @@ +nextflow_process { + + name "Test Process STAR_GENOMEGENERATE" + script "../main.nf" + process "STAR_GENOMEGENERATE" + tag "modules" + tag "modules_nfcore" + tag "star" + tag "star/genomegenerate" + + test("fasta_gtf") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(), + process.out.versions) + .match() } + ) + } + } + + test("fasta") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ [], [] ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(), + process.out.versions + ).match() } + ) + } + } + + test("fasta_gtf_stub") { + + options '-stub' + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("fasta_stub") { + + options '-stub' + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ [], [] ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap new file mode 100644 index 000000000..b79da991d --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap @@ -0,0 +1,148 @@ +{ + "fasta_gtf": { + "content": [ + "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, exonGeTrInfo.tab, exonInfo.tab, geneInfo.tab, genomeParameters.txt, sjdbInfo.txt, sjdbList.fromGTF.out.tab, sjdbList.out.tab, transcriptInfo.tab]", + [ + "versions.yml:md5,0c6c5fab50cc8601f9072268a2f49aad" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:29:40.748676908" + }, + "fasta_gtf_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,0c6c5fab50cc8601f9072268a2f49aad" + ], + "index": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,0c6c5fab50cc8601f9072268a2f49aad" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:30:11.024076742" + }, + "fasta_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,0c6c5fab50cc8601f9072268a2f49aad" + ], + "index": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,0c6c5fab50cc8601f9072268a2f49aad" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:30:22.674364031" + }, + "fasta": { + "content": [ + "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, genomeParameters.txt]", + [ + "versions.yml:md5,0c6c5fab50cc8601f9072268a2f49aad" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.2" + }, + "timestamp": "2024-12-11T16:29:57.958812354" + } +} \ No newline at end of file diff --git a/modules/nf-core/star/genomegenerate/tests/tags.yml b/modules/nf-core/star/genomegenerate/tests/tags.yml new file mode 100644 index 000000000..79f619bfe --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/tags.yml @@ -0,0 +1,2 @@ +star/genomegenerate: + - modules/nf-core/star/genomegenerate/** diff --git a/modules/nf-core/stringtie/stringtie/environment.yml b/modules/nf-core/stringtie/stringtie/environment.yml new file mode 100644 index 000000000..a51985b4f --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::stringtie=2.2.3 diff --git a/modules/nf-core/stringtie/stringtie/main.nf b/modules/nf-core/stringtie/stringtie/main.nf new file mode 100644 index 000000000..4635c8c5b --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/main.nf @@ -0,0 +1,68 @@ +process STRINGTIE_STRINGTIE { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/stringtie:2.2.3--h43eeafb_0' : + 'biocontainers/stringtie:2.2.3--h43eeafb_0' }" + + input: + tuple val(meta), path(bam) + path annotation_gtf + + output: + tuple val(meta), path("*.transcripts.gtf"), emit: transcript_gtf + tuple val(meta), path("*.abundance.txt") , emit: abundance + tuple val(meta), path("*.coverage.gtf") , optional: true, emit: coverage_gtf + tuple val(meta), path("*.ballgown") , optional: true, emit: ballgown + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def reference = annotation_gtf ? "-G $annotation_gtf" : "" + def ballgown = annotation_gtf ? "-b ${prefix}.ballgown" : "" + def coverage = annotation_gtf ? "-C ${prefix}.coverage.gtf" : "" + + def strandedness = '' + if (meta.strandedness == 'forward') { + strandedness = '--fr' + } else if (meta.strandedness == 'reverse') { + strandedness = '--rf' + } + """ + stringtie \\ + $bam \\ + $strandedness \\ + $reference \\ + -o ${prefix}.transcripts.gtf \\ + -A ${prefix}.gene.abundance.txt \\ + $coverage \\ + $ballgown \\ + -p $task.cpus \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + stringtie: \$(stringtie --version 2>&1) + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.transcripts.gtf + touch ${prefix}.gene.abundance.txt + touch ${prefix}.coverage.gtf + touch ${prefix}.ballgown + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + stringtie: \$(stringtie --version 2>&1) + END_VERSIONS + """ +} diff --git a/modules/nf-core/stringtie/stringtie/meta.yml b/modules/nf-core/stringtie/stringtie/meta.yml new file mode 100644 index 000000000..e55b2abfc --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/meta.yml @@ -0,0 +1,79 @@ +name: stringtie_stringtie +description: Transcript assembly and quantification for RNA-Se +keywords: + - transcript + - assembly + - quantification + - gtf +tools: + - stringtie2: + description: | + Transcript assembly and quantification for RNA-Seq + homepage: https://ccb.jhu.edu/software/stringtie/index.shtml + documentation: https://ccb.jhu.edu/software/stringtie/index.shtml?t=manual + licence: ["MIT"] + identifier: biotools:stringtie +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: | + Stringtie transcript gtf output(s). + - - annotation_gtf: + type: file + description: | + Annotation gtf file (optional). +output: + - transcript_gtf: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.transcripts.gtf": + type: file + description: transcript gtf + pattern: "*.{transcripts.gtf}" + - abundance: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.abundance.txt": + type: file + description: abundance + pattern: "*.{abundance.txt}" + - coverage_gtf: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.coverage.gtf": + type: file + description: coverage gtf + pattern: "*.{coverage.gtf}" + - ballgown: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.ballgown": + type: file + description: for running ballgown + pattern: "*.{ballgown}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/stringtie/stringtie/tests/main.nf.test b/modules/nf-core/stringtie/stringtie/tests/main.nf.test new file mode 100644 index 000000000..2204e849f --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/tests/main.nf.test @@ -0,0 +1,213 @@ +nextflow_process { + + name "Test Process STRINGTIE_STRINGTIE" + script "../main.nf" + process "STRINGTIE_STRINGTIE" + config "./nextflow.config" + tag "modules" + tag "modules_nfcore" + tag "stringtie" + tag "stringtie/stringtie" + + test("sarscov2 [bam] - forward strandedness") { + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.abundance, + process.out.transcript_gtf, + process.out.versions + ).match() } + ) + } + } + + test("sarscov2 [bam] - forward strandedness + reference annotation") { + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.abundance, + process.out.ballgown, + process.out.transcript_gtf, + process.out.versions + ).match() } + ) + } + } + + test("sarscov2 [bam] - reverse strandedness") { + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.abundance, + process.out.transcript_gtf, + process.out.versions + ).match() } + ) + } + } + + test("sarscov2 [bam] - reverse strandedness + reference annotation") { + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.abundance, + process.out.ballgown, + process.out.transcript_gtf, + process.out.versions + ).match() } + ) + } + } + + test("sarscov2 [bam] - forward strandedness - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 [bam] - forward strandedness + reference annotation - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 [bam] - reverse strandedness - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 [bam] - reverse strandedness + reference annotation - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap b/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap new file mode 100644 index 000000000..d4645de3e --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap @@ -0,0 +1,508 @@ +{ + "sarscov2 [bam] - forward strandedness + reference annotation": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,7d8bce7f2a922e367cedccae7267c22e" + ] + ], + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + [ + "e2t.ctab:md5,e981c0038295ae54b63cedb1083f1540", + "e_data.ctab:md5,6b4cf69bc03f3f69890f972a0e8b7471", + "i2t.ctab:md5,8a117c8aa4334b4c2d4711932b006fb4", + "i_data.ctab:md5,be3abe09740603213f83d50dcf81427f", + "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818" + ] + ] + ], + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,37154e7bda96544f24506ee902bb561d" + ] + ], + [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T09:56:50.294157199" + }, + "sarscov2 [bam] - forward strandedness": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3" + ] + ], + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,6087dfc9700a52d9e4a1ae3fcd1d1dfd" + ] + ], + [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T09:56:39.4249133" + }, + "sarscov2 [bam] - forward strandedness - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ], + "abundance": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "ballgown": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "coverage_gtf": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "transcript_gtf": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T09:57:23.008470065" + }, + "sarscov2 [bam] - forward strandedness + reference annotation - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ], + "abundance": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "ballgown": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "coverage_gtf": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "transcript_gtf": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T09:57:33.622824981" + }, + "sarscov2 [bam] - reverse strandedness + reference annotation - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ], + "abundance": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "ballgown": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "coverage_gtf": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "transcript_gtf": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T09:57:55.803421433" + }, + "sarscov2 [bam] - reverse strandedness - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ], + "abundance": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "ballgown": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "coverage_gtf": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "transcript_gtf": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T09:57:44.825389635" + }, + "sarscov2 [bam] - reverse strandedness + reference annotation": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,7385b870b955dae2c2ab78a70cf05cce" + ] + ], + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + [ + "e2t.ctab:md5,e981c0038295ae54b63cedb1083f1540", + "e_data.ctab:md5,879b6696029d19c4737b562e9d149218", + "i2t.ctab:md5,8a117c8aa4334b4c2d4711932b006fb4", + "i_data.ctab:md5,be3abe09740603213f83d50dcf81427f", + "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818" + ] + ] + ], + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,fbabb4e3888bbede67f11f692e484880" + ] + ], + [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T09:57:11.793664242" + }, + "sarscov2 [bam] - reverse strandedness": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3" + ] + ], + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,01d6da00a3c458420841e57427297183" + ] + ], + [ + "versions.yml:md5,06593ea00cc35bf06f2de2753e0c3913" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T09:57:01.166309777" + } +} \ No newline at end of file diff --git a/modules/nf-core/stringtie/stringtie/tests/nextflow.config b/modules/nf-core/stringtie/stringtie/tests/nextflow.config new file mode 100644 index 000000000..e3aaa0999 --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'STRINGTIE_STRINGTIE' { + ext.args = '' + } +} diff --git a/modules/nf-core/stringtie/stringtie/tests/tags.yml b/modules/nf-core/stringtie/stringtie/tests/tags.yml new file mode 100644 index 000000000..da9b051c3 --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/tests/tags.yml @@ -0,0 +1,2 @@ +stringtie/stringtie: + - modules/nf-core/stringtie/stringtie/** diff --git a/modules/nf-core/trimgalore/environment.yml b/modules/nf-core/trimgalore/environment.yml new file mode 100644 index 000000000..568b9e72e --- /dev/null +++ b/modules/nf-core/trimgalore/environment.yml @@ -0,0 +1,9 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::cutadapt=4.9 + - bioconda::trim-galore=0.6.10 + - conda-forge::pigz=2.8 diff --git a/modules/nf-core/trimgalore/main.nf b/modules/nf-core/trimgalore/main.nf new file mode 100644 index 000000000..5fe53669f --- /dev/null +++ b/modules/nf-core/trimgalore/main.nf @@ -0,0 +1,107 @@ +process TRIMGALORE { + tag "${meta.id}" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container + ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/9b/9becad054093ad4083a961d12733f2a742e11728fe9aa815d678b882b3ede520/data' + : 'community.wave.seqera.io/library/cutadapt_trim-galore_pigz:a98edd405b34582d'}" + + input: + tuple val(meta), path(reads) + + output: + tuple val(meta), path("*{3prime,5prime,trimmed,val}{,_1,_2}.fq.gz"), emit: reads + tuple val(meta), path("*report.txt") , emit: log, optional: true + tuple val(meta), path("*unpaired{,_1,_2}.fq.gz") , emit: unpaired, optional: true + tuple val(meta), path("*.html") , emit: html, optional: true + tuple val(meta), path("*.zip") , emit: zip, optional: true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + // Calculate number of --cores for TrimGalore based on value of task.cpus + // See: https://github.com/FelixKrueger/TrimGalore/blob/master/CHANGELOG.md#version-060-release-on-1-mar-2019 + // See: https://github.com/nf-core/atacseq/pull/65 + def cores = 1 + if (task.cpus) { + cores = (task.cpus as int) - 4 + if (meta.single_end) { + cores = (task.cpus as int) - 3 + } + if (cores < 1) { + cores = 1 + } + if (cores > 8) { + cores = 8 + } + } + + // Added soft-links to original fastqs for consistent naming in MultiQC + def prefix = task.ext.prefix ?: "${meta.id}" + if (meta.single_end) { + def args_list = args.split("\\s(?=--)").toList() + args_list.removeAll { it.toLowerCase().contains('_r2 ') } + """ + [ ! -f ${prefix}.fastq.gz ] && ln -s ${reads} ${prefix}.fastq.gz + trim_galore \\ + ${args_list.join(' ')} \\ + --cores ${cores} \\ + --gzip \\ + ${prefix}.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//') + cutadapt: \$(cutadapt --version) + pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) + END_VERSIONS + """ + } + else { + """ + [ ! -f ${prefix}_1.fastq.gz ] && ln -s ${reads[0]} ${prefix}_1.fastq.gz + [ ! -f ${prefix}_2.fastq.gz ] && ln -s ${reads[1]} ${prefix}_2.fastq.gz + trim_galore \\ + ${args} \\ + --cores ${cores} \\ + --paired \\ + --gzip \\ + ${prefix}_1.fastq.gz \\ + ${prefix}_2.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//') + cutadapt: \$(cutadapt --version) + pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) + END_VERSIONS + """ + } + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + if (meta.single_end) { + output_command = "echo '' | gzip > ${prefix}_trimmed.fq.gz ;" + output_command += "touch ${prefix}.fastq.gz_trimming_report.txt" + } + else { + output_command = "echo '' | gzip > ${prefix}_1_trimmed.fq.gz ;" + output_command += "touch ${prefix}_1.fastq.gz_trimming_report.txt ;" + output_command += "echo '' | gzip > ${prefix}_2_trimmed.fq.gz ;" + output_command += "touch ${prefix}_2.fastq.gz_trimming_report.txt" + } + """ + ${output_command} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//') + cutadapt: \$(cutadapt --version) + pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) + END_VERSIONS + """ +} diff --git a/modules/nf-core/trimgalore/meta.yml b/modules/nf-core/trimgalore/meta.yml new file mode 100644 index 000000000..bd793635f --- /dev/null +++ b/modules/nf-core/trimgalore/meta.yml @@ -0,0 +1,105 @@ +name: trimgalore +description: Trim FastQ files using Trim Galore! +keywords: + - trimming + - adapters + - sequencing adapters + - fastq +tools: + - trimgalore: + description: | + A wrapper tool around Cutadapt and FastQC to consistently apply quality + and adapter trimming to FastQ files, with some extra functionality for + MspI-digested RRBS-type (Reduced Representation Bisufite-Seq) libraries. + homepage: https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ + documentation: https://github.com/FelixKrueger/TrimGalore/blob/master/Docs/Trim_Galore_User_Guide.md + licence: ["GPL-3.0-or-later"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. +output: + - reads: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*{3prime,5prime,trimmed,val}{,_1,_2}.fq.gz": + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*{3prime,5prime,trimmed,val}{,_1,_2}.fq.gz" + - log: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*_{report.txt}" + - "*report.txt": + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*_{report.txt}" + - unpaired: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*unpaired{,_1,_2}.fq.gz": + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*unpaired*.fq.gz" + - html: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*_{fastqc.html}" + - "*.html": + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*_{fastqc.html}" + - zip: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*_{fastqc.zip}" + - "*.zip": + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + pattern: "*_{fastqc.zip}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@ewels" + - "@FelixKrueger" +maintainers: + - "@drpatelh" + - "@ewels" + - "@FelixKrueger" diff --git a/modules/nf-core/trimgalore/tests/main.nf.test b/modules/nf-core/trimgalore/tests/main.nf.test new file mode 100644 index 000000000..c01672c49 --- /dev/null +++ b/modules/nf-core/trimgalore/tests/main.nf.test @@ -0,0 +1,188 @@ +nextflow_process { + + name "Test Process TRIMGALORE" + script "../main.nf" + process "TRIMGALORE" + tag "modules" + tag "modules_nfcore" + tag "trimgalore" + + test("test_trimgalore_single_end") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) ] + ] + """ + } + } + + then { + def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { report1_lines.each { report1_line -> + { assert path(process.out.log.get(0).get(1)).getText().contains(report1_line) } + } + }, + { assert snapshot(path(process.out.versions.get(0)).yaml).match() }, + ) + } + } + + test("test_trimgalore_single_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out, + path(process.out.versions.get(0)).yaml + ).match() }, + ) + } + } + + test("test_trimgalore_paired_end") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true) + ] + ] + """ + } + } + + then { + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { report1_lines.each { report1_line -> + { assert path(process.out.log.get(0).get(1).get(0)).getText().contains(report1_line) } + } + }, + { report2_lines.each { report2_line -> + { assert path(process.out.log.get(0).get(1).get(1)).getText().contains(report2_line) } + } + }, + { assert snapshot(path(process.out.versions.get(0)).yaml).match() }, + ) + } + } + + test("test_trimgalore_paired_end_keep_unpaired") { + + config "./nextflow.config" + + when { + + params { + module_args = '--retain_unpaired --length 150' + } + + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + path(process.out.versions.get(0)).yaml, + process.out.reads, + process.out.unpaired + ).match() }, + ) + } + } + + test("test_trimgalore_paired_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot(path(process.out.versions.get(0)).yaml).match("versions") }, + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/trimgalore/tests/main.nf.test.snap b/modules/nf-core/trimgalore/tests/main.nf.test.snap new file mode 100644 index 000000000..c454ad521 --- /dev/null +++ b/modules/nf-core/trimgalore/tests/main.nf.test.snap @@ -0,0 +1,251 @@ +{ + "test_trimgalore_single_end": { + "content": [ + { + "TRIMGALORE": { + "trimgalore": "0.6.10", + "cutadapt": 4.9, + "pigz": 2.8 + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-06T12:25:01.330769598" + }, + "test_trimgalore_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + "versions.yml:md5,5928323d579768de37e83c56c821757f" + ], + "html": [ + + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "unpaired": [ + + ], + "versions": [ + "versions.yml:md5,5928323d579768de37e83c56c821757f" + ], + "zip": [ + + ] + }, + { + "TRIMGALORE": { + "trimgalore": "0.6.10", + "cutadapt": 4.9, + "pigz": 2.8 + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-06T12:25:15.582246999" + }, + "test_trimgalore_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + "versions.yml:md5,5928323d579768de37e83c56c821757f" + ], + "html": [ + + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "unpaired": [ + + ], + "versions": [ + "versions.yml:md5,5928323d579768de37e83c56c821757f" + ], + "zip": [ + + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-06T12:26:05.201562315" + }, + "versions": { + "content": [ + { + "TRIMGALORE": { + "trimgalore": "0.6.10", + "cutadapt": 4.9, + "pigz": 2.8 + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-06T12:26:05.229598492" + }, + "test_trimgalore_paired_end": { + "content": [ + { + "TRIMGALORE": { + "trimgalore": "0.6.10", + "cutadapt": 4.9, + "pigz": 2.8 + } + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-06T12:25:33.510924538" + }, + "test_trimgalore_paired_end_keep_unpaired": { + "content": [ + { + "TRIMGALORE": { + "trimgalore": "0.6.10", + "cutadapt": 4.9, + "pigz": 2.8 + } + }, + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1_val_1.fq.gz:md5,75413e85910bbc2e1556e12f6479f935", + "test_2_val_2.fq.gz:md5,d3c588c12646ebd36a0812fe02d0bda6" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1_unpaired_1.fq.gz:md5,17e0e878f6d0e93b9008a05f128660b6", + "test_2_unpaired_2.fq.gz:md5,b09a064368a867e099e66df5ef69b044" + ] + ] + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2025-01-06T12:25:46.461002981" + } +} \ No newline at end of file diff --git a/modules/nf-core/trimgalore/tests/nextflow.config b/modules/nf-core/trimgalore/tests/nextflow.config new file mode 100644 index 000000000..d8e3ac137 --- /dev/null +++ b/modules/nf-core/trimgalore/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: TRIMGALORE { + ext.args = params.module_args + } +} diff --git a/modules/nf-core/trimgalore/tests/tags.yml b/modules/nf-core/trimgalore/tests/tags.yml new file mode 100644 index 000000000..e9937691a --- /dev/null +++ b/modules/nf-core/trimgalore/tests/tags.yml @@ -0,0 +1,2 @@ +trimgalore: + - modules/nf-core/trimgalore/** diff --git a/modules/nf-core/tximeta/tximport/environment.yml b/modules/nf-core/tximeta/tximport/environment.yml new file mode 100644 index 000000000..9dfdbfac9 --- /dev/null +++ b/modules/nf-core/tximeta/tximport/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bioconductor-tximeta=1.20.1 diff --git a/modules/nf-core/tximeta/tximport/main.nf b/modules/nf-core/tximeta/tximport/main.nf new file mode 100644 index 000000000..b0cce8536 --- /dev/null +++ b/modules/nf-core/tximeta/tximport/main.nf @@ -0,0 +1,47 @@ +process TXIMETA_TXIMPORT { + label "process_medium" + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/bioconductor-tximeta%3A1.20.1--r43hdfd78af_0' : + 'biocontainers/bioconductor-tximeta:1.20.1--r43hdfd78af_0' }" + + input: + tuple val(meta), path("quants/*") + tuple val(meta2), path(tx2gene) + val quant_type + + output: + tuple val(meta), path("*gene_tpm.tsv") , emit: tpm_gene + tuple val(meta), path("*gene_counts.tsv") , emit: counts_gene + tuple val(meta), path("*gene_counts_length_scaled.tsv"), emit: counts_gene_length_scaled + tuple val(meta), path("*gene_counts_scaled.tsv") , emit: counts_gene_scaled + tuple val(meta), path("*gene_lengths.tsv") , emit: lengths_gene + tuple val(meta), path("*transcript_tpm.tsv") , emit: tpm_transcript + tuple val(meta), path("*transcript_counts.tsv") , emit: counts_transcript + tuple val(meta), path("*transcript_lengths.tsv") , emit: lengths_transcript + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + template 'tximport.r' + + stub: + """ + touch ${meta.id}.gene_tpm.tsv + touch ${meta.id}.gene_counts.tsv + touch ${meta.id}.gene_counts_length_scaled.tsv + touch ${meta.id}.gene_counts_scaled.tsv + touch ${meta.id}.gene_lengths.tsv + touch ${meta.id}.transcript_tpm.tsv + touch ${meta.id}.transcript_counts.tsv + touch ${meta.id}.transcript_lengths.tsv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bioconductor-tximeta: \$(Rscript -e "library(tximeta); cat(as.character(packageVersion('tximeta')))") + END_VERSIONS + """ +} diff --git a/modules/nf-core/tximeta/tximport/meta.yml b/modules/nf-core/tximeta/tximport/meta.yml new file mode 100644 index 000000000..d4c6a5492 --- /dev/null +++ b/modules/nf-core/tximeta/tximport/meta.yml @@ -0,0 +1,148 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json +name: "tximeta_tximport" +description: | + Import transcript-level abundances and estimated counts for gene-level + analysis packages +keywords: + - gene + - kallisto + - pseudoalignment + - salmon + - transcript +tools: + - "tximeta": + description: "Transcript Quantification Import with Automatic Metadata" + homepage: "https://bioconductor.org/packages/release/bioc/html/tximeta.html" + documentation: "https://bioconductor.org/packages/release/bioc/vignettes/tximeta/inst/doc/tximeta.html" + tool_dev_url: "https://github.com/thelovelab/tximeta" + doi: "10.1371/journal.pcbi.1007664" + licence: ["GPL-2"] + identifier: biotools:tximeta + +input: + - - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - '"quants/*"': + type: directory + description: Directory containing quantification files + - - meta2: + type: map + description: | + Groovy Map containing reference information related to the species + reference e.g. `[ id:'yeast' ]` + - tx2gene: + type: file + description: A transcript to gene mapping table such as those generated by custom/tx2gene + pattern: "*.{csv,tsv}" + - - quant_type: + type: string + description: Quantification type, 'kallisto' or 'salmon' +output: + - tpm_gene: + - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - "*gene_tpm.tsv": + type: file + description: | + Abundance (TPM) values derived from tximport output after + summarizeToGene(), without a 'countsFromAbundance' specification + pattern: "*gene_tpm.tsv" + - counts_gene: + - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - "*gene_counts.tsv": + type: file + description: | + Count values derived from tximport output after + summarizeToGene(), without a 'countsFromAbundance' specification + pattern: "*gene_counts.tsv" + - counts_gene_length_scaled: + - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - "*gene_counts_length_scaled.tsv": + type: file + description: | + Count values derived from tximport output after summarizeToGene(), with + a 'countsFromAbundance' specification of 'lengthScaledTPM' + pattern: "*gene_counts_length_scaled.tsv" + - counts_gene_scaled: + - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - "*gene_counts_scaled.tsv": + type: file + description: | + Count values derived from tximport output after summarizeToGene(), with + a 'countsFromAbundance' specification of 'scaledTPM' + pattern: "*gene_counts_scaled.tsv" + - lengths_gene: + - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - "*gene_lengths.tsv": + type: file + description: | + Length values derived from tximport output after summarizeToGene(), + without a 'countsFromAbundance' specification + pattern: "*gene_lengths.tsv" + - tpm_transcript: + - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - "*transcript_tpm.tsv": + type: file + description: | + Abundance (TPM) values derived from tximport output without + summarizeToGene(), without a 'countsFromAbundance' specification + pattern: "*transcript_tpm.tsv" + - counts_transcript: + - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - "*transcript_counts.tsv": + type: file + description: | + Count values derived from tximport output without + summarizeToGene(), without a 'countsFromAbundance' specification + pattern: "*transcript_counts.tsv" + - lengths_transcript: + - meta: + type: map + description: | + Groovy Map containing information related to the experiment as a whole + e.g. `[ id:'SRP123456' ]` + - "*transcript_lengths.tsv": + type: file + description: | + Length values derived from tximport output without summarizeToGene(), + without a 'countsFromAbundance' specification + pattern: "*gene_lengths.tsv" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@pinin4fjords" +maintainers: + - "@pinin4fjords" diff --git a/modules/nf-core/tximeta/tximport/templates/tximport.r b/modules/nf-core/tximeta/tximport/templates/tximport.r new file mode 100755 index 000000000..5986c05d9 --- /dev/null +++ b/modules/nf-core/tximeta/tximport/templates/tximport.r @@ -0,0 +1,217 @@ +#!/usr/bin/env Rscript --vanilla + +# Script for importing and processing transcript-level quantifications. +# Written by Lorena Pantano, later modified by Jonathan Manning, and released +# under the MIT license. + +# Loading required libraries +library(SummarizedExperiment) +library(tximport) + +################################################ +################################################ +## Functions ## +################################################ +################################################ + +#' Build a table from a SummarizedExperiment object +#' +#' This function takes a SummarizedExperiment object and a specific slot name to extract +#' assay data. It then combines the first two columns of the rowData with the specified +#' assay data slot into a new data table. +#' +#' @param se.obj A SummarizedExperiment object from which to build the table. +#' @param slot The name of the slot in the assays list from which to extract data. +#' +#' @return A data frame combining the first two columns of the rowData with the assay data from the specified slot. + +build_table <- function(se.obj, slot) { + data.frame(cbind(rowData(se.obj)[,1:2], assays(se.obj)[[slot]]), check.names = FALSE) +} + +#' Write a table to a file from a SummarizedExperiment object with given parameters +#' +#' This function generates a table from a SummarizedExperiment object using specified parameters +#' and writes the resulting table to a file. The file name is constructed using a prefix and a +#' suffix from the parameters, and the table is written with tab separation, without quoting text, +#' and without row names. +#' +#' @param params A list containing the parameters needed for file generation and table writing. +#' The list should include: +#' - `obj`: A SummarizedExperiment object from which to build the table. +#' - `slot`: The name of the slot in the assays list from which to extract data. +#' - `suffix`: Suffix to use for generating the file name. +#' +#' @return NULL The function is called for its side effect of writing a file and does not return anything. + +write_se_table <- function(params, prefix) { + file_name <- paste0(prefix, ".", params\$suffix) + write.table(build_table(params\$obj, params\$slot), file_name, + sep="\t", quote=FALSE, row.names = FALSE) +} + +#' Read Transcript Metadata from a Given Path +#' +#' This function reads transcript metadata from a specified file path. The file is expected to +#' be a tab-separated values file without headers, containing transcript information. The function +#' checks if the file is empty and stops execution with an error message if so. It reads the file +#' into a data frame, expecting columns for transcript IDs, gene IDs, and gene names. Additional +#' processing is done to ensure compatibility with a predefined data structure (e.g., `txi[[1]]`), +#' including adding missing entries and reordering based on the transcript IDs found in `txi[[1]]`. +#' +#' @param tinfo_path The file path to the transcript information file. +#' +#' @return A list containing three elements: +#' - `transcript`: A data frame with transcript IDs, gene IDs, and gene names, indexed by transcript IDs. +#' - `gene`: A data frame with unique gene IDs and gene names. +#' - `tx2gene`: A data frame mapping transcript IDs to gene IDs. + +read_transcript_info <- function(tinfo_path){ + info <- file.info(tinfo_path) + if (info\$size == 0) { + stop("tx2gene file is empty") + } + + transcript_info <- read.csv(tinfo_path, sep="\t", header = TRUE, + col.names = c("tx", "gene_id", "gene_name")) + + extra <- setdiff(rownames(txi[[1]]), as.character(transcript_info[["tx"]])) + transcript_info <- rbind(transcript_info, data.frame(tx=extra, gene_id=extra, gene_name=extra)) + transcript_info <- transcript_info[match(rownames(txi[[1]]), transcript_info[["tx"]]), ] + rownames(transcript_info) <- transcript_info[["tx"]] + + list(transcript = transcript_info, + gene = unique(transcript_info[,2:3]), + tx2gene = transcript_info[,1:2]) +} + +#' Create a SummarizedExperiment Object +#' +#' Constructs a SummarizedExperiment object using provided matrices for counts, abundance, and length, +#' along with metadata for columns and rows. This function facilitates the organization of experimental +#' data (e.g., RNA-seq or other high-throughput data) in a structured format that is convenient for +#' further analyses and visualization. +#' +#' @param counts A matrix or DataFrame containing counts data, with rows as features (e.g., genes) and +#' columns as samples. +#' @param abundance A matrix or DataFrame containing abundance data (e.g., TPM or FPKM) with the same +#' dimensions and row/column names as the counts data. +#' @param length A matrix or DataFrame containing feature lengths, matching the dimensions and row/column +#' names of the counts data. +#' @param col_data A DataFrame containing sample-level metadata, with rows corresponding to columns in the +#' counts, abundance, and length matrices. +#' @param row_data A DataFrame containing feature-level metadata, with rows corresponding to features in +#' the counts, abundance, and length matrices. +#' +#' @return A SummarizedExperiment object containing the supplied data and metadata. + +create_summarized_experiment <- function(counts, abundance, length, col_data, row_data) { + SummarizedExperiment(assays = list(counts = counts, abundance = abundance, length = length), + colData = col_data, + rowData = row_data) +} + +################################################ +################################################ +## Main script starts here ## +################################################ +################################################ + +# Define pattern for file names based on quantification type +pattern <- ifelse('$quant_type' == "kallisto", "abundance.tsv", "quant.sf") +fns <- list.files('quants', pattern = pattern, recursive = T, full.names = T) +names <- basename(dirname(fns)) +names(fns) <- names +dropInfReps <- '$quant_type' == "kallisto" + +# Import transcript-level quantifications +txi <- tximport(fns, type = '$quant_type', txOut = TRUE, dropInfReps = dropInfReps) + +# Read transcript and sample data +transcript_info <- read_transcript_info('$tx2gene') + +# Make coldata just to appease the summarizedexperiment +coldata <- data.frame(files = fns, names = names) +rownames(coldata) <- coldata[["names"]] + +# Create initial SummarizedExperiment object +se <- create_summarized_experiment(txi[["counts"]], txi[["abundance"]], txi[["length"]], + DataFrame(coldata), transcript_info\$transcript) + +# Setting parameters for writing tables +params <- list( + list(obj = se, slot = "abundance", suffix = "transcript_tpm.tsv"), + list(obj = se, slot = "counts", suffix = "transcript_counts.tsv"), + list(obj = se, slot = "length", suffix = "transcript_lengths.tsv") +) + +# Process gene-level data if tx2gene mapping is available +if ("tx2gene" %in% names(transcript_info) && !is.null(transcript_info\$tx2gene)) { + tx2gene <- transcript_info\$tx2gene + gi <- summarizeToGene(txi, tx2gene = tx2gene) + gi.ls <- summarizeToGene(txi, tx2gene = tx2gene, countsFromAbundance = "lengthScaledTPM") + gi.s <- summarizeToGene(txi, tx2gene = tx2gene, countsFromAbundance = "scaledTPM") + + gene_info <- transcript_info\$gene[match(rownames(gi[[1]]), transcript_info\$gene[["gene_id"]]),] + rownames(gene_info) <- NULL + col_data_frame <- DataFrame(coldata) + + # Create gene-level SummarizedExperiment objects + gse <- create_summarized_experiment(gi[["counts"]], gi[["abundance"]], gi[["length"]], + col_data_frame, gene_info) + gse.ls <- create_summarized_experiment(gi.ls[["counts"]], gi.ls[["abundance"]], gi.ls[["length"]], + col_data_frame, gene_info) + gse.s <- create_summarized_experiment(gi.s[["counts"]], gi.s[["abundance"]], gi.s[["length"]], + col_data_frame, gene_info) + + params <- c(params, list( + list(obj = gse, slot = "length", suffix = "gene_lengths.tsv"), + list(obj = gse, slot = "abundance", suffix = "gene_tpm.tsv"), + list(obj = gse, slot = "counts", suffix = "gene_counts.tsv"), + list(obj = gse.ls, slot = "counts", suffix = "gene_counts_length_scaled.tsv"), + list(obj = gse.s, slot = "counts", suffix = "gene_counts_scaled.tsv") + )) +} + +# Writing tables for each set of parameters + +prefix <- '' +if ('$task.ext.prefix' != 'null'){ + prefix = '$task.ext.prefix' +} else if ('$meta.id' != 'null'){ + prefix = '$meta.id' +} + +done <- lapply(params, write_se_table, prefix) + +################################################ +################################################ +## R SESSION INFO ## +################################################ +################################################ + +sink(paste(prefix, "R_sessionInfo.log", sep = '.')) +citation("tximeta") +print(sessionInfo()) +sink() + +################################################ +################################################ +## VERSIONS FILE ## +################################################ +################################################ + +r.version <- strsplit(version[['version.string']], ' ')[[1]][3] +tximeta.version <- as.character(packageVersion('tximeta')) + +writeLines( + c( + '"${task.process}":', + paste(' bioconductor-tximeta:', tximeta.version) + ), +'versions.yml') + +################################################ +################################################ +################################################ +################################################ diff --git a/modules/nf-core/tximeta/tximport/tests/main.nf.test b/modules/nf-core/tximeta/tximport/tests/main.nf.test new file mode 100644 index 000000000..b09776f21 --- /dev/null +++ b/modules/nf-core/tximeta/tximport/tests/main.nf.test @@ -0,0 +1,238 @@ +nextflow_process { + + name "Test Process TXIMETA_TXIMPORT" + script "../main.nf" + process "TXIMETA_TXIMPORT" + + tag "modules" + tag "modules_nfcore" + tag "custom/tx2gene" + tag "tximeta" + tag "tximeta/tximport" + tag "untar" + + test("saccharomyces_cerevisiae - kallisto - gtf") { + + setup { + run("UNTAR") { + script "../../../untar/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true) + ]) + """ + } + } + run("CUSTOM_TX2GENE") { + script "../../../custom/tx2gene/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/genome_gfp.gtf', checkIfExists: true) + ]) + input[1] = UNTAR.out.untar.map { meta, dir -> [ meta, dir.listFiles().collect() ] } + input[2] = 'kallisto' + input[3] = 'gene_id' + input[4] = 'gene_name' + """ + } + } + } + + when { + process { + """ + input[0] = UNTAR.out.untar.map { meta, dir -> [ meta, dir.listFiles().collect() ] } + input[1] = CUSTOM_TX2GENE.out.tx2gene + input[2] = 'kallisto' + """ + } + } + + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.counts_gene, + process.out.counts_gene_length_scaled, + process.out.counts_gene_scaled, + process.out.counts_transcript, + process.out.lengths_gene, + process.out.lengths_transcript, + process.out.tpm_gene, + process.out.tpm_transcript, + process.out.versions).match() + } + ) + } + } + + test("saccharomyces_cerevisiae - kallisto - gtf - stub") { + + options "-stub" + + setup { + run("UNTAR") { + script "../../../untar/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true) + ]) + """ + } + } + run("CUSTOM_TX2GENE") { + script "../../../custom/tx2gene/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/genome_gfp.gtf', checkIfExists: true) + ]) + input[1] = UNTAR.out.untar.map { meta, dir -> [ meta, dir.listFiles().collect() ] } + input[2] = 'kallisto' + input[3] = 'gene_id' + input[4] = 'gene_name' + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ [], [] ]) + input[1] = Channel.of([ [], [] ]) + input[2] = 'kallisto' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() + } + ) + } + + } + test("saccharomyces_cerevisiae - salmon - gtf") { + + setup { + run("UNTAR") { + script "../../../untar/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/salmon_results.tar.gz', checkIfExists: true) + ]) + """ + } + } + run("CUSTOM_TX2GENE") { + script "../../../custom/tx2gene/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/genome_gfp.gtf', checkIfExists: true) + ]) + input[1] = UNTAR.out.untar.map { meta, dir -> [ meta, dir.listFiles().collect() ] } + input[2] = 'salmon' + input[3] = 'gene_id' + input[4] = 'gene_name' + """ + } + } + } + + when { + process { + """ + input[0] = UNTAR.out.untar.map { meta, dir -> [ meta, dir.listFiles().collect() ] } + input[1] = CUSTOM_TX2GENE.out.tx2gene + input[2] = 'salmon' + """ + } + } + + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.counts_gene, + process.out.counts_gene_length_scaled, + process.out.counts_gene_scaled, + process.out.counts_transcript, + process.out.lengths_gene, + process.out.lengths_transcript, + process.out.tpm_gene, + process.out.tpm_transcript, + process.out.versions).match() + } + ) + } + + } + + test("saccharomyces_cerevisiae - salmon - gtf - stub") { + + options "-stub" + + setup { + run("UNTAR") { + script "../../../untar/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/salmon_results.tar.gz', checkIfExists: true) + ]) + """ + } + } + run("CUSTOM_TX2GENE") { + script "../../../custom/tx2gene/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/genome_gfp.gtf', checkIfExists: true) + ]) + input[1] = UNTAR.out.untar.map { meta, dir -> [ meta, dir.listFiles().collect() ] } + input[2] = 'salmon' + input[3] = 'gene_id' + input[4] = 'gene_name' + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ [], [] ]) + input[1] = Channel.of([ [], [] ]) + input[2] = 'salmon' + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match()} + ) + } + } +} + diff --git a/modules/nf-core/tximeta/tximport/tests/main.nf.test.snap b/modules/nf-core/tximeta/tximport/tests/main.nf.test.snap new file mode 100644 index 000000000..d4092270b --- /dev/null +++ b/modules/nf-core/tximeta/tximport/tests/main.nf.test.snap @@ -0,0 +1,444 @@ +{ + "saccharomyces_cerevisiae - kallisto - gtf - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + "[].gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + [ + + ], + "[].gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + [ + + ], + "[].gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + [ + + ], + "[].gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + [ + + ], + "[].gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + [ + + ], + "[].transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + [ + + ], + "[].transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + [ + + ], + "[].transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + "versions.yml:md5,6ff317cceddc686f84d79cb976e1e28b" + ], + "counts_gene": [ + [ + [ + + ], + "[].gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene_length_scaled": [ + [ + [ + + ], + "[].gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene_scaled": [ + [ + [ + + ], + "[].gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_transcript": [ + [ + [ + + ], + "[].transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lengths_gene": [ + [ + [ + + ], + "[].gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lengths_transcript": [ + [ + [ + + ], + "[].transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tpm_gene": [ + [ + [ + + ], + "[].gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tpm_transcript": [ + [ + [ + + ], + "[].transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,6ff317cceddc686f84d79cb976e1e28b" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-17T19:24:48.684346976" + }, + "saccharomyces_cerevisiae - salmon - gtf": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.gene_counts.tsv:md5,c14cab7e15cfac73ec0602dc2c404551" + ] + ], + [ + [ + { + "id": "test" + }, + "test.gene_counts_length_scaled.tsv:md5,5f92a6784f6edc5e3b336c71c3ee7daf" + ] + ], + [ + [ + { + "id": "test" + }, + "test.gene_counts_scaled.tsv:md5,fdfb3d23aaf5d4316d81247ec4664ca0" + ] + ], + [ + [ + { + "id": "test" + }, + "test.transcript_counts.tsv:md5,ff0f5be09ca7a322672c0074ba35da17" + ] + ], + [ + [ + { + "id": "test" + }, + "test.gene_lengths.tsv:md5,1691ea2677612805cd699265c83024d7" + ] + ], + [ + [ + { + "id": "test" + }, + "test.transcript_lengths.tsv:md5,db6d8ab9f8e1123d5984fd534b4347dc" + ] + ], + [ + [ + { + "id": "test" + }, + "test.gene_tpm.tsv:md5,6076364cc78741a4f8bc8935a045d13d" + ] + ], + [ + [ + { + "id": "test" + }, + "test.transcript_tpm.tsv:md5,7a334b565e1e865efb1caf615f194ef7" + ] + ], + [ + "versions.yml:md5,6ff317cceddc686f84d79cb976e1e28b" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-17T19:24:59.699008761" + }, + "saccharomyces_cerevisiae - kallisto - gtf": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.gene_counts.tsv:md5,e89c28692ea214396b2d4cb702a804c3" + ] + ], + [ + [ + { + "id": "test" + }, + "test.gene_counts_length_scaled.tsv:md5,4944841ac711124d29673b6b6ed16ef3" + ] + ], + [ + [ + { + "id": "test" + }, + "test.gene_counts_scaled.tsv:md5,39d14e361434978b3cadae901a26a028" + ] + ], + [ + [ + { + "id": "test" + }, + "test.transcript_counts.tsv:md5,42e0106e75fa97c1c684c6d9060f1724" + ] + ], + [ + [ + { + "id": "test" + }, + "test.gene_lengths.tsv:md5,db6becdf807fd164a9c63dd1dd916d9c" + ] + ], + [ + [ + { + "id": "test" + }, + "test.transcript_lengths.tsv:md5,f974b52840431a5dae57bcb615badbf1" + ] + ], + [ + [ + { + "id": "test" + }, + "test.gene_tpm.tsv:md5,85d108269769ae0d841247b9b9ed922d" + ] + ], + [ + [ + { + "id": "test" + }, + "test.transcript_tpm.tsv:md5,65862ed9d4a05abfab952e680dc0e49d" + ] + ], + [ + "versions.yml:md5,6ff317cceddc686f84d79cb976e1e28b" + ] + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-17T19:24:36.406126268" + }, + "saccharomyces_cerevisiae - salmon - gtf - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + "[].gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + [ + + ], + "[].gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + [ + + ], + "[].gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + [ + + ], + "[].gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + [ + + ], + "[].gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + [ + + ], + "[].transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + [ + + ], + "[].transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + [ + + ], + "[].transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + "versions.yml:md5,6ff317cceddc686f84d79cb976e1e28b" + ], + "counts_gene": [ + [ + [ + + ], + "[].gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene_length_scaled": [ + [ + [ + + ], + "[].gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene_scaled": [ + [ + [ + + ], + "[].gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_transcript": [ + [ + [ + + ], + "[].transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lengths_gene": [ + [ + [ + + ], + "[].gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lengths_transcript": [ + [ + [ + + ], + "[].transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tpm_gene": [ + [ + [ + + ], + "[].gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tpm_transcript": [ + [ + [ + + ], + "[].transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,6ff317cceddc686f84d79cb976e1e28b" + ] + } + ], + "meta": { + "nf-test": "0.9.2", + "nextflow": "24.10.3" + }, + "timestamp": "2024-12-17T19:25:16.373218283" + } +} \ No newline at end of file diff --git a/modules/nf-core/tximeta/tximport/tests/tags.yml b/modules/nf-core/tximeta/tximport/tests/tags.yml new file mode 100644 index 000000000..fc96a89e0 --- /dev/null +++ b/modules/nf-core/tximeta/tximport/tests/tags.yml @@ -0,0 +1,2 @@ +tximeta/tximport: + - "modules/nf-core/tximeta/tximport/**" diff --git a/modules/nf-core/ucsc/gtftogenepred/environment.yml b/modules/nf-core/ucsc/gtftogenepred/environment.yml new file mode 100644 index 000000000..86709a0d4 --- /dev/null +++ b/modules/nf-core/ucsc/gtftogenepred/environment.yml @@ -0,0 +1,7 @@ +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::ucsc-gtftogenepred=447 diff --git a/modules/nf-core/ucsc/gtftogenepred/main.nf b/modules/nf-core/ucsc/gtftogenepred/main.nf new file mode 100644 index 000000000..afbb5f3f9 --- /dev/null +++ b/modules/nf-core/ucsc/gtftogenepred/main.nf @@ -0,0 +1,54 @@ +process UCSC_GTFTOGENEPRED { + tag "${meta.id}" + label 'process_low' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/ucsc-gtftogenepred:447--h954228d_0': + 'biocontainers/ucsc-gtftogenepred:447--h954228d_0' }" + + input: + tuple val(meta), path(gtf) + + output: + tuple val(meta), path("*.genepred"), emit: genepred + tuple val(meta), path("*.refflat") , emit: refflat , optional: true + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def gen_refflat = args.contains("-genePredExt") && args.contains("-geneNameAsName2") ? "true" : "false" + def prefix = task.ext.prefix ?: "${meta.id}" + def VERSION = '447' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + """ + gtfToGenePred \\ + $args \\ + $gtf \\ + ${prefix}.genepred + + if [ "${gen_refflat}" == "true" ] ; then + awk 'BEGIN { OFS="\\t"} {print \$12, \$1, \$2, \$3, \$4, \$5, \$6, \$7, \$8, \$9, \$10}' ${prefix}.genepred > ${prefix}.refflat + fi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + ucsc: $VERSION + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def VERSION = '447' + """ + touch ${prefix}.genepred + touch ${prefix}.refflat + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + ucsc: $VERSION + END_VERSIONS + """ +} diff --git a/modules/nf-core/ucsc/gtftogenepred/meta.yml b/modules/nf-core/ucsc/gtftogenepred/meta.yml new file mode 100644 index 000000000..cf04154d4 --- /dev/null +++ b/modules/nf-core/ucsc/gtftogenepred/meta.yml @@ -0,0 +1,56 @@ +name: ucsc_gtftogenepred +description: compute average score of bigwig over bed file +keywords: + - gtf + - genepred + - refflat + - ucsc + - gtftogenepred +tools: + - ucsc: + description: Convert GTF files to GenePred format + homepage: http://hgdownload.cse.ucsc.edu/admin/exe/ + licence: ["varies; see http://genome.ucsc.edu/license"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - gtf: + type: file + description: GTF file + pattern: "*.{gtf}" +output: + - genepred: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.genepred": + type: file + description: genepred file + pattern: "*.{genepred}" + - refflat: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.refflat": + type: file + description: refflat file + pattern: "*.{refflat}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@BarryDigby" + - "@anoronh4" +maintainers: + - "@BarryDigby" + - "@anoronh4" diff --git a/modules/nf-core/ucsc/gtftogenepred/tests/main.nf.test b/modules/nf-core/ucsc/gtftogenepred/tests/main.nf.test new file mode 100644 index 000000000..e0396a63c --- /dev/null +++ b/modules/nf-core/ucsc/gtftogenepred/tests/main.nf.test @@ -0,0 +1,36 @@ + +nextflow_process { + + name "Test Process UCSC_GTFTOGENEPRED" + script "../main.nf" + process "UCSC_GTFTOGENEPRED" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "ucsc" + tag "ucsc/gtftogenepred" + + test("test-ucsc-gtftogenepred") { + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true) ] + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/ucsc/gtftogenepred/tests/main.nf.test.snap b/modules/nf-core/ucsc/gtftogenepred/tests/main.nf.test.snap new file mode 100644 index 000000000..f021f8238 --- /dev/null +++ b/modules/nf-core/ucsc/gtftogenepred/tests/main.nf.test.snap @@ -0,0 +1,51 @@ +{ + "test-ucsc-gtftogenepred": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.genepred:md5,779e4749efaf38da3443ddfde30cc76c" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.refflat:md5,4101802f41d4cf7ee2667587da11bf42" + ] + ], + "2": [ + "versions.yml:md5,fd95365619a316eb451190365b1b799e" + ], + "genepred": [ + [ + { + "id": "test" + }, + "test.genepred:md5,779e4749efaf38da3443ddfde30cc76c" + ] + ], + "refflat": [ + [ + { + "id": "test" + }, + "test.refflat:md5,4101802f41d4cf7ee2667587da11bf42" + ] + ], + "versions": [ + "versions.yml:md5,fd95365619a316eb451190365b1b799e" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-23T08:55:50.58172" + } +} \ No newline at end of file diff --git a/modules/nf-core/ucsc/gtftogenepred/tests/nextflow.config b/modules/nf-core/ucsc/gtftogenepred/tests/nextflow.config new file mode 100644 index 000000000..889bb6ce6 --- /dev/null +++ b/modules/nf-core/ucsc/gtftogenepred/tests/nextflow.config @@ -0,0 +1,8 @@ +process { + withName: UCSC_GTFTOGENEPRED { + ext.args = [ + "-genePredExt", + "-geneNameAsName2" + ].join(' ').trim() + } +} diff --git a/nextflow.config b/nextflow.config index 566d2f46d..cf182b301 100644 --- a/nextflow.config +++ b/nextflow.config @@ -1,154 +1,362 @@ /* - * ------------------------------------------------- - * nf-core/circrna Nextflow config file - * ------------------------------------------------- - * Default config options for all environments. - */ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + nf-core/circrna Nextflow config file +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Default config options for all compute environments +---------------------------------------------------------------------------------------- +*/ // Global default params, used in configs params { - // Workflow flags - // TODO nf-core: Specify your pipeline's command line flags - genome = false - input = "data/*{1,2}.fastq.gz" - single_end = false - outdir = './results' - publish_dir_mode = 'copy' - - // Boilerplate options - name = false - multiqc_config = false - email = false - email_on_fail = false - max_multiqc_email_size = 25.MB - plaintext_email = false - monochrome_logs = false - help = false - igenomes_base = 's3://ngi-igenomes/igenomes/' - tracedir = "${params.outdir}/pipeline_info" - igenomes_ignore = false - custom_config_version = 'master' - custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" - hostnames = false - config_profile_description = false - config_profile_contact = false - config_profile_url = false - - // Defaults only, expecting to be overwritten - max_memory = 128.GB - max_cpus = 16 - max_time = 240.h + // Input options + input = null + outdir = null + phenotype = null + annotation = null + mirna_expression = null -} + //> circRNA + tools = 'circexplorer2' + bsj_reads = 1 + max_shift = 0 + consider_strand = true + min_samples = 1 + min_tools = 1 + save_intermediates = false + quantification_tools = 'ciriquant,psirc,sum,max' + bootstrap_samples = 30 + exons_only = true -// Container slug. Stable releases should specify release tag! -// Developmental code should specify :dev -process.container = 'nfcore/circrna:dev' + //> miRNA + mirna_expression = null + mirna_min_reads = 5 + mirna_min_sample_percentage = 0.2 + mirna_tools = 'miranda,targetscan' + mirna_min_tools = 1 + mirna_correlation = 'pearson' -// Load base.config by default for all pipelines -includeConfig 'conf/base.config' + // References + genome = null + igenomes_base = 's3://ngi-igenomes/igenomes/' + igenomes_ignore = false + bowtie = null + bowtie2 = null + bwa = null + star = null + hisat2 = null + hisat2_build_memory = '200.GB' + segemehl = null + save_reference = true + mature = null -// Load nf-core custom profiles from different Institutions -try { - includeConfig "${params.custom_config_base}/nfcore_custom.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config") + // Trimming + min_trimmed_reads = 10000 + clip_r1 = null + clip_r2 = null + three_prime_clip_r1 = null + three_prime_clip_r2 = null + trim_nextseq = null + save_trimmed = false + skip_trimming = false + + // Alignment options + + //> STAR + chimJunctionOverhangMin = 10 + alignSJDBoverhangMin = 10 + chimSegmentMin = 10 + sjdboverhang = 100 + limitSjdbInsertNsj = 1000000 + + //> MAPSPLICE + seglen = 25 + min_intron = 20 + max_intron = 1000000 + min_map_len = 40 + min_fusion_distance = 200 + + //> MISC + save_unaligned = false + seq_center = null + + // MultiQC options + skip_fastqc = false + multiqc_config = null + multiqc_title = null + multiqc_logo = null + max_multiqc_email_size = '25.MB' + multiqc_methods_description = null + + // Boilerplate options + outdir = null + publish_dir_mode = 'copy' + email = null + email_on_fail = null + plaintext_email = false + monochrome_logs = false + hook_url = null + help = false + help_full = false + show_hidden = false + version = false + pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' + trace_report_suffix = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')// Config options + config_profile_name = null + config_profile_description = null + + custom_config_version = 'master' + custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" + config_profile_contact = null + config_profile_url = null + + // Schema validation default options + validate_params = true } +// Load base.config by default for all pipelines +includeConfig 'conf/base.config' + profiles { - conda { process.conda = "$projectDir/environment.yml" } - debug { process.beforeScript = 'echo $HOSTNAME' } - docker { - docker.enabled = true - // Avoid this error: - // WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. - // Testing this in nf-core after discussion here https://github.com/nf-core/tools/pull/351 - // once this is established and works well, nextflow might implement this behavior as new default. - docker.runOptions = '-u \$(id -u):\$(id -g)' - } - singularity { - singularity.enabled = true - singularity.autoMounts = true - } - podman { - podman.enabled = true - } - test { includeConfig 'conf/test.config' } - test_full { includeConfig 'conf/test_full.config' } + debug { + dumpHashes = true + process.beforeScript = 'echo $HOSTNAME' + cleanup = false + nextflow.enable.configProcessNamesValidation = true + } + conda { + conda.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + conda.channels = ['conda-forge', 'bioconda'] + apptainer.enabled = false + } + mamba { + conda.enabled = true + conda.useMamba = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false + } + docker { + docker.enabled = true + conda.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false + docker.runOptions = '-u $(id -u):$(id -g)' + } + arm { + docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + conda.enabled = false + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false + } + podman { + podman.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false + } + shifter { + shifter.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + apptainer.enabled = false + } + charliecloud { + charliecloud.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + apptainer.enabled = false + } + apptainer { + apptainer.enabled = true + apptainer.autoMounts = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.runOptions = '--no-mount tmp --writable-tmpfs' + } + wave { + apptainer.ociAutoPull = true + singularity.ociAutoPull = true + wave.enabled = true + wave.freeze = true + wave.strategy = 'conda,container' + } + gitpod { + executor.name = 'local' + executor.cpus = 4 + executor.memory = 8.GB + process { + resourceLimits = [ + memory: 8.GB, + cpus : 4, + time : 1.h + ] + } + } + test { includeConfig 'conf/test.config' } + test_igenomes { includeConfig 'conf/test_igenomes.config' } + full { includeConfig 'conf/full.config' } + test_full { includeConfig 'conf/test_full.config' } } +// Load nf-core custom profiles from different Institutions +includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null" + +// Load nf-core/circrna custom profiles from different institutions. +// TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs +// includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/circrna.config" : "/dev/null" + +// Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile +// Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled +// Set to your registry if you have a mirror of containers +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' +charliecloud.registry = 'quay.io' + // Load igenomes.config if required -if (!params.igenomes_ignore) { - includeConfig 'conf/igenomes.config' -} +includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' // Export these variables to prevent local Python/R libraries from conflicting with those in the container +// The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. +// See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. + env { - PYTHONNOUSERSITE = 1 - R_PROFILE_USER = "/.Rprofile" - R_ENVIRON_USER = "/.Renviron" + PYTHONNOUSERSITE = 1 + R_PROFILE_USER = "/.Rprofile" + R_ENVIRON_USER = "/.Renviron" + JULIA_DEPOT_PATH = "/usr/local/share/julia" } -// Capture exit codes from upstream processes when piping -process.shell = ['/bin/bash', '-euo', 'pipefail'] +// Set bash options +process.shell = [ + "bash", + "-C", // No clobber - prevent output redirection from overwriting files. + "-e", // Exit if a tool returns a non-zero status/exit code + "-u", // Treat unset variables and parameters as an error + "-o", // Returns the status of the last command to exit.. + "pipefail" // ..with a non-zero status or zero if all successfully execute +] + +// Disable process selector warnings by default. Use debug profile to enable warnings. +nextflow.enable.configProcessNamesValidation = false timeline { - enabled = true - file = "${params.tracedir}/execution_timeline.html" + enabled = true + file = "${params.outdir}/pipeline_info/execution_timeline_${params.trace_report_suffix}.html" } report { - enabled = true - file = "${params.tracedir}/execution_report.html" + enabled = true + file = "${params.outdir}/pipeline_info/execution_report_${params.trace_report_suffix}.html" } trace { - enabled = true - file = "${params.tracedir}/execution_trace.txt" + enabled = true + file = "${params.outdir}/pipeline_info/execution_trace_${params.trace_report_suffix}.txt" } dag { - enabled = true - file = "${params.tracedir}/pipeline_dag.svg" + enabled = true + file = "${params.outdir}/pipeline_info/pipeline_dag_${params.trace_report_suffix}.html" } manifest { - name = 'nf-core/circrna' - author = 'Barry Digby' - homePage = 'https://github.com/nf-core/circrna' - description = 'workflow for the quantification, differential expression analysis and miRNA target prediction analysis of circRNAs in RNA-Seq data' - mainScript = 'main.nf' - nextflowVersion = '>=20.04.0' - version = '1.0dev' + name = 'nf-core/circrna' + author = """Barry Digby, Nico Trummer""" // The author field is deprecated from Nextflow version 24.10.0, use contributors instead + contributors = [ + // TODO nf-core: Update the field with the details of the contributors to your pipeline. New with Nextflow version 24.10.0 + [ + name: 'Barry Digby', + affiliation: '', + email: '', + github: '', + contribution: [], // List of contribution types ('author', 'maintainer' or 'contributor') + orcid: '' + ], + [ + name: ' Nico Trummer', + affiliation: '', + email: '', + github: '', + contribution: [], // List of contribution types ('author', 'maintainer' or 'contributor') + orcid: '' + ], + ] + homePage = 'https://github.com/nf-core/circrna' + description = """Quantification, miRNA target prediction and differential expression analysis of circular RNAs""" + mainScript = 'main.nf' + defaultBranch = 'master' + nextflowVersion = '!>=24.04.2' + version = '0.0.1dev' + doi = '' } -// Function to ensure that resource requirements don't go beyond -// a maximum limit -def check_max(obj, type) { - if (type == 'memory') { - try { - if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1) - return params.max_memory as nextflow.util.MemoryUnit - else - return obj - } catch (all) { - println " ### ERROR ### Max memory '${params.max_memory}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'time') { - try { - if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1) - return params.max_time as nextflow.util.Duration - else - return obj - } catch (all) { - println " ### ERROR ### Max time '${params.max_time}' is not valid! Using default value: $obj" - return obj +// Nextflow plugins +plugins { + id 'nf-schema@2.3.0' // Validation of pipeline parameters and creation of an input channel from a sample sheet +} + +validation { + defaultIgnoreParams = ["genomes"] + monochromeLogs = params.monochrome_logs + help { + enabled = true + command = "nextflow run nf-core/circrna -profile --input samplesheet.csv --outdir " + fullParameter = "help_full" + showHiddenParameter = "show_hidden" + beforeText = """ +-\033[2m----------------------------------------------------\033[0m- + \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m +\033[0;34m ___ __ __ __ ___ \033[0;32m/,-._.--~\'\033[0m +\033[0;34m |\\ | |__ __ / ` / \\ |__) |__ \033[0;33m} {\033[0m +\033[0;34m | \\| | \\__, \\__/ | \\ |___ \033[0;32m\\`-._,-`-,\033[0m + \033[0;32m`._,._,\'\033[0m +\033[0;35m nf-core/circrna ${manifest.version}\033[0m +-\033[2m----------------------------------------------------\033[0m- +""" + afterText = """${manifest.doi ? "\n* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} +* The nf-core framework + https://doi.org/10.1038/s41587-020-0439-x + +* Software dependencies + https://github.com/nf-core/circrna/blob/master/CITATIONS.md +""" } - } else if (type == 'cpus') { - try { - return Math.min( obj, params.max_cpus as int ) - } catch (all) { - println " ### ERROR ### Max cpus '${params.max_cpus}' is not valid! Using default value: $obj" - return obj + summary { + beforeText = validation.help.beforeText + afterText = validation.help.afterText } - } } + +// Load modules.config for DSL2 module specific options +includeConfig 'conf/modules.config' diff --git a/nextflow_schema.json b/nextflow_schema.json index d8f497aa9..425a42a76 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -1,36 +1,56 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/circrna/master/nextflow_schema.json", "title": "nf-core/circrna pipeline parameters", - "description": "workflow for the quantification, differential expression analysis and miRNA target prediction analysis of circRNAs in RNA-Seq data", + "description": "Quantification, miRNA target prediction and differential expression analysis of circular RNAs", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", "fa_icon": "fas fa-terminal", "description": "Define where the pipeline should find input data and save output data.", - "required": [ - "input" - ], + "required": ["input", "outdir"], "properties": { "input": { "type": "string", - "fa_icon": "fas fa-dna", - "description": "Input FastQ files.", - "help_text": "Use this to specify the location of your input FastQ files. For example:\n\n```bash\n--input 'path/to/data/sample_*_{1,2}.fastq'\n```\n\nPlease note the following requirements:\n\n1. The path must be enclosed in quotes\n2. The path must have at least one `*` wildcard character\n3. When using the pipeline with paired end data, the path must use `{1,2}` notation to specify read pairs.\n\nIf left unspecified, a default pattern is used: `data/*{1,2}.fastq.gz`" - }, - "single_end": { - "type": "boolean", - "description": "Specifies that the input is single-end reads.", - "fa_icon": "fas fa-align-center", - "help_text": "By default, the pipeline expects paired-end data. If you have single-end data, you need to specify `--single_end` on the command line when you launch the pipeline. A normal glob pattern, enclosed in quotation marks, can then be used for `--input`. For example:\n\n```bash\n--single_end --input '*.fastq'\n```\n\nIt is not possible to run a mixture of single-end and paired-end files in one run." + "format": "file-path", + "exists": true, + "schema": "assets/schema_input.json", + "mimetype": "text/csv", + "pattern": "^\\S+\\.csv$", + "description": "Path to comma-separated file containing information about the samples in the experiment.", + "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/circrna/usage#samplesheet-input).", + "fa_icon": "fas fa-file-csv" }, "outdir": { "type": "string", - "description": "The output directory where the results will be saved.", - "default": "./results", - "fa_icon": "fas fa-folder-open" + "format": "directory-path", + "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.", + "fa_icon": "fas fa-folder-open", + "default": null + }, + "phenotype": { + "type": "string", + "format": "file-path", + "exists": true, + "schema": "assets/schema_phenotype.json", + "mimetype": "text/csv", + "pattern": "^\\S+\\.csv$", + "description": "Phenotype CSV file specifying the experimental design. If provided, the pipeline will run CIRCTEST.", + "help_text": "There are two rules for providing the phenotype CSV file. 1) The 'sample' column must match the sample sheets 'sample' column. 2) The response variable containing the phenotype of primary interest in the experiment must have the column name condition. All other columns included in the file are controlled for in the `DESeq2` design. \n\n| sample \t| condition \t| replicate \t|\n|-----------\t|-----------\t|-----------\t|\n| control_1 \t| ctr \t| 1 \t|\n| control_2 \t| ctr \t| 2 \t|\n| control_3 \t| ctr \t| 3 \t|\n| treated_1 \t| trt \t| 1 \t|\n| treated_2 \t| trt \t| 2 \t|\n| treated_3 \t| trt \t| 3 \t|\n\nThe above phenotype file will identify differentially expressed circRNAs/mRNAs between control and treatment cells, whilst controlling for the effect of variation between replicates: ` ~ replicates + condition`", + "fa_icon": "fas fa-file-csv" + }, + "annotation": { + "type": "string", + "format": "file-path", + "exists": true, + "schema": "assets/schema_annotation.json", + "mimetype": "text/csv", + "pattern": "^\\S+\\.csv$", + "description": "Path to a CSV file containing BED files that should be used for annotation.", + "help_text": "The annotation file should be a CSV file with the following columns: `name`, `file` and `min_overlap`. The `name` column should contain a unique identifier for the annotation, the `file` column should contain the path to the BED file and the `min_overlap` column should contain the minimum overlap required for a circRNA to be considered as overlapping with the annotation. The `min_overlap` column is optional and defaults to 0.9 if not provided.", + "fa_icon": "fas fa-file-csv" }, "email": { "type": "string", @@ -38,6 +58,214 @@ "fa_icon": "fas fa-envelope", "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.", "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$" + }, + "multiqc_title": { + "type": "string", + "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.", + "fa_icon": "fas fa-file-signature" + } + } + }, + "circrna_options": { + "title": "circRNA Options", + "type": "object", + "fa_icon": "fas fa-circle-notch", + "description": "Parameters for circrna discovery.", + "required": ["tools"], + "properties": { + "tools": { + "type": "string", + "fa_icon": "fas fa-wrench", + "description": "Comma separated list of circRNA quantification tools to use. Supported tools: ciriquant, circexplorer2, find_circ, circrna_finder, mapsplice, dcc, segemehl", + "pattern": "^(ciriquant|circexplorer2|find_circ|circrna_finder|mapsplice|dcc|segemehl)(,(ciriquant|circexplorer2|find_circ|circrna_finder|mapsplice|dcc|segemehl))*$", + "help_text": "Select one or a combination of circRNA quantification tools for the pipeline e.g:\n--tool 'circexplorer2, ciriquant, find_circ'\n\nN.B: Selecting more than one circRNA quantification tool will trigger the circRNA filtering parameter --min_tools", + "default": "circexplorer2" + }, + "bsj_reads": { + "type": "integer", + "fa_icon": "fas fa-circle-notch", + "description": "Minimum number of reads spanning circRNA back-splice junction required for circRNA to be output by workflow.", + "help_text": "Filter low confidence circRNAs by removing circRNAs with read counts below a specified value. To disable, set the value to 1 (default).", + "default": 1, + "minimum": 1 + }, + "max_shift": { + "type": "integer", + "fa_icon": "fas fa-file-plus-minus", + "description": "If both start and end of a pair of BSJs are within max_shift bp, they are considered as the same BSJ.", + "default": 0, + "minimum": 0 + }, + "consider_strand": { + "type": "boolean", + "fa_icon": "fas fa-arrows-alt-v", + "description": "Consider strand information when comparing BSJs.", + "default": true + }, + "min_tools": { + "type": "integer", + "fa_icon": "fas fa-intersection", + "description": "Specify the minimum number of tools circRNAs must be called by to be output by the workflow.", + "help_text": "When multiple circRNA quantification tools have been provided to `--tool`, set a filtering method whereby circRNAs are output if they have been called by at least *n* quantification tools.\n\nSetting `--min_tools` to 1 is the same as taking the union, all circRNAs are included in the output.\n\nSetting `--min_tools` to 2 will output circRNAs that have been called by at least 2 quantification tools and so on.", + "default": 1, + "minimum": 1, + "maximum": 7 + }, + "min_samples": { + "type": "integer", + "fa_icon": "fas fa-intersection", + "description": "Minimum number of samples a circRNA must be detected in to be output by the workflow.", + "help_text": "Filter circRNAs by removing circRNAs detected in fewer samples than the specified value. To disable, set the value to 1 (default).", + "default": 1, + "minimum": 1 + }, + "quantification_tools": { + "type": "string", + "fa_icon": "fas fa-wrench", + "description": "Comma separated list of circRNA quantification tools to use. Supported tools: ciriquant, psirc", + "help_text": "Select one or a combination of circRNA quantification tools for the pipeline e.g:\n--quantification_tools 'ciriquant,psirc,sum,max'", + "default": "ciriquant,psirc,sum,max", + "pattern": "^((ciriquant|psirc|sum|max)(,(ciriquant|psirc|sum|max))*)+$" + }, + "bootstrap_samples": { + "type": "integer", + "description": "Number of bootstrap samples to use during psirc quantification.", + "default": 30 + }, + "exons_only": { + "type": "boolean", + "description": "Only consider exons for circRNA sequence extraction.", + "help_text": "With single-end reads, we cannot determine the actual full-length isoform (FLI) sequence. Thus, we can either use the entire sequence between the BSJ boundaries or only the exons.", + "default": true + } + } + }, + "mirna_options": { + "title": "miRNA options", + "type": "object", + "fa_icon": "fas fa-terminal", + "description": "Define paths and threasholds for miRNA analysis.", + "properties": { + "mirna_expression": { + "type": "string", + "format": "file-path", + "exists": true, + "mimetype": "text/tsv", + "pattern": "^\\S+\\.tsv$", + "description": "path to tab-separated file providing the expression counts of mirnas, which are created in pipeline 'smrnaseq'. \n\nmirna \t sample1 \t sample2 \t sample3 \t\nid1\t count_sample1 \t count_sample2 \t count_sample3 \t\nid2 \t ... \t ... \t ... \t \n", + "fa_icon": "fas fa-file-tsv" + }, + "mirna_min_sample_percentage": { + "type": "number", + "fa_icon": "fas fa-circle-notch", + "description": "Minimum percentage of samples, a miRNA has to be expressed in to pass filtering.", + "help_text": "The mirna_min_percentage parameter sets the minimum percentage of samples in which a miRNA must be expressed to pass filtering. The default value is 0.2, which means a miRNA must be detected in at least 20% of the samples to be included in the analysis.", + "default": 0.2, + "minimum": 0 + }, + "mirna_min_reads": { + "type": "integer", + "fa_icon": "fas fa-circle-notch", + "description": "Minimum number of reads, a miRNA is required to have to pass filtering.", + "help_text": "This parameter determines the minimum number of reads that a miRNA must have to pass filtering. The default is 5, meaning a miRNA must have at least 5 reads across the samples to be considered for analysis.", + "default": 5, + "minimum": 0 + }, + "mirna_correlation": { + "type": "string", + "fa_icon": "fas fa-wrench", + "description": "Specifies the type of correlation to be used when analyzing the relationship between miRNA and transcript expression levels. Valid options are 'pearson' or 'spearman'.", + "help_text": "Select the correlation method to be applied in the correlation analysis of miRNAs.", + "default": "pearson", + "pattern": "^(pearson|spearman)$" + }, + "mirna_tools": { + "type": "string", + "fa_icon": "fas fa-wrench", + "description": "Comma separated list of miRNA bindingsite prediction tools to use. Supported tools: miranda, targetscan.", + "help_text": "Select one or a combination of miRNA bindingsite prediction tools for the pipeline e.g:\n--mirna_tools 'miranda,targetscan'", + "default": "miranda,targetscan", + "pattern": "^((miranda|targetscan)?,?)*[^,]+$" + }, + "mirna_min_tools": { + "type": "integer", + "fa_icon": "fas fa-intersection", + "description": "Specify the number of votes required for a miRNA to be further considered in downstream analysis.'", + "help_text": "Controls the number of votes required for a binding site prediction to be considered valid. If a miRNA binding site was predicted by two different tools (e.g., miRanda and TargetScan), it receives two votes. By specifying additional tools for miRNA binding site prediction (using the 'mirna_min_tools' parameter), you can adjust the number of votes required for a binding site to be considered valid.", + "default": 1, + "minimum": 1, + "maximum": 4 + } + } + }, + "alignment_options": { + "title": "Alignment Options", + "type": "object", + "description": "Parameters used by aligners pertinent to circRNA detection", + "default": "", + "fa_icon": "fas fa-align-center", + "properties": { + "sjdboverhang": { + "type": "integer", + "description": "*only used at the genome generation step* tells STAR how many bases to concatenate from donor and acceptor sides of the junctions.", + "default": 100 + }, + "chimJunctionOverhangMin": { + "type": "integer", + "description": "Minimum overhang for a chimeric junction", + "default": 10 + }, + "alignSJDBoverhangMin": { + "type": "integer", + "description": "Minimum overhang for annotated junctions", + "default": 10 + }, + "limitSjdbInsertNsj": { + "type": "integer", + "description": "Maximum number of junction to be inserted to the genome on the fly at the mapping stage, including those from annotations and those detected in the 1st step of the 2-pass run", + "default": 1000000 + }, + "chimSegmentMin": { + "type": "integer", + "description": "Minimum length of chimeric segment length. Must be set to a positive value to detect circular junctions.", + "default": 10 + }, + "seglen": { + "type": "integer", + "description": "Segment length. Default 25", + "default": 25 + }, + "min_intron": { + "type": "integer", + "description": "Minimum intron length. Default 20", + "default": 20 + }, + "max_intron": { + "type": "integer", + "description": "Maximum intron length. Default 1000000", + "default": 1000000 + }, + "min_map_len": { + "type": "integer", + "description": "Minimum alignment length. Default 40", + "default": 40 + }, + "min_fusion_distance": { + "type": "integer", + "description": "Minimum distance between two gapped segments to be considered as fusion candidate. Must set to lower values to be sensitive to circular candidates (e.g 200).", + "default": 200 + }, + "seq_center": { + "type": "string", + "description": "Sequencing center information to be added to read group of BAM files.", + "fa_icon": "fas fa-synagogue" + }, + "save_unaligned": { + "type": "boolean", + "fa_icon": "fas fa-save", + "description": "Where possible, save unaligned reads from either STAR, HISAT2 or Salmon to the results directory.", + "help_text": "This may either be in the form of FastQ or BAM files depending on the options available for that particular tool.", + "default": false } } }, @@ -45,26 +273,88 @@ "title": "Reference genome options", "type": "object", "fa_icon": "fas fa-dna", - "description": "Options for the reference genome indices used to align reads.", + "description": "Reference genome related files and options required for the workflow.", "properties": { + "save_reference": { + "type": "boolean", + "description": "Save generated reference genome files such as indices, chromosome FASTA files.", + "default": true, + "fa_icon": "fas fa-save" + }, "genome": { "type": "string", "description": "Name of iGenomes reference.", "fa_icon": "fas fa-book", - "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`.\n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details." + "help_text": "By using a reference genome build on iGenomes, the gtf, mature, species and index files (bar HISAT2 and segemehl) will be automatically downloaded for you. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details." }, "fasta": { "type": "string", - "fa_icon": "fas fa-font", + "format": "file-path", + "exists": true, + "mimetype": "text/plain", + "pattern": "^\\S+\\.fn?a(sta)?(\\.gz)?$", "description": "Path to FASTA genome file.", - "help_text": "If you have no genome reference available, the pipeline can build one using a FASTA file. This requires additional time and resources, so it's better to use a pre-build index if possible." + "help_text": "If you use AWS iGenomes, this has already been set for you appropriately.\n\nThis parameter is *mandatory* if `--genome` is not specified.", + "fa_icon": "fas fa-book" }, - "igenomes_base": { + "gtf": { "type": "string", - "description": "Directory / URL base for iGenomes references.", - "default": "s3://ngi-igenomes/igenomes/", - "fa_icon": "fas fa-cloud-download-alt", - "hidden": true + "fa_icon": "fas fa-address-book", + "mimetype": "text/plain", + "description": "Path to reference GTF file.", + "help_text": "This parameter is *mandatory* if `--genome` is not specified. Needs to contain the following attributes: `gene_id`, `transcript_id` and `gene_name`.", + "pattern": "\\.gtf$" + }, + "mature": { + "type": "string", + "description": "Path to FASTA file with mature miRNAs. This parameter needs to be specified to perform miRNA interaction analyses.", + "mimetype": "text/plain", + "help_text": "Typically this will be the `mature.fa` file from miRBase. Can be given either as a plain text `.fa` file or a compressed `.gz` file.", + "fa_icon": "fas fa-wheelchair", + "default": null + }, + "bowtie": { + "type": "string", + "fa_icon": "fas fa-bold", + "description": "Path to Bowtie index files, surrounded by quotes. No glob pattern required.", + "default": null + }, + "bowtie2": { + "type": "string", + "fa_icon": "fas fa-bold", + "description": "Path to Bowtie2 index files, surrounded by quotes. No glob pattern required.", + "default": null + }, + "bwa": { + "type": "string", + "fa_icon": "fas fa-bold", + "description": "Path to BWA index directory, surrounded by quotes. No glob pattern required.", + "default": null + }, + "hisat2": { + "type": "string", + "description": "Path to Hisat2 index directory, surrounded by quotes. No glob pattern required.", + "default": null, + "fa_icon": "fab fa-bold" + }, + "hisat2_build_memory": { + "type": "string", + "default": "200.GB", + "fa_icon": "fas fa-memory", + "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", + "description": "Minimum memory required to use splice sites and exons in the HiSAT2 index build process.", + "help_text": "HiSAT2 requires a huge amount of RAM to build a genome index for larger genomes, if including splice sites and exons e.g. the human genome might typically require 200GB. If you specify less than this threshold for the `HISAT2_BUILD` process then the splice sites and exons will be ignored, meaning that the process will require a lot less memory. If you are working with a small genome, set this parameter to a lower value to reduce the threshold for skipping this check. If using a larger genome, consider supplying more memory to the `HISAT2_BUILD` process." + }, + "segemehl": { + "type": "string", + "default": null, + "fa_icon": "fab fa-stripe-s", + "description": "Path to Segemehl Index **file**." + }, + "star": { + "type": "string", + "fa_icon": "far fa-star", + "description": "Path to STAR index directory, surrounded by quotes. No glob pattern required." }, "igenomes_ignore": { "type": "boolean", @@ -72,120 +362,74 @@ "fa_icon": "fas fa-ban", "hidden": true, "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`." + }, + "igenomes_base": { + "type": "string", + "format": "directory-path", + "description": "The base path to the igenomes reference files", + "fa_icon": "fas fa-ban", + "hidden": true, + "default": "s3://ngi-igenomes/igenomes/" } } }, - "generic_options": { - "title": "Generic options", + "read_trimming_options": { + "title": "Read trimming options", "type": "object", - "fa_icon": "fas fa-file-import", - "description": "Less common options for the pipeline, typically set in a config file.", - "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", + "fa_icon": "fas fa-cut", + "description": "Options to adjust read trimming criteria.", "properties": { - "help": { + "skip_trimming": { "type": "boolean", - "description": "Display help text.", - "hidden": true, - "fa_icon": "fas fa-question-circle" - }, - "publish_dir_mode": { - "type": "string", - "default": "copy", - "hidden": true, - "description": "Method used to save pipeline results to output directory.", - "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", - "fa_icon": "fas fa-copy", - "enum": [ - "symlink", - "rellink", - "link", - "copy", - "copyNoFollow", - "move" - ] - }, - "name": { - "type": "string", - "description": "Workflow name.", - "fa_icon": "fas fa-fingerprint", - "hidden": true, - "help_text": "A custom name for the pipeline run. Unlike the core nextflow `-name` option with one hyphen this parameter can be reused multiple times, for example if using `-resume`. Passed through to steps such as MultiQC and used for things like report filenames and titles." + "description": "Skip the adapter trimming step.", + "help_text": "Use this if your input FastQ files have already been trimmed outside of the workflow or if you're very confident that there is no adapter contamination in your data.", + "fa_icon": "fas fa-fast-forward", + "default": false }, - "email_on_fail": { - "type": "string", - "description": "Email address for completion summary, only when pipeline fails.", - "fa_icon": "fas fa-exclamation-triangle", - "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$", - "hidden": true, - "help_text": "This works exactly as with `--email`, except emails are only sent if the workflow is not successful." + "save_trimmed": { + "type": "boolean", + "description": "Save the trimmed FastQ files in the results directory.", + "help_text": "By default, trimmed FastQ files will not be saved to the results directory. Specify this flag (or set to true in your config file) to copy these files to the results directory when complete.", + "fa_icon": "fas fa-save", + "default": false }, - "plaintext_email": { + "skip_fastqc": { "type": "boolean", - "description": "Send plain-text email instead of HTML.", - "fa_icon": "fas fa-remove-format", - "hidden": true, - "help_text": "Set to receive plain-text e-mails instead of HTML formatted." + "description": "Skip FastQC quality control of the sequencing reads.", + "fa_icon": "fas fa-terminal", + "default": false }, - "max_multiqc_email_size": { - "type": "string", - "description": "File size limit when attaching MultiQC reports to summary emails.", - "default": "25.MB", - "fa_icon": "fas fa-file-upload", - "hidden": true, - "help_text": "If file generated by pipeline exceeds the threshold, it will not be attached." + "clip_r1": { + "type": "integer", + "description": "Instructs Trim Galore to remove bp from the 5' end of read 1 (or single-end reads).", + "fa_icon": "fas fa-cut" }, - "monochrome_logs": { - "type": "boolean", - "description": "Do not use coloured log outputs.", - "fa_icon": "fas fa-palette", - "hidden": true, - "help_text": "Set to disable colourful command line output and live life in monochrome." + "clip_r2": { + "type": "integer", + "description": "Instructs Trim Galore to remove bp from the 5' end of read 2 (paired-end reads only).", + "fa_icon": "fas fa-cut" }, - "multiqc_config": { - "type": "string", - "description": "Custom config file to supply to MultiQC.", - "fa_icon": "fas fa-cog", - "hidden": true + "three_prime_clip_r1": { + "type": "integer", + "description": "Instructs Trim Galore to remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.", + "fa_icon": "fas fa-cut" }, - "tracedir": { - "type": "string", - "description": "Directory to keep pipeline Nextflow logs and reports.", - "default": "${params.outdir}/pipeline_info", - "fa_icon": "fas fa-cogs", - "hidden": true - } - } - }, - "max_job_request_options": { - "title": "Max job request options", - "type": "object", - "fa_icon": "fab fa-acquisitions-incorporated", - "description": "Set the top limit for requested resources for any single job.", - "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.", - "properties": { - "max_cpus": { + "three_prime_clip_r2": { "type": "integer", - "description": "Maximum number of CPUs that can be requested for any single job.", - "default": 16, - "fa_icon": "fas fa-microchip", - "hidden": true, - "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`" + "description": "Instructs Trim Galore to remove bp from the 3' end of read 2 AFTER adapter/quality trimming has been performed.", + "fa_icon": "fas fa-cut" }, - "max_memory": { - "type": "string", - "description": "Maximum amount of memory that can be requested for any single job.", - "default": "128.GB", - "fa_icon": "fas fa-memory", - "hidden": true, - "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`" + "trim_nextseq": { + "type": "integer", + "description": "Instructs Trim Galore to apply the --nextseq=X option, to trim based on quality after removing poly-G tails.", + "help_text": "This enables the option Cutadapt `--nextseq-trim=3'CUTOFF` option via Trim Galore, which will set a quality cutoff (that is normally given with -q instead), but qualities of G bases are ignored. This trimming is in common for the NextSeq- and NovaSeq-platforms, where basecalls without any signal are called as high-quality G bases.", + "fa_icon": "fas fa-cut" }, - "max_time": { - "type": "string", - "description": "Maximum amount of time that can be requested for any single job.", - "default": "240.h", - "fa_icon": "far fa-clock", - "hidden": true, - "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`" + "min_trimmed_reads": { + "type": "integer", + "default": 10000, + "fa_icon": "fas fa-hand-paper", + "description": "Minimum number of trimmed reads below which samples are removed from further processing. Some downstream steps in the pipeline will fail if this threshold is too low." } } }, @@ -201,20 +445,19 @@ "description": "Git commit id for Institutional configs.", "default": "master", "hidden": true, - "fa_icon": "fas fa-users-cog", - "help_text": "Provide git commit id for custom Institutional configs hosted at `nf-core/configs`. This was implemented for reproducibility purposes. Default: `master`.\n\n```bash\n## Download and use config file with following git commit id\n--custom_config_version d52db660777c4bf36546ddb188ec530c3ada1b96\n```" + "fa_icon": "fas fa-users-cog" }, "custom_config_base": { "type": "string", "description": "Base directory for Institutional configs.", "default": "https://raw.githubusercontent.com/nf-core/configs/master", "hidden": true, - "help_text": "If you're running offline, nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell nextflow where to find them with the `custom_config_base` option. For example:\n\n```bash\n## Download and unzip the config files\ncd /path/to/my/configs\nwget https://github.com/nf-core/configs/archive/master.zip\nunzip master.zip\n\n## Run the pipeline\ncd /path/to/my/data\nnextflow run /path/to/pipeline/ --custom_config_base /path/to/my/configs/configs-master/\n```\n\n> Note that the nf-core/tools helper package has a `download` command to download all required pipeline files + singularity containers + institutional configs in one go for you, to make this process easier.", + "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.", "fa_icon": "fas fa-users-cog" }, - "hostnames": { + "config_profile_name": { "type": "string", - "description": "Institutional configs hostname.", + "description": "Institutional config name.", "hidden": true, "fa_icon": "fas fa-users-cog" }, @@ -237,23 +480,135 @@ "fa_icon": "fas fa-users-cog" } } + }, + "generic_options": { + "title": "Generic options", + "type": "object", + "fa_icon": "fas fa-file-import", + "description": "Less common options for the pipeline, typically set in a config file.", + "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", + "properties": { + "version": { + "type": "boolean", + "description": "Display version and exit.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "save_intermediates": { + "type": "boolean", + "description": "Save intermediate files.", + "default": false, + "fa_icon": "fas fa-save" + }, + "publish_dir_mode": { + "type": "string", + "default": "copy", + "description": "Method used to save pipeline results to output directory.", + "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", + "fa_icon": "fas fa-copy", + "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"], + "hidden": true + }, + "email_on_fail": { + "type": "string", + "description": "Email address for completion summary, only when pipeline fails.", + "fa_icon": "fas fa-exclamation-triangle", + "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$", + "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.", + "hidden": true + }, + "plaintext_email": { + "type": "boolean", + "description": "Send plain-text email instead of HTML.", + "fa_icon": "fas fa-remove-format", + "hidden": true + }, + "max_multiqc_email_size": { + "type": "string", + "description": "File size limit when attaching MultiQC reports to summary emails.", + "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", + "default": "25.MB", + "fa_icon": "fas fa-file-upload", + "hidden": true + }, + "monochrome_logs": { + "type": "boolean", + "description": "Do not use coloured log outputs.", + "fa_icon": "fas fa-palette", + "hidden": true + }, + "hook_url": { + "type": "string", + "description": "Incoming hook URL for messaging service", + "fa_icon": "fas fa-people-group", + "help_text": "Incoming hook URL for messaging service. Currently, MS Teams and Slack are supported.", + "hidden": true + }, + "multiqc_config": { + "type": "string", + "format": "file-path", + "description": "Custom config file to supply to MultiQC.", + "fa_icon": "fas fa-cog", + "hidden": true + }, + "multiqc_logo": { + "type": "string", + "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file", + "fa_icon": "fas fa-image", + "hidden": true + }, + "multiqc_methods_description": { + "type": "string", + "description": "Custom MultiQC yaml file containing HTML including a methods description.", + "fa_icon": "fas fa-cog" + }, + "validate_params": { + "type": "boolean", + "description": "Boolean whether to validate parameters against the schema at runtime", + "default": true, + "fa_icon": "fas fa-check-square", + "hidden": true + }, + "pipelines_testdata_base_path": { + "type": "string", + "fa_icon": "far fa-check-circle", + "description": "Base URL or local path to location of pipeline test dataset files", + "default": "https://raw.githubusercontent.com/nf-core/test-datasets/", + "hidden": true + }, + "trace_report_suffix": { + "type": "string", + "fa_icon": "far calendar", + "description": "Suffix to add to the trace report filename. Default is the date and time in the format yyyy-MM-dd_HH-mm-ss.", + "hidden": true + } + } } }, "allOf": [ { - "$ref": "#/definitions/input_output_options" + "$ref": "#/$defs/input_output_options" + }, + { + "$ref": "#/$defs/reference_genome_options" + }, + { + "$ref": "#/$defs/read_trimming_options" + }, + { + "$ref": "#/$defs/alignment_options" }, { - "$ref": "#/definitions/reference_genome_options" + "$ref": "#/$defs/circrna_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/mirna_options" }, { - "$ref": "#/definitions/max_job_request_options" + "$ref": "#/$defs/institutional_config_options" }, { - "$ref": "#/definitions/institutional_config_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/ro-crate-metadata.json b/ro-crate-metadata.json new file mode 100644 index 000000000..dfb36f62c --- /dev/null +++ b/ro-crate-metadata.json @@ -0,0 +1,326 @@ +{ + "@context": [ + "https://w3id.org/ro/crate/1.1/context", + { + "GithubService": "https://w3id.org/ro/terms/test#GithubService", + "JenkinsService": "https://w3id.org/ro/terms/test#JenkinsService", + "PlanemoEngine": "https://w3id.org/ro/terms/test#PlanemoEngine", + "TestDefinition": "https://w3id.org/ro/terms/test#TestDefinition", + "TestInstance": "https://w3id.org/ro/terms/test#TestInstance", + "TestService": "https://w3id.org/ro/terms/test#TestService", + "TestSuite": "https://w3id.org/ro/terms/test#TestSuite", + "TravisService": "https://w3id.org/ro/terms/test#TravisService", + "definition": "https://w3id.org/ro/terms/test#definition", + "engineVersion": "https://w3id.org/ro/terms/test#engineVersion", + "instance": "https://w3id.org/ro/terms/test#instance", + "resource": "https://w3id.org/ro/terms/test#resource", + "runsOn": "https://w3id.org/ro/terms/test#runsOn" + } + ], + "@graph": [ + { + "@id": "./", + "@type": "Dataset", + "creativeWorkStatus": "InProgress", + "datePublished": "2025-01-27T14:44:44+00:00", + "description": "

\n \n \n \"nf-core/circrna\"\n \n

\n\n[![GitHub Actions CI Status](https://github.com/nf-core/circrna/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/circrna/actions/workflows/ci.yml)\n[![GitHub Actions Linting Status](https://github.com/nf-core/circrna/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/circrna/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/circrna/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)\n[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)\n\n[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/)\n[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)\n[![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/)\n[![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/)\n[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/circrna)\n\n[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23circrna-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/circrna)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core)\n\n## Introduction\n\n**nf-core/circrna** is a bioinformatics pipeline that ...\n\n\n\n\n1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))2. Present QC for raw reads ([`MultiQC`](http://multiqc.info/))\n\n## Usage\n\n> [!NOTE]\n> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data.\n\n\n\nNow, you can run the pipeline using:\n\n\n\n```bash\nnextflow run nf-core/circrna \\\n -profile \\\n --input samplesheet.csv \\\n --outdir \n```\n\n> [!WARNING]\n> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).\n\nFor more details and further functionality, please refer to the [usage documentation](https://nf-co.re/circrna/usage) and the [parameter documentation](https://nf-co.re/circrna/parameters).\n\n## Pipeline output\n\nTo see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/circrna/results) tab on the nf-core website pipeline page.\nFor more details about the output files and reports, please refer to the\n[output documentation](https://nf-co.re/circrna/output).\n\n## Credits\n\nnf-core/circrna was originally written by Barry Digby, Nico Trummer.\n\nWe thank the following people for their extensive assistance in the development of this pipeline:\n\n\n\n## Contributions and Support\n\nIf you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).\n\nFor further information or help, don't hesitate to get in touch on the [Slack `#circrna` channel](https://nfcore.slack.com/channels/circrna) (you can join with [this invite](https://nf-co.re/join/slack)).\n\n## Citations\n\n\n\n\n\n\nAn extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.\n\nYou can cite the `nf-core` publication as follows:\n\n> **The nf-core framework for community-curated bioinformatics pipelines.**\n>\n> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.\n>\n> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).\n", + "hasPart": [ + { + "@id": "main.nf" + }, + { + "@id": "assets/" + }, + { + "@id": "conf/" + }, + { + "@id": "docs/" + }, + { + "@id": "docs/images/" + }, + { + "@id": "modules/" + }, + { + "@id": "modules/nf-core/" + }, + { + "@id": "workflows/" + }, + { + "@id": "subworkflows/" + }, + { + "@id": "nextflow.config" + }, + { + "@id": "README.md" + }, + { + "@id": "nextflow_schema.json" + }, + { + "@id": "CHANGELOG.md" + }, + { + "@id": "LICENSE" + }, + { + "@id": "CODE_OF_CONDUCT.md" + }, + { + "@id": "CITATIONS.md" + }, + { + "@id": "modules.json" + }, + { + "@id": "docs/usage.md" + }, + { + "@id": "docs/output.md" + }, + { + "@id": ".nf-core.yml" + }, + { + "@id": ".pre-commit-config.yaml" + }, + { + "@id": ".prettierignore" + } + ], + "isBasedOn": "https://github.com/nf-core/circrna", + "license": "MIT", + "mainEntity": { + "@id": "main.nf" + }, + "mentions": [ + { + "@id": "#d9d6704c-b248-4f6b-b713-f292cf59fc53" + } + ], + "name": "nf-core/circrna" + }, + { + "@id": "ro-crate-metadata.json", + "@type": "CreativeWork", + "about": { + "@id": "./" + }, + "conformsTo": [ + { + "@id": "https://w3id.org/ro/crate/1.1" + }, + { + "@id": "https://w3id.org/workflowhub/workflow-ro-crate/1.0" + } + ] + }, + { + "@id": "main.nf", + "@type": ["File", "SoftwareSourceCode", "ComputationalWorkflow"], + "creator": [ + { + "@id": "https://orcid.org/0000-0002-8492-6585" + }, + { + "@id": "https://orcid.org/0000-0002-8492-6585" + } + ], + "dateCreated": "", + "dateModified": "2025-01-27T14:44:44Z", + "dct:conformsTo": "https://bioschemas.org/profiles/ComputationalWorkflow/1.0-RELEASE/", + "keywords": [ + "nf-core", + "nextflow", + "circrna", + "circrna-pipeline", + "circrna-prediction", + "circular-rna", + "genomics", + "mirna", + "mirna-targets", + "ngs", + "rna-seq" + ], + "license": ["MIT"], + "maintainer": [ + { + "@id": "https://orcid.org/0000-0002-8492-6585" + } + ], + "name": ["nf-core/circrna"], + "programmingLanguage": { + "@id": "https://w3id.org/workflowhub/workflow-ro-crate#nextflow" + }, + "sdPublisher": { + "@id": "https://nf-co.re/" + }, + "url": ["https://github.com/nf-core/circrna", "https://nf-co.re/circrna/dev/"], + "version": ["0.0.1dev"] + }, + { + "@id": "https://w3id.org/workflowhub/workflow-ro-crate#nextflow", + "@type": "ComputerLanguage", + "identifier": { + "@id": "https://www.nextflow.io/" + }, + "name": "Nextflow", + "url": { + "@id": "https://www.nextflow.io/" + }, + "version": "!>=24.04.2" + }, + { + "@id": "#d9d6704c-b248-4f6b-b713-f292cf59fc53", + "@type": "TestSuite", + "instance": [ + { + "@id": "#0dfde08c-c4c5-4173-9d21-2883f8333535" + } + ], + "mainEntity": { + "@id": "main.nf" + }, + "name": "Test suite for nf-core/circrna" + }, + { + "@id": "#0dfde08c-c4c5-4173-9d21-2883f8333535", + "@type": "TestInstance", + "name": "GitHub Actions workflow for testing nf-core/circrna", + "resource": "repos/nf-core/circrna/actions/workflows/ci.yml", + "runsOn": { + "@id": "https://w3id.org/ro/terms/test#GithubService" + }, + "url": "https://api.github.com" + }, + { + "@id": "https://w3id.org/ro/terms/test#GithubService", + "@type": "TestService", + "name": "Github Actions", + "url": { + "@id": "https://github.com" + } + }, + { + "@id": "assets/", + "@type": "Dataset", + "description": "Additional files" + }, + { + "@id": "conf/", + "@type": "Dataset", + "description": "Configuration files" + }, + { + "@id": "docs/", + "@type": "Dataset", + "description": "Markdown files for documenting the pipeline" + }, + { + "@id": "docs/images/", + "@type": "Dataset", + "description": "Images for the documentation files" + }, + { + "@id": "modules/", + "@type": "Dataset", + "description": "Modules used by the pipeline" + }, + { + "@id": "modules/nf-core/", + "@type": "Dataset", + "description": "nf-core modules" + }, + { + "@id": "workflows/", + "@type": "Dataset", + "description": "Main pipeline workflows to be executed in main.nf" + }, + { + "@id": "subworkflows/", + "@type": "Dataset", + "description": "Smaller subworkflows" + }, + { + "@id": "nextflow.config", + "@type": "File", + "description": "Main Nextflow configuration file" + }, + { + "@id": "README.md", + "@type": "File", + "description": "Basic pipeline usage information" + }, + { + "@id": "nextflow_schema.json", + "@type": "File", + "description": "JSON schema for pipeline parameter specification" + }, + { + "@id": "CHANGELOG.md", + "@type": "File", + "description": "Information on changes made to the pipeline" + }, + { + "@id": "LICENSE", + "@type": "File", + "description": "The license - should be MIT" + }, + { + "@id": "CODE_OF_CONDUCT.md", + "@type": "File", + "description": "The nf-core code of conduct" + }, + { + "@id": "CITATIONS.md", + "@type": "File", + "description": "Citations needed when using the pipeline" + }, + { + "@id": "modules.json", + "@type": "File", + "description": "Version information for modules from nf-core/modules" + }, + { + "@id": "docs/usage.md", + "@type": "File", + "description": "Usage documentation" + }, + { + "@id": "docs/output.md", + "@type": "File", + "description": "Output documentation" + }, + { + "@id": ".nf-core.yml", + "@type": "File", + "description": "nf-core configuration file, configuring template features and linting rules" + }, + { + "@id": ".pre-commit-config.yaml", + "@type": "File", + "description": "Configuration file for pre-commit hooks" + }, + { + "@id": ".prettierignore", + "@type": "File", + "description": "Ignore file for prettier" + }, + { + "@id": "https://nf-co.re/", + "@type": "Organization", + "name": "nf-core", + "url": "https://nf-co.re/" + }, + { + "@id": "https://orcid.org/0000-0002-8492-6585", + "@type": "Person", + "email": "b.digby237@gmail.com", + "name": "Barry digby" + } + ] +} diff --git a/subworkflows/local/annotation.nf b/subworkflows/local/annotation.nf new file mode 100644 index 000000000..97ae1dbd8 --- /dev/null +++ b/subworkflows/local/annotation.nf @@ -0,0 +1,59 @@ +include { GAWK as INGEST_DATABASE_NAMES } from '../../modules/nf-core/gawk' +include { GNU_SORT as COMBINE_DATABASES } from '../../modules/nf-core/gnu/sort' +include { BEDTOOLS_INTERSECT as INTERSECT_DATABASE } from '../../modules/nf-core/bedtools/intersect' +include { CIRCEXPLORER2_ANNOTATE as ANNOTATE } from '../../modules/nf-core/circexplorer2/annotate' +include { BEDTOOLS_GETFASTA as GET_FASTA } from '../../modules/nf-core/bedtools/getfasta' +include { GAWK as RENAME } from '../../modules/nf-core/gawk' +include { GAWK as CUT_BED12 } from '../../modules/nf-core/gawk' +include { ANNOTATION_BED2GTF as BED2GTF } from '../../modules/local/annotation/bed2gtf' +workflow ANNOTATION { + take: + regions + ch_annotation + fasta + circexplorer2_index + + main: + ch_versions = Channel.empty() + + INGEST_DATABASE_NAMES(ch_annotation, [], false) + ch_versions = ch_versions.mix(INGEST_DATABASE_NAMES.out.versions) + + INTERSECT_DATABASE( + regions.combine(INGEST_DATABASE_NAMES.out.output).map { meta1, _regions, meta2, database -> + [ + [ + id: "${meta1.id}-${meta2.id}", + tool: meta1.tool, + original_meta: meta1, + min_overlap: meta2.min_overlap, + ], + _regions, + database, + ] + }, + [[], []], + ) + ch_versions = ch_versions.mix(INTERSECT_DATABASE.out.versions) + + ANNOTATE(regions, fasta, circexplorer2_index) + ch_versions = ch_versions.mix(ANNOTATE.out.versions) + + RENAME(ANNOTATE.out.txt, [], false) + ch_versions = ch_versions.mix(RENAME.out.versions) + + BED2GTF(RENAME.out.output.map{meta, bed12 -> [meta, bed12, []]}, params.exons_only) + ch_versions = ch_versions.mix(BED2GTF.out.versions) + + CUT_BED12(RENAME.out.output, [], false) + ch_versions = ch_versions.mix(CUT_BED12.out.versions) + + GET_FASTA(RENAME.out.output, fasta) + ch_versions = ch_versions.mix(GET_FASTA.out.versions) + + emit: + bed12 = RENAME.out.output + gtf = BED2GTF.out.gtf + fasta = GET_FASTA.out.fasta + versions = ch_versions +} diff --git a/subworkflows/local/bsj_detection.nf b/subworkflows/local/bsj_detection.nf new file mode 100644 index 000000000..5cd85e57a --- /dev/null +++ b/subworkflows/local/bsj_detection.nf @@ -0,0 +1,224 @@ +// MODULES +include { GAWK as EXTRACT_COUNTS } from '../../modules/nf-core/gawk' +include { CSVTK_JOIN as COMBINE_COUNTS_PER_TOOL } from '../../modules/nf-core/csvtk/join' +include { GAWK as FILTER_BSJS } from '../../modules/nf-core/gawk' +include { GAWK as BED_ADD_SAMPLE_TOOL } from '../../modules/nf-core/gawk' +include { COMBINEBEDS_FILTER as COMBINE_TOOLS_PER_SAMPLE } from '../../modules/local/combinebeds/filter' +include { COMBINEBEDS_SHIFTS as INVESTIGATE_SHIFTS } from '../../modules/local/combinebeds/shifts' +include { COMBINEBEDS_FILTER as COMBINE_SAMPLES } from '../../modules/local/combinebeds/filter' + +// SUBWORKFLOWS +include { SEGEMEHL } from './detection_tools/segemehl' +include { STAR2PASS } from './detection_tools/star2pass' +include { CIRCEXPLORER2 } from './detection_tools/circexplorer2' +include { CIRCRNA_FINDER } from './detection_tools/circrna_finder' +include { FIND_CIRC } from './detection_tools/find_circ' +include { CIRIQUANT } from './detection_tools/ciriquant' +include { DCC } from './detection_tools/dcc' +include { MAPSPLICE } from './detection_tools/mapsplice' +include { ANNOTATION as ANNOTATE_COMBINED } from './annotation' +include { ANNOTATION as ANNOTATE_PER_SAMPLE } from './annotation' +include { ANNOTATION as ANNOTATE_PER_SAMPLE_TOOL } from './annotation' + +workflow BSJ_DETECTION { + + take: + reads + ch_fasta + ch_gtf + ch_annotation + bowtie_index + bowtie2_index + bwa_index + chromosomes + hisat2_index + star_index + circexplorer2_index + bsj_reads + + main: + ch_versions = Channel.empty() + ch_bsj_bed_per_sample_tool = Channel.empty() + ch_multiqc_files = Channel.empty() + fasta = ch_fasta.map{_meta, fasta -> fasta} + gtf = ch_gtf.map{_meta, gtf -> gtf} + + // STAR 2-PASS-MODE + star_ignore_sjdbgtf = true + seq_center = params.seq_center ?: '' + seq_platform = '' + STAR2PASS( reads, star_index, ch_gtf, bsj_reads, star_ignore_sjdbgtf, seq_center, seq_platform ) + ch_versions = ch_versions.mix(STAR2PASS.out.versions) + + // + // DISCOVERY TOOLS: + // + tools_selected = params.tools.split(',').collect{it.trim().toLowerCase()} + + if (tools_selected.size() == 0) { + error 'No tools selected for circRNA discovery.' + } + + if (tools_selected.contains('segemehl')) { + SEGEMEHL( reads, fasta, params.segemehl ) + ch_versions = ch_versions.mix(SEGEMEHL.out.versions) + ch_bsj_bed_per_sample_tool = ch_bsj_bed_per_sample_tool.mix(SEGEMEHL.out.bed) + } + + if (tools_selected.contains('circexplorer2')) { + CIRCEXPLORER2( fasta, STAR2PASS.out.junction, circexplorer2_index ) + ch_versions = ch_versions.mix(CIRCEXPLORER2.out.versions) + ch_bsj_bed_per_sample_tool = ch_bsj_bed_per_sample_tool.mix(CIRCEXPLORER2.out.bed) + } + + if (tools_selected.contains('circrna_finder')) { + CIRCRNA_FINDER( fasta, STAR2PASS.out.sam, STAR2PASS.out.junction, + STAR2PASS.out.tab ) + ch_versions = ch_versions.mix(CIRCRNA_FINDER.out.versions) + ch_bsj_bed_per_sample_tool = ch_bsj_bed_per_sample_tool.mix(CIRCRNA_FINDER.out.bed) + } + + if (tools_selected.contains('find_circ')) { + FIND_CIRC( reads, bowtie2_index, ch_fasta ) + ch_versions = ch_versions.mix(FIND_CIRC.out.versions) + ch_bsj_bed_per_sample_tool = ch_bsj_bed_per_sample_tool.mix(FIND_CIRC.out.bed) + } + + if (tools_selected.contains('ciriquant')) { + CIRIQUANT( reads, ch_gtf, ch_fasta, bwa_index, hisat2_index ) + ch_versions = ch_versions.mix(CIRIQUANT.out.versions) + ch_bsj_bed_per_sample_tool = ch_bsj_bed_per_sample_tool.mix(CIRIQUANT.out.bed) + } + + if (tools_selected.contains('dcc')) { + DCC( reads, ch_fasta, ch_gtf, star_index, STAR2PASS.out.junction, + star_ignore_sjdbgtf, seq_platform, seq_center, bsj_reads ) + ch_versions = ch_versions.mix(DCC.out.versions) + ch_bsj_bed_per_sample_tool = ch_bsj_bed_per_sample_tool.mix(DCC.out.bed) + } + + if (tools_selected.contains('mapsplice')) { + MAPSPLICE( reads, gtf, fasta, bowtie_index, chromosomes, + STAR2PASS.out.junction, circexplorer2_index ) + ch_versions = ch_versions.mix(MAPSPLICE.out.versions) + ch_bsj_bed_per_sample_tool = ch_bsj_bed_per_sample_tool.mix(MAPSPLICE.out.bed) + } + + ch_bsj_bed_per_sample_tool = ch_bsj_bed_per_sample_tool + .filter{ _meta, bed -> !bed.isEmpty() } + + // + // QUANTIFY BSJs PER TOOL + // + + EXTRACT_COUNTS( ch_bsj_bed_per_sample_tool, [], false ) + ch_versions = ch_versions.mix(EXTRACT_COUNTS.out.versions) + + COMBINE_COUNTS_PER_TOOL( EXTRACT_COUNTS.out.output + .map{ meta, bed -> [[id: meta.tool], bed]} + .groupTuple() ) + ch_versions = ch_versions.mix(COMBINE_COUNTS_PER_TOOL.out.versions) + + // + // APPLY bsj_reads FILTER + // + + ch_bsj_bed_per_sample_tool_filtered = FILTER_BSJS( ch_bsj_bed_per_sample_tool, [], false ).output + ch_versions = ch_versions.mix(FILTER_BSJS.out.versions) + + // + // MERGE BED FILES + // + + BED_ADD_SAMPLE_TOOL( ch_bsj_bed_per_sample_tool_filtered, [], false ) + ch_versions = ch_versions.mix(BED_ADD_SAMPLE_TOOL.out.versions) + ch_bsj_bed_per_sample_tool_meta = BED_ADD_SAMPLE_TOOL.out.output + + COMBINE_TOOLS_PER_SAMPLE( + ch_bsj_bed_per_sample_tool_meta + .map{ meta, bed -> [ [id: meta.id], bed ] } + .groupTuple(), + params.max_shift, + params.consider_strand, + params.min_tools, + 1 + ) + ch_versions = ch_versions.mix(COMBINE_TOOLS_PER_SAMPLE.out.versions) + ch_bsj_bed_per_sample = COMBINE_TOOLS_PER_SAMPLE.out.combined + .filter{ _meta, bed -> !bed.isEmpty() } + + ch_all_samples = ch_bsj_bed_per_sample_tool_meta + .map{ _meta, bed -> [[id: "all"], bed] } + .groupTuple() + + COMBINE_SAMPLES( + ch_all_samples, + params.max_shift, + params.consider_strand, + params.min_tools, + params.min_samples + ) + ch_versions = ch_versions.mix(COMBINE_SAMPLES.out.versions) + ch_bsj_bed_combined = COMBINE_SAMPLES.out.combined + .filter{ _meta, bed -> !bed.isEmpty() } + .collect() + + INVESTIGATE_SHIFTS(ch_all_samples) + ch_versions = ch_versions.mix(INVESTIGATE_SHIFTS.out.versions) + ch_multiqc_files = INVESTIGATE_SHIFTS.out.multiqc + + // + // ANNOTATION + // + + ANNOTATE_COMBINED( ch_bsj_bed_combined, ch_annotation, fasta, circexplorer2_index ) + ch_versions = ch_versions.mix(ANNOTATE_COMBINED.out.versions) + ch_bsj_bed12_combined = ANNOTATE_COMBINED.out.bed12.collect() + ch_bsj_gtf_combined = ANNOTATE_COMBINED.out.gtf + ch_bsj_fasta_combined = ANNOTATE_COMBINED.out.fasta + + ANNOTATE_PER_SAMPLE( ch_bsj_bed_per_sample, ch_annotation, fasta, circexplorer2_index ) + ch_versions = ch_versions.mix(ANNOTATE_PER_SAMPLE.out.versions) + ch_bsj_bed12_per_sample = ANNOTATE_PER_SAMPLE.out.bed12 + ch_bsj_fasta_per_sample = ANNOTATE_PER_SAMPLE.out.fasta + + ANNOTATE_PER_SAMPLE_TOOL( ch_bsj_bed_per_sample_tool, ch_annotation, fasta, circexplorer2_index ) + ch_versions = ch_versions.mix(ANNOTATE_PER_SAMPLE_TOOL.out.versions) + ch_bsj_bed12_per_sample_tool = ANNOTATE_PER_SAMPLE_TOOL.out.bed12 + ch_bsj_fasta_per_sample_tool = ANNOTATE_PER_SAMPLE_TOOL.out.fasta + + // STOP PIPELINE IF NO CIRCULAR RNAs WERE FOUND + Channel.empty() + // First, make sure that all detection processes are finished + // So that even if all hits are filtered out, we will still get the intermediate files + .mix(ch_bsj_bed12_combined) + .mix(ch_bsj_bed12_per_sample) + .mix(ch_bsj_bed12_per_sample_tool) + .mix(ch_bsj_fasta_combined) + .mix(ch_bsj_fasta_per_sample) + .mix(ch_bsj_fasta_per_sample_tool) + // Then, check if any circular RNAs were found + .map{ _meta, _f -> false } + .mix( ch_bsj_bed_combined.map{ _meta, _f -> true } ) + // If no circular RNAs were found, stop the pipeline + .filter{ it } + .ifEmpty{ + error ( + "No circular RNAs were found by at least ${params.min_tools} tools and in at least ${params.min_samples} samples.\n" + + "These thresholds can be adjusted using the parameters 'min_tools' and 'min_samples'.\n" + + "Feel free to check the preliminary results in '${params.outdir}'\n" + + (params.save_intermediates ? "" : + "You can enable saving intermediate files by setting the parameter 'save_intermediates' to 'true'.")) + } + + emit: + bed = ch_bsj_bed_combined + bed12 = ch_bsj_bed12_combined + gtf = ch_bsj_gtf_combined + fasta = ch_bsj_fasta_combined + + bed_per_sample_tool = ch_bsj_bed_per_sample_tool_meta + + multiqc_files = ch_multiqc_files + versions = ch_versions +} diff --git a/subworkflows/local/combine_transcriptomes.nf b/subworkflows/local/combine_transcriptomes.nf new file mode 100644 index 000000000..0a60cd469 --- /dev/null +++ b/subworkflows/local/combine_transcriptomes.nf @@ -0,0 +1,39 @@ +include { GNU_SORT as COMBINE_TRANSCRIPTOME_GTFS } from '../../modules/nf-core/gnu/sort' +include { GAWK as EXCLUDE_OVERLONG_TRANSCRIPTS } from '../../modules/nf-core/gawk' +include { GFFREAD as TRANSCRIPTOME } from '../../modules/nf-core/gffread' + +workflow COMBINE_TRANSCRIPTOMES { + take: + ch_genome_fasta + ch_genome_gtf + ch_circ_gtf + + main: + ch_versions = Channel.empty() + + COMBINE_TRANSCRIPTOME_GTFS( + ch_genome_gtf.mix(ch_circ_gtf).map{_meta, gtf -> gtf}.collect().map{[[id: "transcriptome"], it]}, + ) + ch_versions = ch_versions.mix(COMBINE_TRANSCRIPTOME_GTFS.out.versions) + + EXCLUDE_OVERLONG_TRANSCRIPTS( + COMBINE_TRANSCRIPTOME_GTFS.out.sorted, [], false + ) + ch_versions = ch_versions.mix(EXCLUDE_OVERLONG_TRANSCRIPTS.out.versions) + + TRANSCRIPTOME( + EXCLUDE_OVERLONG_TRANSCRIPTS.out.output, + ch_genome_fasta.map{_meta, fasta -> fasta} + ) + ch_versions = ch_versions.mix(TRANSCRIPTOME.out.versions) + + TRANSCRIPTOME.out.gffread_fasta.ifEmpty { + error 'No transcriptome fasta file produced.' + } + + emit: + fasta = TRANSCRIPTOME.out.gffread_fasta + gtf = EXCLUDE_OVERLONG_TRANSCRIPTS.out.output + + versions = ch_versions +} diff --git a/subworkflows/local/detection_tools/circexplorer2.nf b/subworkflows/local/detection_tools/circexplorer2.nf new file mode 100644 index 000000000..76637707a --- /dev/null +++ b/subworkflows/local/detection_tools/circexplorer2.nf @@ -0,0 +1,24 @@ +include { CIRCEXPLORER2_PARSE as PARSE } from '../../../modules/nf-core/circexplorer2/parse' +include { GAWK as UNIFY } from '../../../modules/nf-core/gawk' + +workflow CIRCEXPLORER2 { + take: + fasta + star_junctions + circexplorer2_index + + main: + ch_versions = Channel.empty() + + PARSE( star_junctions ) + ch_versions = ch_versions.mix(PARSE.out.versions) + + UNIFY( PARSE.out.junction + .map{ meta, txt -> [ meta + [tool: "circexplorer2"], txt ] }, [], false ) + ch_versions = ch_versions.mix(UNIFY.out.versions) + + emit: + bed = UNIFY.out.output + + versions = ch_versions +} diff --git a/subworkflows/local/detection_tools/circrna_finder.nf b/subworkflows/local/detection_tools/circrna_finder.nf new file mode 100644 index 000000000..2bb63ebd3 --- /dev/null +++ b/subworkflows/local/detection_tools/circrna_finder.nf @@ -0,0 +1,28 @@ +include { CIRCRNA_FINDER as MAIN } from '../../../modules/local/circrna_finder' +include { GAWK as UNIFY } from '../../../modules/nf-core/gawk' + +workflow CIRCRNA_FINDER { + take: + fasta + star_sam + star_junctions + star_tab + + main: + ch_versions = Channel.empty() + + ch_joined = star_sam.join(star_junctions).join(star_tab) + .map{ meta, sam, junction, tab -> + [ meta + [tool: "circrna_finder"], [sam, junction, tab] ] } + + MAIN( ch_joined ) + UNIFY( MAIN.out.results, [], false ) + + ch_versions = ch_versions.mix(MAIN.out.versions) + ch_versions = ch_versions.mix(UNIFY.out.versions) + + emit: + bed = UNIFY.out.output + + versions = ch_versions +} diff --git a/subworkflows/local/detection_tools/ciriquant.nf b/subworkflows/local/detection_tools/ciriquant.nf new file mode 100644 index 000000000..a8f999fb8 --- /dev/null +++ b/subworkflows/local/detection_tools/ciriquant.nf @@ -0,0 +1,26 @@ +include { CIRIQUANT as MAIN } from '../../../modules/local/ciriquant/ciriquant' +include { GAWK as UNIFY } from '../../../modules/nf-core/gawk' + +workflow CIRIQUANT { + take: + reads + ch_gtf + ch_fasta + bwa_index + hisat2_index + + main: + ch_versions = Channel.empty() + + MAIN( reads, [[], []], ch_gtf, ch_fasta, bwa_index, hisat2_index ) + UNIFY( MAIN.out.gtf.map{ meta, gtf -> + [ meta + [tool: "ciriquant"], gtf ] }, [], false ) + + ch_versions = ch_versions.mix(MAIN.out.versions) + ch_versions = ch_versions.mix(UNIFY.out.versions) + + emit: + bed = UNIFY.out.output + + versions = ch_versions +} diff --git a/subworkflows/local/detection_tools/dcc.nf b/subworkflows/local/detection_tools/dcc.nf new file mode 100644 index 000000000..19de77a6f --- /dev/null +++ b/subworkflows/local/detection_tools/dcc.nf @@ -0,0 +1,67 @@ +include { STAR_ALIGN as MATE1_1ST_PASS } from '../../../modules/nf-core/star/align' +include { STAR_ALIGN as MATE1_2ND_PASS } from '../../../modules/nf-core/star/align' +include { SJDB as MATE1_SJDB } from '../../../modules/local/star/sjdb' +include { STAR_ALIGN as MATE2_1ST_PASS } from '../../../modules/nf-core/star/align' +include { STAR_ALIGN as MATE2_2ND_PASS } from '../../../modules/nf-core/star/align' +include { SJDB as MATE2_SJDB } from '../../../modules/local/star/sjdb' +include { DCC as MAIN } from '../../../modules/local/dcc' +include { GAWK as UNIFY } from '../../../modules/nf-core/gawk' + +workflow DCC { + take: + reads + ch_fasta + ch_gtf + star_index + star_junction + ignore_sjdbgtf + seq_platform + seq_center + bsj_reads + + main: + ch_versions = Channel.empty() + + mate1 = reads.filter{ meta, _reads -> !meta.single_end } + .map{ meta, _reads -> return [ [id: meta.id, single_end: true], _reads[0] ] } + MATE1_1ST_PASS( mate1, star_index, ch_gtf, ignore_sjdbgtf, seq_platform, seq_center ) + MATE1_SJDB( MATE1_1ST_PASS.out.tab + .map{ _meta, tab -> return tab }.collect().map{[[id: "mate1_sjdb"], it]}, bsj_reads ) + MATE1_2ND_PASS( mate1, star_index, MATE1_SJDB.out.sjtab, ignore_sjdbgtf, seq_platform, seq_center ) + + mate2 = reads.filter{ meta, _reads -> !meta.single_end } + .map{ meta, _reads -> return [ [id: meta.id, single_end: true], _reads[1] ] } + MATE2_1ST_PASS( mate2, star_index, ch_gtf, ignore_sjdbgtf, seq_platform, seq_center ) + MATE2_SJDB( MATE2_1ST_PASS.out.tab + .map{ _meta, tab -> return tab }.collect().map{[[id: "mate2_sjdb"], it]}, bsj_reads ) + MATE2_2ND_PASS( mate2, star_index, MATE2_SJDB.out.sjtab, ignore_sjdbgtf, seq_platform, seq_center ) + + dcc_stage = star_junction.map{ meta, junction -> return [ meta.id, meta, junction]} + .join( + MATE1_2ND_PASS.out.junction.map{ meta, junction -> return [ meta.id, junction] }, + remainder: true + ) + .join( + MATE2_2ND_PASS.out.junction.map{ meta, junction -> return [ meta.id, junction] }, + remainder: true + ) + .map{ _id, meta, junction, _mate1, _mate2 -> return [ meta, junction, _mate1, _mate2 ]} + + dcc = dcc_stage.map{ it -> [ it[0], it[1], it[2] ?: [], it[3] ?: [] ] } + MAIN( dcc, ch_fasta.map{ _meta, fasta -> fasta }, ch_gtf.map{ _meta, gtf -> gtf } ) + UNIFY( MAIN.out.txt.map{ meta, txt -> [ meta + [tool: "dcc"], txt ] }, [], false ) + + ch_versions = ch_versions.mix(MATE1_1ST_PASS.out.versions) + ch_versions = ch_versions.mix(MATE1_SJDB.out.versions) + ch_versions = ch_versions.mix(MATE1_2ND_PASS.out.versions) + ch_versions = ch_versions.mix(MATE2_1ST_PASS.out.versions) + ch_versions = ch_versions.mix(MATE2_SJDB.out.versions) + ch_versions = ch_versions.mix(MATE2_2ND_PASS.out.versions) + ch_versions = ch_versions.mix(MAIN.out.versions) + ch_versions = ch_versions.mix(UNIFY.out.versions) + + emit: + bed = UNIFY.out.output + + versions = ch_versions +} diff --git a/subworkflows/local/detection_tools/find_circ.nf b/subworkflows/local/detection_tools/find_circ.nf new file mode 100644 index 000000000..7e4677b49 --- /dev/null +++ b/subworkflows/local/detection_tools/find_circ.nf @@ -0,0 +1,36 @@ +include { BOWTIE2_ALIGN as ALIGN } from '../../../modules/nf-core/bowtie2/align' +include { SAMTOOLS_VIEW } from '../../../modules/nf-core/samtools/view' +include { SAMTOOLS_INDEX } from '../../../modules/nf-core/samtools/index' +include { FIND_CIRC_ANCHORS as ANCHORS } from '../../../modules/local/find_circ/anchors' +include { FIND_CIRC as MAIN } from '../../../modules/local/find_circ/find_circ' +include { GAWK as UNIFY } from '../../../modules/nf-core/gawk' + +workflow FIND_CIRC { + take: + reads + bowtie2_index + ch_fasta + + main: + ch_versions = Channel.empty() + + ALIGN( reads, bowtie2_index, ch_fasta, false, true ) + SAMTOOLS_INDEX( ALIGN.out.bam ) + SAMTOOLS_VIEW( ALIGN.out.bam.join( SAMTOOLS_INDEX.out.bai ), ch_fasta, [] ) + ANCHORS( SAMTOOLS_VIEW.out.bam ) + MAIN( ANCHORS.out.anchors, bowtie2_index, ch_fasta.map{ _meta, fasta -> fasta } ) + UNIFY( MAIN.out.bed.map{ meta, bed -> + [ meta + [tool: "find_circ"], bed ] }, [], false ) + + ch_versions = ch_versions.mix(ALIGN.out.versions) + ch_versions = ch_versions.mix(SAMTOOLS_INDEX.out.versions) + ch_versions = ch_versions.mix(SAMTOOLS_VIEW.out.versions) + ch_versions = ch_versions.mix(ANCHORS.out.versions) + ch_versions = ch_versions.mix(MAIN.out.versions) + ch_versions = ch_versions.mix(UNIFY.out.versions) + + emit: + bed = UNIFY.out.output + + versions = ch_versions +} diff --git a/subworkflows/local/detection_tools/mapsplice.nf b/subworkflows/local/detection_tools/mapsplice.nf new file mode 100644 index 000000000..07421a6f8 --- /dev/null +++ b/subworkflows/local/detection_tools/mapsplice.nf @@ -0,0 +1,31 @@ +include { MAPSPLICE_ALIGN as ALIGN } from '../../../modules/local/mapsplice/align' +include { CIRCEXPLORER2_PARSE as PARSE } from '../../../modules/nf-core/circexplorer2/parse' +include { GAWK as UNIFY } from '../../../modules/nf-core/gawk' + +workflow MAPSPLICE { + take: + reads + gtf + fasta + bowtie_index + chromosomes + star_junctions + circexplorer2_index + + main: + ch_versions = Channel.empty() + + ALIGN( reads, bowtie_index.map{ _meta, index -> index}, chromosomes, gtf ) + PARSE( ALIGN.out.raw_fusions ) + UNIFY( PARSE.out.junction.map{ meta, bed -> + [ meta + [tool: "mapsplice"], bed ] }, [], false ) + + ch_versions = ch_versions.mix(ALIGN.out.versions) + ch_versions = ch_versions.mix(PARSE.out.versions) + ch_versions = ch_versions.mix(UNIFY.out.versions) + + emit: + bed = UNIFY.out.output + + versions = ch_versions +} diff --git a/subworkflows/local/detection_tools/segemehl.nf b/subworkflows/local/detection_tools/segemehl.nf new file mode 100644 index 000000000..a7a811abd --- /dev/null +++ b/subworkflows/local/detection_tools/segemehl.nf @@ -0,0 +1,37 @@ +include { SEGEMEHL_INDEX as INDEX } from '../../../modules/nf-core/segemehl/index' +include { SEGEMEHL_ALIGN as ALIGN } from '../../../modules/nf-core/segemehl/align' +include { GAWK as EXTRACT } from '../../../modules/nf-core/gawk' +include { GNU_SORT as SORT } from '../../../modules/nf-core/gnu/sort' +include { BEDTOOLS_GROUPBY as GROUP } from '../../../modules/nf-core/bedtools/groupby' +include { GAWK as UNIFY } from '../../../modules/nf-core/gawk' + +workflow SEGEMEHL { + take: + reads + fasta + index + + main: + ch_versions = Channel.empty() + + index = index ?: INDEX( fasta ).index + + ALIGN( reads, fasta, index ) + EXTRACT( ALIGN.out.single_bed + .map{ meta, bed -> [ meta + [tool: "segemehl"], bed ] }, [], false ) + + SORT( EXTRACT.out.output ) + GROUP( SORT.out.sorted, 5 ) + UNIFY( GROUP.out.bed, [], false ) + + ch_versions = ch_versions.mix(ALIGN.out.versions) + ch_versions = ch_versions.mix(EXTRACT.out.versions) + ch_versions = ch_versions.mix(SORT.out.versions) + ch_versions = ch_versions.mix(GROUP.out.versions) + ch_versions = ch_versions.mix(UNIFY.out.versions) + + emit: + bed = UNIFY.out.output + + versions = ch_versions +} diff --git a/subworkflows/local/detection_tools/star2pass.nf b/subworkflows/local/detection_tools/star2pass.nf new file mode 100644 index 000000000..6bf629206 --- /dev/null +++ b/subworkflows/local/detection_tools/star2pass.nf @@ -0,0 +1,34 @@ +include { STAR_ALIGN as PASS_1 } from '../../../modules/nf-core/star/align' +include { STAR_ALIGN as PASS_2 } from '../../../modules/nf-core/star/align' +include { SJDB } from '../../../modules/local/star/sjdb' + + +workflow STAR2PASS { + take: + reads + star_index + ch_gtf + bsj_reads + ignore_sjdbgtf + seq_center + seq_platform + + main: + ch_versions = Channel.empty() + + PASS_1( reads, star_index, ch_gtf, ignore_sjdbgtf, seq_platform, seq_center) + sjdb = PASS_1.out.tab.map{ _meta, tab -> return tab }.collect().map{[[id: "star_sjdb"], it]} + SJDB( sjdb, bsj_reads ) + PASS_2( reads, star_index, SJDB.out.sjtab, ignore_sjdbgtf, seq_platform, seq_center ) + + ch_versions = ch_versions.mix(PASS_1.out.versions) + ch_versions = ch_versions.mix(SJDB.out.versions) + ch_versions = ch_versions.mix(PASS_2.out.versions) + + emit: + junction = PASS_2.out.junction + sam = PASS_2.out.sam + tab = PASS_2.out.tab + + versions = ch_versions +} diff --git a/subworkflows/local/mirna/mirna_bindingsites.nf b/subworkflows/local/mirna/mirna_bindingsites.nf new file mode 100644 index 000000000..59215a696 --- /dev/null +++ b/subworkflows/local/mirna/mirna_bindingsites.nf @@ -0,0 +1,111 @@ +include { BIOAWK as ADD_BACKSPLICE } from '../../../modules/nf-core/bioawk' +include { MIRANDA } from '../../../modules/nf-core/miranda' +include { GAWK as UNIFY_MIRANDA } from '../../../modules/nf-core/gawk' +include { TARGETSCAN } from '../../../modules/local/targetscan/predict' +include { GAWK as UNIFY_TARGETSCAN } from '../../../modules/nf-core/gawk' +include { MIRNA_TARGETS } from '../../../modules/local/mirna_targets' +include { CAT_CAT as COMBINE_BINDINGSITES } from '../../../modules/nf-core/cat/cat' +include { MAJORITY_VOTE } from '../../../modules/local/majority_vote' + +workflow MIRNA_BINDINGSITES { + take: + transcriptome_fasta + circrna_bed12 + mirna_fasta + + main: + ch_versions = Channel.empty() + ch_predictions = Channel.empty() + + // miRNAs can potentially bind to circRNAs right at the backsplice site + // In this case, the miRNA binding sequence would partially overlap with start and end of the circRNA + // To account for this, the first 25bp of the circRNA are added to the end of the circRNA sequence + ADD_BACKSPLICE( transcriptome_fasta ) + ch_versions = ch_versions.mix(ADD_BACKSPLICE.out.versions) + + ch_transcriptome_batches = ADD_BACKSPLICE.out.output + .splitFasta(by: 100, file: true) + .map{ _meta, file -> [[id: "batch_" + file.baseName.split("\\.").last()], file]} + + // + // MIRNA PREDICTION TOOLS: + // + tools_selected = params.mirna_tools.split(',').collect{it.trim().toLowerCase()} + + if (tools_selected.size() == 0) { + error 'No tools selected for miRNA discovery.' + } + + if (tools_selected.contains('targetscan')) { + // + // TARGETSCAN WORKFLOW: + // + TARGETSCAN( ch_transcriptome_batches, formatMiRNAForTargetScan( mirna_fasta ).collect() ) + UNIFY_TARGETSCAN( TARGETSCAN.out.txt, [], false ) + + ch_versions = ch_versions.mix(TARGETSCAN.out.versions) + ch_versions = ch_versions.mix(UNIFY_TARGETSCAN.out.versions) + ch_predictions = ch_predictions.mix(UNIFY_TARGETSCAN.out.output) + } + + if (tools_selected.contains('miranda')) { + // + // MIRANDA WORKFLOW: + // + MIRANDA( ch_transcriptome_batches, mirna_fasta.map{_meta, mature -> mature}.collect() ) + UNIFY_MIRANDA( MIRANDA.out.txt, [], false ) + + ch_versions = ch_versions.mix(MIRANDA.out.versions) + ch_versions = ch_versions.mix(UNIFY_MIRANDA.out.versions) + ch_predictions = ch_predictions.mix(UNIFY_MIRANDA.out.output) + } + + // + // CONSOLIDATE PREDICTIONS WORKFLOW: + // + // TODO: This is an artifact and should be removed if we have a replacement + + // consolidate_targets = TARGETSCAN.out.txt.join(MIRANDA.out.txt).join(circrna_bed12) + consolidate_targets = TARGETSCAN.out.txt.join(MIRANDA.out.txt) + + MIRNA_TARGETS( consolidate_targets ) + + ch_versions = ch_versions.mix(MIRNA_TARGETS.out.versions) + + // + // MAJORITY VOTING: + // + MAJORITY_VOTE( ch_predictions.map{_meta, file -> file}.collect().map{[[id: "mirna"], it]} ) + ch_versions = ch_versions.mix(MAJORITY_VOTE.out.versions) + + emit: + binding_sites = MAJORITY_VOTE.out.targets + + versions = ch_versions +} + +/* +======================================================================================== + FUNCTIONS +======================================================================================== +*/ +// Formatting miRNA input for targetscan +// takes mature.fa, iterates over entries (id, seq) and generates a new file +// writing: +// 1. miR ID +// 2. miR (7bp) seed sequence from mature seq +// 3. Species ID (set to 0000, not important for output). +// to new file +def formatMiRNAForTargetScan(ch_mature) { + + def ch_targetscan_meta_formatted = ch_mature + .map { _meta, mature -> mature } + .splitFasta(record: [id: true, seqString: true]) + .map { record -> + return "${record.id}\t${record.seqString[1..7]}\t0000\n" + } + .collectFile(name: 'mature.txt') + + ch_targetscan_meta_formatted = ch_targetscan_meta_formatted.map { [[id: "mature_targetscan"], it] } + return ch_targetscan_meta_formatted +} diff --git a/subworkflows/local/mirna_prediction.nf b/subworkflows/local/mirna_prediction.nf new file mode 100644 index 000000000..d69d4d2b1 --- /dev/null +++ b/subworkflows/local/mirna_prediction.nf @@ -0,0 +1,83 @@ +// MODULES +include { BIOAWK as ADD_BACKSPLICE } from '../../modules/nf-core/bioawk' +include { DESEQ2_NORMALIZATION } from '../../modules/local/deseq2/normalization' +include { MIRNA_FILTERING } from '../../modules/local/mirna_filtering' +include { COMPUTE_CORRELATIONS } from '../../modules/local/compute_correlations' + +// SUBWORKFLOWS +include { MIRNA_BINDINGSITES } from './mirna/mirna_bindingsites' + +workflow MIRNA_PREDICTION { + + take: + transcriptome_fasta + circrna_annotation + ch_mature + ch_mirna + transcript_counts + quantification_rds + + main: + ch_versions = Channel.empty() + + // + // MIRNA NORMALIZATION WORKFLOW: + // + + if (params.mirna_expression) { + + ch_mirna_normalized = DESEQ2_NORMALIZATION( ch_mirna ).normalized + + ch_versions = ch_versions.mix(DESEQ2_NORMALIZATION.out.versions) + + ch_mirna_filtered = MIRNA_FILTERING(ch_mirna_normalized, + params.mirna_min_sample_percentage, + params.mirna_min_reads + ).filtered + + ch_versions = ch_versions.mix(MIRNA_FILTERING.out.versions) + + // + // MIRNA BINDING SITES: + // + + // Filtering miRNAs from ch_mature if they are not in ch_mirna_filtered. + ch_uniq_mirnas = ch_mirna_filtered.map{ _meta, path -> path }.splitCsv( sep: '\t' ).map{ it[0] }.unique().collect() + + ch_mature = ch_mature + .map{ _meta, path -> path } + .splitFasta( record: [id:true, seqString:true] ) + .combine(ch_uniq_mirnas.map{ it -> [it]}) // Not sure why this mapping is necessary but I think it is + .filter{ record, _mirnas -> + ch_uniq_mirnas.contains(record.id).value + }.map{ record, _mirnas -> + ">${record.id}\n${record.seqString}" + } + .collectFile( name: 'mature_filtered.fa', newLine: true) + .map{ it -> [[id: 'mature_filtered'], it]} + } + + MIRNA_BINDINGSITES( transcriptome_fasta, circrna_annotation, ch_mature ) + ch_versions = ch_versions.mix(MIRNA_BINDINGSITES.out.versions) + + if (params.mirna_expression) { + // + // COMPUTE CORRELATION: + // + ch_binding_site_batches = MIRNA_BINDINGSITES.out.binding_sites + .splitText(by: 100, file: true) + .map{ _meta, file -> [[id: "batch_" + file.baseName.split("\\.").last()], file]} + + COMPUTE_CORRELATIONS(ch_binding_site_batches, ch_mirna_filtered, quantification_rds) + + ch_correlation_results = COMPUTE_CORRELATIONS.out.correlations + .map{_meta, results -> results} + .flatten().collect() + .map{results -> [[id: 'correlation'], results]} + + ch_versions = ch_versions.mix(COMPUTE_CORRELATIONS.out.versions) + } + + emit: + versions = ch_versions +} diff --git a/subworkflows/local/prepare_genome.nf b/subworkflows/local/prepare_genome.nf new file mode 100644 index 000000000..a24693e83 --- /dev/null +++ b/subworkflows/local/prepare_genome.nf @@ -0,0 +1,85 @@ +include { CUSTOM_GTFFILTER as GTFFILTER } from '../../modules/nf-core/custom/gtffilter' +include { SEQKIT_SPLIT } from '../../modules/local/seqkit/split' +include { BOWTIE_BUILD } from '../../modules/nf-core/bowtie/build' +include { BOWTIE2_BUILD } from '../../modules/nf-core/bowtie2/build' +include { BWA_INDEX } from '../../modules/nf-core/bwa/index' +include { HISAT2_EXTRACTSPLICESITES } from '../../modules/nf-core/hisat2/extractsplicesites' +include { HISAT2_BUILD } from '../../modules/nf-core/hisat2/build' +include { STAR_GENOMEGENERATE } from '../../modules/nf-core/star/genomegenerate' +include { GAWK as CLEAN_FASTA } from '../../modules/nf-core/gawk' +include { SAMTOOLS_FAIDX } from '../../modules/nf-core/samtools/faidx' +include { UCSC_GTFTOGENEPRED } from '../../modules/nf-core/ucsc/gtftogenepred' +include { GAWK as CIRCEXPLORER2_REFERENCE } from '../../modules/nf-core/gawk' + +workflow PREPARE_GENOME { + + take: + ch_fasta + ch_gtf + + main: + ch_versions = Channel.empty() + + detection_tools = params.tools.split(',').collect{it.trim().toLowerCase()} + + // MapSplice cannot deal with extra field in the fasta headers + // this removes all additional fields in the headers of the input fasta file + if( detection_tools.contains('mapsplice') ) { + CLEAN_FASTA(ch_fasta, [], false) + ch_fasta = CLEAN_FASTA.out.output + + ch_versions = ch_versions.mix(CLEAN_FASTA.out.versions) + } + + GTFFILTER(ch_gtf, ch_fasta) + ch_gtf = GTFFILTER.out.gtf + ch_versions = ch_versions.mix(GTFFILTER.out.versions) + + UCSC_GTFTOGENEPRED(ch_gtf) + ch_versions = ch_versions.mix(UCSC_GTFTOGENEPRED.out.versions) + + SEQKIT_SPLIT(ch_fasta) + ch_versions = ch_versions.mix(SEQKIT_SPLIT.out.versions) + + BOWTIE_BUILD(ch_fasta) + ch_versions = ch_versions.mix(BOWTIE_BUILD.out.versions) + + BOWTIE2_BUILD(ch_fasta) + ch_versions = ch_versions.mix(BOWTIE2_BUILD.out.versions) + + BWA_INDEX (ch_fasta) + ch_versions = ch_versions.mix(BWA_INDEX.out.versions) + + HISAT2_EXTRACTSPLICESITES(ch_gtf) + ch_versions = ch_versions.mix(HISAT2_EXTRACTSPLICESITES.out.versions) + + HISAT2_BUILD(ch_fasta, ch_gtf, HISAT2_EXTRACTSPLICESITES.out.txt) + ch_versions = ch_versions.mix(HISAT2_BUILD.out.versions) + + STAR_GENOMEGENERATE(ch_fasta, ch_gtf) + ch_versions = ch_versions.mix(STAR_GENOMEGENERATE.out.versions) + + SAMTOOLS_FAIDX(ch_fasta, [[], []]) + ch_versions = ch_versions.mix(SAMTOOLS_FAIDX.out.versions) + + ch_circexplorer2_reference = Channel.empty() + if (detection_tools.intersect(['circexplorer2', 'mapsplice']).size() > 0) { + CIRCEXPLORER2_REFERENCE(UCSC_GTFTOGENEPRED.out.genepred, [], false) + ch_circexplorer2_reference = CIRCEXPLORER2_REFERENCE.out.output.map{ _meta, file -> file }.collect() + ch_versions = ch_versions.mix(CIRCEXPLORER2_REFERENCE.out.versions) + } + + emit: + gtf = ch_gtf + faidx = SAMTOOLS_FAIDX.out.fai + bowtie = params.bowtie ?: BOWTIE_BUILD.out.index + bowtie2 = params.bowtie2 ? Channel.value([[id: "bowtie2"], file(params.bowtie2, checkIfExists: true)]) : BOWTIE2_BUILD.out.index.collect() + bwa = params.bwa ? Channel.value([[id: "bwa"], file(params.bwa, checkIfExists: true)]) : BWA_INDEX.out.index.collect() + hisat2 = params.hisat2 ? Channel.value([[id: "hisat2"], file(params.hisat2, checkIfExists: true)]) : HISAT2_BUILD.out.index.collect() + star = params.star ? Channel.value([[id: "star"], file(params.star, checkIfExists: true)]) : STAR_GENOMEGENERATE.out.index.collect() + circexplorer2 = ch_circexplorer2_reference + chromosomes = SEQKIT_SPLIT.out.split + splice_sites = HISAT2_EXTRACTSPLICESITES.out.txt.collect() + + versions = ch_versions +} diff --git a/subworkflows/local/quantification.nf b/subworkflows/local/quantification.nf new file mode 100644 index 000000000..0c4e6931b --- /dev/null +++ b/subworkflows/local/quantification.nf @@ -0,0 +1,83 @@ +include { PSIRC_QUANT } from './quantification_tools/psirc_quant' +include { CIRIQUANT } from './quantification_tools/ciriquant' +include { COMBINEBEDS_COUNTS as AGGREGATE } from '../../modules/local/combinebeds/counts' + +workflow QUANTIFICATION { + take: + reads + ch_gtf + ch_fasta + ch_transcriptome_fasta + ch_transcriptome_gtf + circ_annotation_bed + circ_annotation_gtf + ch_bsj_bed_per_sample_tool + bootstrap_samples + ch_phenotype + ch_faidx + bwa_index + hisat2_index + + main: + ch_versions = Channel.empty() + ch_gene_counts = Channel.empty() + ch_circ_counts = Channel.empty() + ch_ciriquant = Channel.empty() + ch_stringtie = Channel.empty() + ch_rds = Channel.empty() + + tools_selected = params.quantification_tools.split(',').collect { it.trim().toLowerCase() } + if (tools_selected.size() == 0) { + error('No tools selected for circRNA quantification.') + } + + if (tools_selected.contains('psirc')) { + PSIRC_QUANT( + reads, + ch_transcriptome_fasta, + ch_transcriptome_gtf, + bootstrap_samples, + ch_phenotype, + ch_faidx, + ) + ch_gene_counts = ch_gene_counts.mix(PSIRC_QUANT.out.gene_counts.map { meta, counts -> [meta + [quantification: 'psirc'], counts] }) + ch_circ_counts = ch_circ_counts.mix(PSIRC_QUANT.out.circular_tx_counts.map { meta, counts -> [meta + [quantification: 'psirc'], counts] }) + ch_versions = ch_versions.mix(PSIRC_QUANT.out.versions) + ch_rds = ch_rds.mix(PSIRC_QUANT.out.rds) + } + + if (tools_selected.contains('ciriquant')) { + CIRIQUANT( + reads, + circ_annotation_bed, + ch_gtf, + ch_fasta, + bwa_index, + hisat2_index, + ) + ch_versions = ch_versions.mix(CIRIQUANT.out.versions) + ch_gene_counts = ch_gene_counts.mix(CIRIQUANT.out.gene_tpm) + ch_circ_counts = ch_circ_counts.mix(CIRIQUANT.out.circ_cpm) + ch_ciriquant = ch_ciriquant.mix(CIRIQUANT.out.raw) + ch_stringtie = ch_stringtie.mix(CIRIQUANT.out.stringtie) + } + + aggregations = ['sum', 'max'] + if (tools_selected.intersect(aggregations).size() > 0) { + ch_aggregations = Channel.fromList(tools_selected.intersect(aggregations)) + + AGGREGATE( + ch_aggregations.map { agg -> [[id: agg], agg] }.combine(circ_annotation_bed.map { _meta, bed -> bed }).combine(ch_bsj_bed_per_sample_tool.map { _meta, bed -> bed }.collect().map { beds -> [beds] }), + params.max_shift, + params.consider_strand, + ) + } + + emit: + gene = ch_gene_counts + circ = ch_circ_counts + ciriquant = ch_ciriquant + stringtie = ch_stringtie + rds = ch_rds + versions = ch_versions +} diff --git a/subworkflows/local/quantification_tools/ciriquant.nf b/subworkflows/local/quantification_tools/ciriquant.nf new file mode 100644 index 000000000..91fe901c2 --- /dev/null +++ b/subworkflows/local/quantification_tools/ciriquant.nf @@ -0,0 +1,45 @@ +include { CIRIQUANT as MAIN } from '../../../modules/local/ciriquant/ciriquant' +include { PYGTFTK_TABULATE as EXTRACT_CIRC } from '../../../modules/local/pygtftk/tabulate' +include { GAWK as EXTRACT_GENES } from '../../../modules/nf-core/gawk' +include { JOIN_SAMPLES as JOIN_GENE } from '../../../modules/local/matrix/join_samples' +include { JOIN_SAMPLES as JOIN_CIRC } from '../../../modules/local/matrix/join_samples' + +workflow CIRIQUANT { + take: + reads + ch_bed + ch_gtf + ch_fasta + bwa_index + hisat2_index + + main: + ch_versions = Channel.empty() + + MAIN( reads, ch_bed, ch_gtf, ch_fasta, bwa_index, hisat2_index ) + ch_versions = ch_versions.mix(MAIN.out.versions) + + EXTRACT_CIRC( MAIN.out.gtf ) + ch_versions = ch_versions.mix(EXTRACT_CIRC.out.versions) + + EXTRACT_GENES( MAIN.out.gene_list, [], false ) + ch_versions = ch_versions.mix(EXTRACT_GENES.out.versions) + + JOIN_GENE( + EXTRACT_GENES.out.output.map{meta, table -> [[id: 'gene'], meta.id, table]}.groupTuple() + ) + ch_versions = ch_versions.mix(JOIN_GENE.out.versions) + + JOIN_CIRC( + EXTRACT_CIRC.out.table.map{meta, table -> [[id: 'circ'], meta.id, table]}.groupTuple() + ) + ch_versions = ch_versions.mix(JOIN_CIRC.out.versions) + + emit: + gene_tpm = JOIN_GENE.out.joined + circ_cpm = JOIN_CIRC.out.joined + raw = MAIN.out.gtf + stringtie = MAIN.out.gene_gtf + + versions = ch_versions +} diff --git a/subworkflows/local/quantification_tools/psirc_quant.nf b/subworkflows/local/quantification_tools/psirc_quant.nf new file mode 100644 index 000000000..50cc30ba5 --- /dev/null +++ b/subworkflows/local/quantification_tools/psirc_quant.nf @@ -0,0 +1,114 @@ +include { GAWK as MARK_CIRCULAR } from '../../../modules/nf-core/gawk' +include { PSIRC_INDEX } from '../../../modules/local/psirc/index' +include { PSIRC_QUANT as RUN_PSIRC_QUANT } from '../../../modules/local/psirc/quant' +include { CUSTOM_TX2GENE } from '../../../modules/nf-core/custom/tx2gene' +include { TXIMETA_TXIMPORT } from '../../../modules/nf-core/tximeta/tximport' +include { TXIMETA_TXIMETA } from '../../../modules/local/tximeta/tximeta' +include { MERGE_EXPERIMENTS } from '../../../modules/local/quantification/merge_experiments' +include { CSVTK_JOIN as JOIN_GENE_COUNTS } from '../../../modules/nf-core/csvtk/join' +include { CSVTK_JOIN as JOIN_GENE_TPM } from '../../../modules/nf-core/csvtk/join' +include { CSVTK_JOIN as JOIN_TX_COUNTS } from '../../../modules/nf-core/csvtk/join' +include { CSVTK_JOIN as JOIN_TX_TPM } from '../../../modules/nf-core/csvtk/join' +include { SPLIT_TYPES as SPLIT_TYPES_COUNTS } from '../../../modules/local/quantification/split_types' +include { SPLIT_TYPES as SPLIT_TYPES_TPM } from '../../../modules/local/quantification/split_types' + +workflow PSIRC_QUANT { + take: + reads + ch_transcriptome_fasta + ch_transcriptome_gtf + bootstrap_samples + ch_phenotype + ch_faidx + + main: + ch_versions = Channel.empty() + + MARK_CIRCULAR(ch_transcriptome_fasta, [], false) + ch_versions = ch_versions.mix(MARK_CIRCULAR.out.versions) + + PSIRC_INDEX(MARK_CIRCULAR.out.output) + RUN_PSIRC_QUANT(reads, PSIRC_INDEX.out.index.collect(), MARK_CIRCULAR.out.output, ch_faidx, bootstrap_samples) + + CUSTOM_TX2GENE( + ch_transcriptome_gtf, + RUN_PSIRC_QUANT.out.directory.map { _meta, quant -> quant }.collect().map { [[id: "quant"], it] }, + "kallisto", + "gene_id", + "gene_name", + ) + + TXIMETA_TXIMETA( + RUN_PSIRC_QUANT.out.directory, + "kallisto", + ) + + TXIMETA_TXIMPORT( + RUN_PSIRC_QUANT.out.directory, + CUSTOM_TX2GENE.out.tx2gene, + "kallisto", + ) + + ch_versions = ch_versions.mix( + PSIRC_INDEX.out.versions, + RUN_PSIRC_QUANT.out.versions, + CUSTOM_TX2GENE.out.versions, + TXIMETA_TXIMETA.out.versions, + TXIMETA_TXIMPORT.out.versions, + ) + + JOIN_GENE_COUNTS( + TXIMETA_TXIMPORT.out.counts_gene.map { _meta, counts -> counts }.collect().map { [[id: "gene_counts"], it] } + ) + + JOIN_GENE_TPM( + TXIMETA_TXIMPORT.out.tpm_gene.map { _meta, tpm -> tpm }.collect().map { [[id: "gene_tpm"], it] } + ) + + JOIN_TX_COUNTS( + TXIMETA_TXIMPORT.out.counts_transcript.map { _meta, counts -> counts }.collect().map { [[id: "tx_counts"], it] } + ) + + JOIN_TX_TPM( + TXIMETA_TXIMPORT.out.tpm_transcript.map { _meta, tpm -> tpm }.collect().map { [[id: "tx_tpm"], it] } + ) + + SPLIT_TYPES_COUNTS( + JOIN_TX_COUNTS.out.csv + ) + + SPLIT_TYPES_TPM( + JOIN_TX_TPM.out.csv + ) + + + MERGE_EXPERIMENTS( + TXIMETA_TXIMETA.out.se.map { _meta, se -> se }.collect().map { [[id: "experiments"], it] }, + ch_phenotype.ifEmpty([[], []]), + ch_transcriptome_gtf, + JOIN_TX_TPM.out.csv, + ) + + ch_versions = ch_versions.mix( + JOIN_GENE_COUNTS.out.versions, + JOIN_GENE_TPM.out.versions, + JOIN_TX_COUNTS.out.versions, + JOIN_TX_TPM.out.versions, + SPLIT_TYPES_COUNTS.out.versions, + SPLIT_TYPES_TPM.out.versions, + MERGE_EXPERIMENTS.out.versions, + ) + + emit: + se = MERGE_EXPERIMENTS.out.merged + rds = MERGE_EXPERIMENTS.out.merged + gene_counts = JOIN_GENE_COUNTS.out.csv + gene_tpm = JOIN_GENE_TPM.out.csv + tx_counts = JOIN_TX_COUNTS.out.csv + tx_tpm = JOIN_TX_TPM.out.csv + linear_tx_counts = SPLIT_TYPES_COUNTS.out.linear + linear_tx_tpm = SPLIT_TYPES_TPM.out.linear + circular_tx_counts = SPLIT_TYPES_COUNTS.out.circular + circular_tx_tpm = SPLIT_TYPES_TPM.out.circular + versions = ch_versions +} diff --git a/subworkflows/local/statistical_tests.nf b/subworkflows/local/statistical_tests.nf new file mode 100644 index 000000000..0d9e37ca6 --- /dev/null +++ b/subworkflows/local/statistical_tests.nf @@ -0,0 +1,77 @@ +include { CIRCTEST_PREPARE } from '../../modules/local/circtest/prepare' +include { CIRCTEST_CIRCTEST } from '../../modules/local/circtest/circtest' +include { CIRIQUANT_PREPDE } from '../../modules/local/ciriquant/prepde' +include { STRINGTIE_PREPDE } from '../../modules/local/stringtie/prepde' +include { CIRIQUANT_DE } from '../../modules/local/ciriquant/de' + +workflow STATISTICAL_TESTS { + take: + ch_gene_counts + ch_circ_counts + ch_ciriquant + ch_stringtie + ch_phenotype + + main: + ch_versions = Channel.empty() + + ch_counts = ch_gene_counts.join(ch_circ_counts) + + CIRCTEST_PREPARE(ch_counts) + ch_versions = ch_versions.mix(CIRCTEST_PREPARE.out.versions) + + CIRCTEST_CIRCTEST(CIRCTEST_PREPARE.out.counts, + ch_phenotype) + ch_versions = ch_versions.mix(CIRCTEST_CIRCTEST.out.versions) + + ch_phenotype_annotations = ch_phenotype + .map{ _meta, table -> table.text } + .splitCsv( header: true ) + + ch_condition_samples = ch_phenotype_annotations + .map{ annotations -> [annotations.sample, annotations.condition] } + .join(ch_ciriquant.map{ meta, gtf -> [meta.id, gtf] }) + .join(ch_stringtie.map{ meta, gtf -> [meta.id, gtf] }) + .map{ sample, condition, ciriquant, stringtie -> [condition, [sample, ciriquant, stringtie]] } + .groupTuple() + .map{ condition, samples -> + [condition, samples.sort({ a, b -> a[0] <=> b[0] }).transpose()] + } + .map{ condition, samples -> + [condition, samples[0], samples[1], samples[2]] + } + + ch_condition_pairs = ch_condition_samples + .combine(ch_condition_samples) + .filter{ c_control, _s_control, _f_ciri_control, _f_stringtie_control, c_treatment, _s_treatment, _f_ciri_treatment, _f_stringtie_treatment + -> c_control > c_treatment } + .map{ c_control, s_control, f_ciri_control, f_stringtie_control, c_treatment, s_treatment, f_ciri_treatment, f_stringtie_treatment -> + [ [id: "${c_control}_${c_treatment}"], + s_control + s_treatment, + f_ciri_control + f_ciri_treatment, + f_stringtie_control + f_stringtie_treatment, + ['C'] * s_control.size() + ['T'] * s_treatment.size() + ]} + + CIRIQUANT_PREPDE(ch_condition_pairs + .map{meta, samples, ciri, _stringtie, conditions -> [meta, samples, ciri, conditions]} + ) + ch_versions = ch_versions.mix(CIRIQUANT_PREPDE.out.versions) + + STRINGTIE_PREPDE(ch_condition_pairs + .map{meta, samples, _ciri, stringtie, _conditions -> [meta, samples, stringtie]} + ) + ch_versions = ch_versions.mix(STRINGTIE_PREPDE.out.versions) + + CIRIQUANT_DE( + CIRIQUANT_PREPDE.out.library.join( + CIRIQUANT_PREPDE.out.expression + ).join( + STRINGTIE_PREPDE.out.gene_matrix + ) + ) + ch_versions = ch_versions.mix(CIRIQUANT_DE.out.versions) + + emit: + versions = ch_versions +} diff --git a/subworkflows/local/utils_nfcore_circrna_pipeline/main.nf b/subworkflows/local/utils_nfcore_circrna_pipeline/main.nf new file mode 100644 index 000000000..13086d55c --- /dev/null +++ b/subworkflows/local/utils_nfcore_circrna_pipeline/main.nf @@ -0,0 +1,265 @@ +// +// Subworkflow with functionality specific to the nf-core/circrna pipeline +// + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +include { UTILS_NFSCHEMA_PLUGIN } from '../../nf-core/utils_nfschema_plugin' +include { paramsSummaryMap } from 'plugin/nf-schema' +include { samplesheetToList } from 'plugin/nf-schema' +include { completionEmail } from '../../nf-core/utils_nfcore_pipeline' +include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' +include { imNotification } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + SUBWORKFLOW TO INITIALISE PIPELINE +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow PIPELINE_INITIALISATION { + + take: + version // boolean: Display version and exit + validate_params // boolean: Boolean whether to validate parameters against the schema at runtime + monochrome_logs // boolean: Do not use coloured log outputs + nextflow_cli_args // array: List of positional nextflow CLI args + outdir // string: The output directory where the results will be saved + input // string: Path to input samplesheet + + main: + + ch_versions = Channel.empty() + + // + // Print version and exit if required and dump pipeline parameters to JSON file + // + UTILS_NEXTFLOW_PIPELINE ( + version, + true, + outdir, + workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 + ) + + // + // Validate parameters and generate parameter summary to stdout + // + UTILS_NFSCHEMA_PLUGIN ( + workflow, + validate_params, + null + ) + + // + // Check config provided to the pipeline + // + UTILS_NFCORE_PIPELINE ( + nextflow_cli_args + ) + + // + // Custom validation for pipeline parameters + // + validateInputParameters() + + // + // Create channel from input file provided through params.input + // + + Channel + .fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_input.json")) + .map { + meta, fastq_1, fastq_2 -> + if (!fastq_2) { + return [ meta.id, meta + [ single_end:true ], [ fastq_1 ] ] + } else { + return [ meta.id, meta + [ single_end:false ], [ fastq_1, fastq_2 ] ] + } + } + .groupTuple() + .map { samplesheet -> + validateInputSamplesheet(samplesheet) + } + .set { ch_samplesheet } + + emit: + samplesheet = ch_samplesheet + versions = ch_versions +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + SUBWORKFLOW FOR PIPELINE COMPLETION +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow PIPELINE_COMPLETION { + + take: + email // string: email address + email_on_fail // string: email address sent on pipeline failure + plaintext_email // boolean: Send plain-text email instead of HTML + outdir // path: Path to output directory where results will be published + monochrome_logs // boolean: Disable ANSI colour codes in log output + hook_url // string: hook URL for notifications + multiqc_report // string: Path to MultiQC report + + main: + summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") + def multiqc_reports = multiqc_report.toList() + + // + // Completion email and summary + // + workflow.onComplete { + if (email || email_on_fail) { + completionEmail( + summary_params, + email, + email_on_fail, + plaintext_email, + outdir, + monochrome_logs, + multiqc_reports.getVal(), + ) + } + + completionSummary(monochrome_logs) + if (hook_url) { + imNotification(summary_params, hook_url) + } + } + + workflow.onError { + log.error "Pipeline failed. Please refer to troubleshooting docs: https://nf-co.re/docs/usage/troubleshooting" + } +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + FUNCTIONS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ +// +// Check and validate pipeline parameters +// +def validateInputParameters() { + genomeExistsError() +} + +// +// Validate channels from input samplesheet +// +def validateInputSamplesheet(input) { + def (metas, fastqs) = input[1..2] + + // Check that multiple runs of the same sample are of the same datatype i.e. single-end / paired-end + def endedness_ok = metas.collect{ meta -> meta.single_end }.unique().size == 1 + if (!endedness_ok) { + error("Please check input samplesheet -> Multiple runs of a sample must be of the same datatype i.e. single-end or paired-end: ${metas[0].id}") + } + + // Check that multiple runs of the same sample are of the same strandedness i.e. auto / unstranded / forward / reverse + def strandedness_ok = metas.collect{ it.strandedness }.unique().size == 1 + if (!strandedness_ok) { + error("Please check input samplesheet -> Multiple runs of a sample must be of the same strandedness: ${metas[0].id}") + } + + return [ metas[0], fastqs ] +} +// +// Get attribute from genome config file e.g. fasta +// +def getGenomeAttribute(attribute) { + if (params.genomes && params.genome && params.genomes.containsKey(params.genome)) { + if (params.genomes[ params.genome ].containsKey(attribute)) { + return params.genomes[ params.genome ][ attribute ] + } + } + return null +} + +// +// Exit pipeline if incorrect --genome key provided +// +def genomeExistsError() { + if (params.genomes && params.genome && !params.genomes.containsKey(params.genome)) { + def error_string = "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + + " Genome '${params.genome}' not found in any config files provided to the pipeline.\n" + + " Currently, the available genome keys are:\n" + + " ${params.genomes.keySet().join(", ")}\n" + + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + error(error_string) + } +} +// +// Generate methods description for MultiQC +// +def toolCitationText() { + // TODO nf-core: Optionally add in-text citation tools to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def citation_text = [ + "Tools used in the workflow included:", + "FastQC (Andrews 2010),", + "MultiQC (Ewels et al. 2016)", + "." + ].join(' ').trim() + + return citation_text +} + +def toolBibliographyText() { + // TODO nf-core: Optionally add bibliographic entries to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "
  • Author (2023) Pub name, Journal, DOI
  • " : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def reference_text = [ + "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
  • ", + "
  • Ewels, P., Magnusson, M., Lundin, S., & Käller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
  • " + ].join(' ').trim() + + return reference_text +} + +def methodsDescriptionText(mqc_methods_yaml) { + // Convert to a named map so can be used as with familiar NXF ${workflow} variable syntax in the MultiQC YML file + def meta = [:] + meta.workflow = workflow.toMap() + meta["manifest_map"] = workflow.manifest.toMap() + + // Pipeline DOI + if (meta.manifest_map.doi) { + // Using a loop to handle multiple DOIs + // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers + // Removing ` ` since the manifest.doi is a string and not a proper list + def temp_doi_ref = "" + def manifest_doi = meta.manifest_map.doi.tokenize(",") + manifest_doi.each { doi_ref -> + temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + } + meta["doi_text"] = temp_doi_ref.substring(0, temp_doi_ref.length() - 2) + } else meta["doi_text"] = "" + meta["nodoi_text"] = meta.manifest_map.doi ? "" : "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
  • " + + // Tool references + meta["tool_citations"] = "" + meta["tool_bibliography"] = "" + + // TODO nf-core: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! + // meta["tool_citations"] = toolCitationText().replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") + // meta["tool_bibliography"] = toolBibliographyText() + + + def methods_text = mqc_methods_yaml.text + + def engine = new groovy.text.SimpleTemplateEngine() + def description_html = engine.createTemplate(methods_text).make(meta) + + return description_html.toString() +} diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/main.nf b/subworkflows/nf-core/bam_sort_stats_samtools/main.nf new file mode 100644 index 000000000..b716375b0 --- /dev/null +++ b/subworkflows/nf-core/bam_sort_stats_samtools/main.nf @@ -0,0 +1,50 @@ +// +// Sort, index BAM file and run samtools stats, flagstat and idxstats +// + +include { SAMTOOLS_SORT } from '../../../modules/nf-core/samtools/sort/main' +include { SAMTOOLS_INDEX } from '../../../modules/nf-core/samtools/index/main' +include { BAM_STATS_SAMTOOLS } from '../bam_stats_samtools/main' + +workflow BAM_SORT_STATS_SAMTOOLS { + take: + ch_bam // channel: [ val(meta), [ bam ] ] + ch_fasta // channel: [ val(meta), path(fasta) ] + + main: + + ch_versions = Channel.empty() + + SAMTOOLS_SORT ( ch_bam, ch_fasta ) + ch_versions = ch_versions.mix(SAMTOOLS_SORT.out.versions.first()) + + SAMTOOLS_INDEX ( SAMTOOLS_SORT.out.bam ) + ch_versions = ch_versions.mix(SAMTOOLS_INDEX.out.versions.first()) + + SAMTOOLS_SORT.out.bam + .join(SAMTOOLS_INDEX.out.bai, by: [0], remainder: true) + .join(SAMTOOLS_INDEX.out.csi, by: [0], remainder: true) + .map { + meta, bam, bai, csi -> + if (bai) { + [ meta, bam, bai ] + } else { + [ meta, bam, csi ] + } + } + .set { ch_bam_bai } + + BAM_STATS_SAMTOOLS ( ch_bam_bai, ch_fasta ) + ch_versions = ch_versions.mix(BAM_STATS_SAMTOOLS.out.versions) + + emit: + bam = SAMTOOLS_SORT.out.bam // channel: [ val(meta), [ bam ] ] + bai = SAMTOOLS_INDEX.out.bai // channel: [ val(meta), [ bai ] ] + csi = SAMTOOLS_INDEX.out.csi // channel: [ val(meta), [ csi ] ] + + stats = BAM_STATS_SAMTOOLS.out.stats // channel: [ val(meta), [ stats ] ] + flagstat = BAM_STATS_SAMTOOLS.out.flagstat // channel: [ val(meta), [ flagstat ] ] + idxstats = BAM_STATS_SAMTOOLS.out.idxstats // channel: [ val(meta), [ idxstats ] ] + + versions = ch_versions // channel: [ versions.yml ] +} diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml new file mode 100644 index 000000000..e01f9ccf6 --- /dev/null +++ b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml @@ -0,0 +1,70 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: bam_sort_stats_samtools +description: Sort SAM/BAM/CRAM file +keywords: + - sort + - bam + - sam + - cram +components: + - samtools/sort + - samtools/index + - samtools/stats + - samtools/idxstats + - samtools/flagstat + - bam_stats_samtools +input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - fasta: + type: file + description: Reference genome fasta file + pattern: "*.{fasta,fa}" +# TODO Update when we decide on a standard for subworkflow docs +output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: Sorted BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" + - bai: + type: file + description: BAM/CRAM/SAM index file + pattern: "*.{bai,crai,sai}" + - crai: + type: file + description: BAM/CRAM/SAM index file + pattern: "*.{bai,crai,sai}" + - stats: + type: file + description: File containing samtools stats output + pattern: "*.{stats}" + - flagstat: + type: file + description: File containing samtools flagstat output + pattern: "*.{flagstat}" + - idxstats: + type: file + description: File containing samtools idxstats output + pattern: "*.{idxstats}" + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@ewels" +maintainers: + - "@drpatelh" + - "@ewels" diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test new file mode 100644 index 000000000..821a3cf50 --- /dev/null +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test @@ -0,0 +1,134 @@ +nextflow_workflow { + + name "Test Workflow BAM_SORT_STATS_SAMTOOLS" + script "../main.nf" + workflow "BAM_SORT_STATS_SAMTOOLS" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/bam_sort_stats_samtools" + tag "bam_sort_stats_samtools" + tag "subworkflows/bam_stats_samtools" + tag "bam_stats_samtools" + tag "samtools" + tag "samtools/index" + tag "samtools/sort" + tag "samtools/stats" + tag "samtools/idxstats" + tag "samtools/flagstat" + + test("test_bam_sort_stats_samtools_single_end") { + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, + { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } + ) + } + } + + test("test_bam_sort_stats_samtools_paired_end") { + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, + { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } + ) + } + } + + test("test_bam_sort_stats_samtools_single_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_sort_stats_samtools_paired_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap new file mode 100644 index 000000000..c3c9a0492 --- /dev/null +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap @@ -0,0 +1,330 @@ +{ + "test_bam_sort_stats_samtools_single_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,2fe0f3a7a1f07906061c1dadb62e0d05" + ] + ], + [ + "versions.yml:md5,032c89015461d597fcc5a5331b619d0a", + "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf", + "versions.yml:md5,721391fd94c417808516480c9451c6fd", + "versions.yml:md5,9e12386b91a2977d23292754e3bcb522", + "versions.yml:md5,c294c162aeb09862cc5e55b602647452" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:26:24.36986488" + }, + "test_bam_sort_stats_samtools_paired_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,ba007b13981dad548358c7c957d41e12" + ] + ], + [ + "versions.yml:md5,032c89015461d597fcc5a5331b619d0a", + "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf", + "versions.yml:md5,721391fd94c417808516480c9451c6fd", + "versions.yml:md5,9e12386b91a2977d23292754e3bcb522", + "versions.yml:md5,c294c162aeb09862cc5e55b602647452" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:26:38.683996037" + }, + "test_bam_sort_stats_samtools_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + "versions.yml:md5,032c89015461d597fcc5a5331b619d0a", + "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf", + "versions.yml:md5,721391fd94c417808516480c9451c6fd", + "versions.yml:md5,9e12386b91a2977d23292754e3bcb522", + "versions.yml:md5,c294c162aeb09862cc5e55b602647452" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,032c89015461d597fcc5a5331b619d0a", + "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf", + "versions.yml:md5,721391fd94c417808516480c9451c6fd", + "versions.yml:md5,9e12386b91a2977d23292754e3bcb522", + "versions.yml:md5,c294c162aeb09862cc5e55b602647452" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:07:18.896460047" + }, + "test_bam_sort_stats_samtools_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + "versions.yml:md5,032c89015461d597fcc5a5331b619d0a", + "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf", + "versions.yml:md5,721391fd94c417808516480c9451c6fd", + "versions.yml:md5,9e12386b91a2977d23292754e3bcb522", + "versions.yml:md5,c294c162aeb09862cc5e55b602647452" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,032c89015461d597fcc5a5331b619d0a", + "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf", + "versions.yml:md5,721391fd94c417808516480c9451c6fd", + "versions.yml:md5,9e12386b91a2977d23292754e3bcb522", + "versions.yml:md5,c294c162aeb09862cc5e55b602647452" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:07:39.028688324" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml new file mode 100644 index 000000000..30b69d6a4 --- /dev/null +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/bam_sort_stats_samtools: + - subworkflows/nf-core/bam_sort_stats_samtools/** diff --git a/subworkflows/nf-core/bam_stats_samtools/main.nf b/subworkflows/nf-core/bam_stats_samtools/main.nf new file mode 100644 index 000000000..44d4c010a --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/main.nf @@ -0,0 +1,32 @@ +// +// Run SAMtools stats, flagstat and idxstats +// + +include { SAMTOOLS_STATS } from '../../../modules/nf-core/samtools/stats/main' +include { SAMTOOLS_IDXSTATS } from '../../../modules/nf-core/samtools/idxstats/main' +include { SAMTOOLS_FLAGSTAT } from '../../../modules/nf-core/samtools/flagstat/main' + +workflow BAM_STATS_SAMTOOLS { + take: + ch_bam_bai // channel: [ val(meta), path(bam), path(bai) ] + ch_fasta // channel: [ val(meta), path(fasta) ] + + main: + ch_versions = Channel.empty() + + SAMTOOLS_STATS ( ch_bam_bai, ch_fasta ) + ch_versions = ch_versions.mix(SAMTOOLS_STATS.out.versions) + + SAMTOOLS_FLAGSTAT ( ch_bam_bai ) + ch_versions = ch_versions.mix(SAMTOOLS_FLAGSTAT.out.versions) + + SAMTOOLS_IDXSTATS ( ch_bam_bai ) + ch_versions = ch_versions.mix(SAMTOOLS_IDXSTATS.out.versions) + + emit: + stats = SAMTOOLS_STATS.out.stats // channel: [ val(meta), path(stats) ] + flagstat = SAMTOOLS_FLAGSTAT.out.flagstat // channel: [ val(meta), path(flagstat) ] + idxstats = SAMTOOLS_IDXSTATS.out.idxstats // channel: [ val(meta), path(idxstats) ] + + versions = ch_versions // channel: [ path(versions.yml) ] +} diff --git a/subworkflows/nf-core/bam_stats_samtools/meta.yml b/subworkflows/nf-core/bam_stats_samtools/meta.yml new file mode 100644 index 000000000..809bf736b --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/meta.yml @@ -0,0 +1,43 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: bam_stats_samtools +description: Produces comprehensive statistics from SAM/BAM/CRAM file +keywords: + - statistics + - counts + - bam + - sam + - cram +components: + - samtools/stats + - samtools/idxstats + - samtools/flagstat +input: + - ch_bam_bai: + description: | + The input channel containing the BAM/CRAM and it's index + Structure: [ val(meta), path(bam), path(bai) ] + - ch_fasta: + description: | + Reference genome fasta file + Structure: [ path(fasta) ] +output: + - stats: + description: | + File containing samtools stats output + Structure: [ val(meta), path(stats) ] + - flagstat: + description: | + File containing samtools flagstat output + Structure: [ val(meta), path(flagstat) ] + - idxstats: + description: | + File containing samtools idxstats output + Structure: [ val(meta), path(idxstats)] + - versions: + description: | + Files containing software versions + Structure: [ path(versions.yml) ] +authors: + - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test new file mode 100644 index 000000000..76e7a40a0 --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test @@ -0,0 +1,188 @@ +nextflow_workflow { + + name "Test Workflow BAM_STATS_SAMTOOLS" + script "../main.nf" + workflow "BAM_STATS_SAMTOOLS" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "bam_stats_samtools" + tag "subworkflows/bam_stats_samtools" + tag "samtools" + tag "samtools/flagstat" + tag "samtools/idxstats" + tag "samtools/stats" + + test("test_bam_stats_samtools_single_end") { + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } + ) + } + } + + test("test_bam_stats_samtools_paired_end") { + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } + ) + } + } + + test("test_bam_stats_samtools_paired_end_cram") { + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } + ) + } + } + + test ("test_bam_stats_samtools_single_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_stats_samtools_paired_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_stats_samtools_paired_end_cram - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap new file mode 100644 index 000000000..8ca225263 --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap @@ -0,0 +1,350 @@ +{ + "test_bam_stats_samtools_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:08:35.660286921" + }, + "test_bam_stats_samtools_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:08:24.220305512" + }, + "test_bam_stats_samtools_paired_end_cram - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:08:54.206770141" + }, + "test_bam_stats_samtools_single_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,291bb2393ec947140d12d42c2795b222" + ] + ], + [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:07:49.731645858" + }, + "test_bam_stats_samtools_paired_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,8140d69cdedd77570ca1d7618a744e16" + ] + ], + [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:08:01.421996172" + }, + "test_bam_stats_samtools_paired_end_cram": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,1622856127bafd6cdbadee9cd64ec9b7" + ] + ], + [ + "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a", + "versions.yml:md5,80d8653e01575b3c381d87073f672fb5", + "versions.yml:md5,cb889532237a2f3d813978ac14a12d51" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T08:08:12.640915756" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml new file mode 100644 index 000000000..ec2f2d68f --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/bam_stats_samtools: + - subworkflows/nf-core/bam_stats_samtools/** diff --git a/subworkflows/nf-core/fastqc_trimgalore.nf b/subworkflows/nf-core/fastqc_trimgalore.nf new file mode 100644 index 000000000..50f9dc97b --- /dev/null +++ b/subworkflows/nf-core/fastqc_trimgalore.nf @@ -0,0 +1,48 @@ +// +// Read QC, UMI extraction and trimming +// + +include { FASTQC } from '../../modules/nf-core/fastqc/main' +include { TRIMGALORE } from '../../modules/nf-core/trimgalore/main' + +workflow FASTQC_TRIMGALORE { + take: + reads // channel: [ val(meta), [ reads ] ] + skip_fastqc // boolean: true/false + skip_trimming // boolean: true/false + + main: + ch_versions = Channel.empty() + fastqc_html = Channel.empty() + fastqc_zip = Channel.empty() + if (!skip_fastqc) { + FASTQC ( reads ).html.set { fastqc_html } + fastqc_zip = FASTQC.out.zip + ch_versions = ch_versions.mix(FASTQC.out.versions.first()) + } + + trim_reads = reads + trim_html = Channel.empty() + trim_zip = Channel.empty() + trim_log = Channel.empty() + trimgalore_versions = Channel.empty() + if (!skip_trimming) { + TRIMGALORE ( reads ).reads.set { trim_reads } + trim_html = TRIMGALORE.out.html + trim_zip = TRIMGALORE.out.zip + trim_log = TRIMGALORE.out.log + ch_versions = ch_versions.mix(TRIMGALORE.out.versions.first()) + } + + emit: + reads = trim_reads // channel: [ val(meta), [ reads ] ] + + fastqc_html // channel: [ val(meta), [ html ] ] + fastqc_zip // channel: [ val(meta), [ zip ] ] + + trim_html // channel: [ val(meta), [ html ] ] + trim_zip // channel: [ val(meta), [ zip ] ] + trim_log // channel: [ val(meta), [ txt ] ] + + versions = ch_versions // channel: [ versions.yml ] +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf new file mode 100644 index 000000000..d6e593e85 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -0,0 +1,126 @@ +// +// Subworkflow with functionality that may be useful for any Nextflow pipeline +// + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + SUBWORKFLOW DEFINITION +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow UTILS_NEXTFLOW_PIPELINE { + take: + print_version // boolean: print version + dump_parameters // boolean: dump parameters + outdir // path: base directory used to publish pipeline results + check_conda_channels // boolean: check conda channels + + main: + + // + // Print workflow version and exit on --version + // + if (print_version) { + log.info("${workflow.manifest.name} ${getWorkflowVersion()}") + System.exit(0) + } + + // + // Dump pipeline parameters to a JSON file + // + if (dump_parameters && outdir) { + dumpParametersToJSON(outdir) + } + + // + // When running with Conda, warn if channels have not been set-up appropriately + // + if (check_conda_channels) { + checkCondaChannels() + } + + emit: + dummy_emit = true +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + FUNCTIONS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +// +// Generate version string +// +def getWorkflowVersion() { + def version_string = "" as String + if (workflow.manifest.version) { + def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' + version_string += "${prefix_v}${workflow.manifest.version}" + } + + if (workflow.commitId) { + def git_shortsha = workflow.commitId.substring(0, 7) + version_string += "-g${git_shortsha}" + } + + return version_string +} + +// +// Dump pipeline parameters to a JSON file +// +def dumpParametersToJSON(outdir) { + def timestamp = new java.util.Date().format('yyyy-MM-dd_HH-mm-ss') + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) + + nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") + temp_pf.delete() +} + +// +// When running with -profile conda, warn if channels have not been set-up appropriately +// +def checkCondaChannels() { + def parser = new org.yaml.snakeyaml.Yaml() + def channels = [] + try { + def config = parser.load("conda config --show channels".execute().text) + channels = config.channels + } + catch (NullPointerException e) { + log.debug(e) + log.warn("Could not verify conda channel configuration.") + return null + } + catch (IOException e) { + log.debug(e) + log.warn("Could not verify conda channel configuration.") + return null + } + + // Check that all channels are present + // This channel list is ordered by required channel priority. + def required_channels_in_order = ['conda-forge', 'bioconda'] + def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean + + // Check that they are in the right order + def channel_priority_violation = required_channels_in_order != channels.findAll { ch -> ch in required_channels_in_order } + + if (channels_missing | channel_priority_violation) { + log.warn """\ + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + There is a problem with your Conda configuration! + You will need to set-up the conda-forge and bioconda channels correctly. + Please refer to https://bioconda.github.io/ + The observed channel order is + ${channels} + but the following channel order is required: + ${required_channels_in_order} + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + """.stripIndent(true) + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml b/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml new file mode 100644 index 000000000..e5c3a0a82 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml @@ -0,0 +1,38 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NEXTFLOW_PIPELINE" +description: Subworkflow with functionality that may be useful for any Nextflow pipeline +keywords: + - utility + - pipeline + - initialise + - version +components: [] +input: + - print_version: + type: boolean + description: | + Print the version of the pipeline and exit + - dump_parameters: + type: boolean + description: | + Dump the parameters of the pipeline to a JSON file + - output_directory: + type: directory + description: Path to output dir to write JSON file to. + pattern: "results/" + - check_conda_channel: + type: boolean + description: | + Check if the conda channel priority is correct. +output: + - dummy_emit: + type: boolean + description: | + Dummy emit to make nf-core subworkflows lint happy +authors: + - "@adamrtalbot" + - "@drpatelh" +maintainers: + - "@adamrtalbot" + - "@drpatelh" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test new file mode 100644 index 000000000..68718e4f5 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test @@ -0,0 +1,54 @@ + +nextflow_function { + + name "Test Functions" + script "subworkflows/nf-core/utils_nextflow_pipeline/main.nf" + config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" + tag 'subworkflows' + tag 'utils_nextflow_pipeline' + tag 'subworkflows/utils_nextflow_pipeline' + + test("Test Function getWorkflowVersion") { + + function "getWorkflowVersion" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function dumpParametersToJSON") { + + function "dumpParametersToJSON" + + when { + function { + """ + // define inputs of the function here. Example: + input[0] = "$outputDir" + """.stripIndent() + } + } + + then { + assertAll( + { assert function.success } + ) + } + } + + test("Test Function checkCondaChannels") { + + function "checkCondaChannels" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap new file mode 100644 index 000000000..e3f0baf47 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap @@ -0,0 +1,20 @@ +{ + "Test Function getWorkflowVersion": { + "content": [ + "v9.9.9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:05.308243" + }, + "Test Function checkCondaChannels": { + "content": null, + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:12.425833" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test new file mode 100644 index 000000000..02dbf094c --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test @@ -0,0 +1,113 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NEXTFLOW_PIPELINE" + script "../main.nf" + config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" + workflow "UTILS_NEXTFLOW_PIPELINE" + tag 'subworkflows' + tag 'utils_nextflow_pipeline' + tag 'subworkflows/utils_nextflow_pipeline' + + test("Should run no inputs") { + + when { + workflow { + """ + print_version = false + dump_parameters = false + outdir = null + check_conda_channels = false + + input[0] = print_version + input[1] = dump_parameters + input[2] = outdir + input[3] = check_conda_channels + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should print version") { + + when { + workflow { + """ + print_version = true + dump_parameters = false + outdir = null + check_conda_channels = false + + input[0] = print_version + input[1] = dump_parameters + input[2] = outdir + input[3] = check_conda_channels + """ + } + } + + then { + expect { + with(workflow) { + assert success + assert "nextflow_workflow v9.9.9" in stdout + } + } + } + } + + test("Should dump params") { + + when { + workflow { + """ + print_version = false + dump_parameters = true + outdir = 'results' + check_conda_channels = false + + input[0] = false + input[1] = true + input[2] = outdir + input[3] = false + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should not create params JSON if no output directory") { + + when { + workflow { + """ + print_version = false + dump_parameters = true + outdir = null + check_conda_channels = false + + input[0] = false + input[1] = true + input[2] = outdir + input[3] = false + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config new file mode 100644 index 000000000..a09572e5b --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config @@ -0,0 +1,9 @@ +manifest { + name = 'nextflow_workflow' + author = """nf-core""" + homePage = 'https://127.0.0.1' + description = """Dummy pipeline""" + nextflowVersion = '!>=23.04.0' + version = '9.9.9' + doi = 'https://doi.org/10.5281/zenodo.5070524' +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml new file mode 100644 index 000000000..f84761125 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nextflow_pipeline: + - subworkflows/nf-core/utils_nextflow_pipeline/** diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf new file mode 100644 index 000000000..bfd258760 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -0,0 +1,419 @@ +// +// Subworkflow with utility functions specific to the nf-core pipeline template +// + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + SUBWORKFLOW DEFINITION +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow UTILS_NFCORE_PIPELINE { + take: + nextflow_cli_args + + main: + valid_config = checkConfigProvided() + checkProfileProvided(nextflow_cli_args) + + emit: + valid_config +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + FUNCTIONS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +// +// Warn if a -profile or Nextflow config has not been provided to run the pipeline +// +def checkConfigProvided() { + def valid_config = true as Boolean + if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { + log.warn( + "[${workflow.manifest.name}] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + "Please refer to the quick start section and usage docs for the pipeline.\n " + ) + valid_config = false + } + return valid_config +} + +// +// Exit pipeline if --profile contains spaces +// +def checkProfileProvided(nextflow_cli_args) { + if (workflow.profile.endsWith(',')) { + error( + "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) + } + if (nextflow_cli_args[0]) { + log.warn( + "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) + } +} + +// +// Generate workflow version string +// +def getWorkflowVersion() { + def version_string = "" as String + if (workflow.manifest.version) { + def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' + version_string += "${prefix_v}${workflow.manifest.version}" + } + + if (workflow.commitId) { + def git_shortsha = workflow.commitId.substring(0, 7) + version_string += "-g${git_shortsha}" + } + + return version_string +} + +// +// Get software versions for pipeline +// +def processVersionsFromYAML(yaml_file) { + def yaml = new org.yaml.snakeyaml.Yaml() + def versions = yaml.load(yaml_file).collectEntries { k, v -> [k.tokenize(':')[-1], v] } + return yaml.dumpAsMap(versions).trim() +} + +// +// Get workflow version for pipeline +// +def workflowVersionToYAML() { + return """ + Workflow: + ${workflow.manifest.name}: ${getWorkflowVersion()} + Nextflow: ${workflow.nextflow.version} + """.stripIndent().trim() +} + +// +// Get channel of software versions used in pipeline in YAML format +// +def softwareVersionsToYAML(ch_versions) { + return ch_versions.unique().map { version -> processVersionsFromYAML(version) }.unique().mix(Channel.of(workflowVersionToYAML())) +} + +// +// Get workflow summary for MultiQC +// +def paramsSummaryMultiqc(summary_params) { + def summary_section = '' + summary_params + .keySet() + .each { group -> + def group_params = summary_params.get(group) + // This gets the parameters of that particular group + if (group_params) { + summary_section += "

    ${group}

    \n" + summary_section += "
    \n" + group_params + .keySet() + .sort() + .each { param -> + summary_section += "
    ${param}
    ${group_params.get(param) ?: 'N/A'}
    \n" + } + summary_section += "
    \n" + } + } + + def yaml_file_text = "id: '${workflow.manifest.name.replace('/', '-')}-summary'\n" as String + yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" + yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" + yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" + yaml_file_text += "plot_type: 'html'\n" + yaml_file_text += "data: |\n" + yaml_file_text += "${summary_section}" + + return yaml_file_text +} + +// +// ANSII colours used for terminal logging +// +def logColours(monochrome_logs=true) { + def colorcodes = [:] as Map + + // Reset / Meta + colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" + colorcodes['bold'] = monochrome_logs ? '' : "\033[1m" + colorcodes['dim'] = monochrome_logs ? '' : "\033[2m" + colorcodes['underlined'] = monochrome_logs ? '' : "\033[4m" + colorcodes['blink'] = monochrome_logs ? '' : "\033[5m" + colorcodes['reverse'] = monochrome_logs ? '' : "\033[7m" + colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" + + // Regular Colors + colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" + colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" + colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" + colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" + colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" + colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" + colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" + colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" + + // Bold + colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" + colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" + colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" + colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" + colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" + colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" + colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" + colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" + + // Underline + colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" + colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" + colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" + colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" + colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" + colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" + colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" + colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" + + // High Intensity + colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" + colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" + colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" + colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" + colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" + colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" + colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" + colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" + + // Bold High Intensity + colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" + colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" + colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" + colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" + colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" + colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" + colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" + colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" + + return colorcodes +} + +// Return a single report from an object that may be a Path or List +// +def getSingleReport(multiqc_reports) { + if (multiqc_reports instanceof Path) { + return multiqc_reports + } else if (multiqc_reports instanceof List) { + if (multiqc_reports.size() == 0) { + log.warn("[${workflow.manifest.name}] No reports found from process 'MULTIQC'") + return null + } else if (multiqc_reports.size() == 1) { + return multiqc_reports.first() + } else { + log.warn("[${workflow.manifest.name}] Found multiple reports from process 'MULTIQC', will use only one") + return multiqc_reports.first() + } + } else { + return null + } +} + +// +// Construct and send completion email +// +def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs=true, multiqc_report=null) { + + // Set up the e-mail variables + def subject = "[${workflow.manifest.name}] Successful: ${workflow.runName}" + if (!workflow.success) { + subject = "[${workflow.manifest.name}] FAILED: ${workflow.runName}" + } + + def summary = [:] + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } + + def misc_fields = [:] + misc_fields['Date Started'] = workflow.start + misc_fields['Date Completed'] = workflow.complete + misc_fields['Pipeline script file path'] = workflow.scriptFile + misc_fields['Pipeline script hash ID'] = workflow.scriptId + if (workflow.repository) { + misc_fields['Pipeline repository Git URL'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['Pipeline repository Git Commit'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['Pipeline Git branch/tag'] = workflow.revision + } + misc_fields['Nextflow Version'] = workflow.nextflow.version + misc_fields['Nextflow Build'] = workflow.nextflow.build + misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp + + def email_fields = [:] + email_fields['version'] = getWorkflowVersion() + email_fields['runName'] = workflow.runName + email_fields['success'] = workflow.success + email_fields['dateComplete'] = workflow.complete + email_fields['duration'] = workflow.duration + email_fields['exitStatus'] = workflow.exitStatus + email_fields['errorMessage'] = (workflow.errorMessage ?: 'None') + email_fields['errorReport'] = (workflow.errorReport ?: 'None') + email_fields['commandLine'] = workflow.commandLine + email_fields['projectDir'] = workflow.projectDir + email_fields['summary'] = summary << misc_fields + + // On success try attach the multiqc report + def mqc_report = getSingleReport(multiqc_report) + + // Check if we are only sending emails on failure + def email_address = email + if (!email && email_on_fail && !workflow.success) { + email_address = email_on_fail + } + + // Render the TXT template + def engine = new groovy.text.GStringTemplateEngine() + def tf = new File("${workflow.projectDir}/assets/email_template.txt") + def txt_template = engine.createTemplate(tf).make(email_fields) + def email_txt = txt_template.toString() + + // Render the HTML template + def hf = new File("${workflow.projectDir}/assets/email_template.html") + def html_template = engine.createTemplate(hf).make(email_fields) + def email_html = html_template.toString() + + // Render the sendmail template + def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as MemoryUnit + def smail_fields = [email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes()] + def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") + def sendmail_template = engine.createTemplate(sf).make(smail_fields) + def sendmail_html = sendmail_template.toString() + + // Send the HTML e-mail + def colors = logColours(monochrome_logs) as Map + if (email_address) { + try { + if (plaintext_email) { + new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') + } + // Try to send HTML e-mail using sendmail + def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") + sendmail_tf.withWriter { w -> w << sendmail_html } + ['sendmail', '-t'].execute() << sendmail_html + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (sendmail)-") + } + catch (Exception msg) { + log.debug(msg.toString()) + log.debug("Trying with mail instead of sendmail") + // Catch failures and try with plaintext + def mail_cmd = ['mail', '-s', subject, '--content-type=text/html', email_address] + mail_cmd.execute() << email_html + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (mail)-") + } + } + + // Write summary e-mail HTML to a file + def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") + output_hf.withWriter { w -> w << email_html } + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html") + output_hf.delete() + + // Write summary e-mail TXT to a file + def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") + output_tf.withWriter { w -> w << email_txt } + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt") + output_tf.delete() +} + +// +// Print pipeline summary on completion +// +def completionSummary(monochrome_logs=true) { + def colors = logColours(monochrome_logs) as Map + if (workflow.success) { + if (workflow.stats.ignoredCount == 0) { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Pipeline completed successfully${colors.reset}-") + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-") + } + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.red} Pipeline completed with errors${colors.reset}-") + } +} + +// +// Construct and send a notification to a web server as JSON e.g. Microsoft Teams and Slack +// +def imNotification(summary_params, hook_url) { + def summary = [:] + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } + + def misc_fields = [:] + misc_fields['start'] = workflow.start + misc_fields['complete'] = workflow.complete + misc_fields['scriptfile'] = workflow.scriptFile + misc_fields['scriptid'] = workflow.scriptId + if (workflow.repository) { + misc_fields['repository'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['commitid'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['revision'] = workflow.revision + } + misc_fields['nxf_version'] = workflow.nextflow.version + misc_fields['nxf_build'] = workflow.nextflow.build + misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp + + def msg_fields = [:] + msg_fields['version'] = getWorkflowVersion() + msg_fields['runName'] = workflow.runName + msg_fields['success'] = workflow.success + msg_fields['dateComplete'] = workflow.complete + msg_fields['duration'] = workflow.duration + msg_fields['exitStatus'] = workflow.exitStatus + msg_fields['errorMessage'] = (workflow.errorMessage ?: 'None') + msg_fields['errorReport'] = (workflow.errorReport ?: 'None') + msg_fields['commandLine'] = workflow.commandLine.replaceFirst(/ +--hook_url +[^ ]+/, "") + msg_fields['projectDir'] = workflow.projectDir + msg_fields['summary'] = summary << misc_fields + + // Render the JSON template + def engine = new groovy.text.GStringTemplateEngine() + // Different JSON depending on the service provider + // Defaults to "Adaptive Cards" (https://adaptivecards.io), except Slack which has its own format + def json_path = hook_url.contains("hooks.slack.com") ? "slackreport.json" : "adaptivecard.json" + def hf = new File("${workflow.projectDir}/assets/${json_path}") + def json_template = engine.createTemplate(hf).make(msg_fields) + def json_message = json_template.toString() + + // POST + def post = new URL(hook_url).openConnection() + post.setRequestMethod("POST") + post.setDoOutput(true) + post.setRequestProperty("Content-Type", "application/json") + post.getOutputStream().write(json_message.getBytes("UTF-8")) + def postRC = post.getResponseCode() + if (!postRC.equals(200)) { + log.warn(post.getErrorStream().getText()) + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml b/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml new file mode 100644 index 000000000..d08d24342 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml @@ -0,0 +1,24 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NFCORE_PIPELINE" +description: Subworkflow with utility functions specific to the nf-core pipeline template +keywords: + - utility + - pipeline + - initialise + - version +components: [] +input: + - nextflow_cli_args: + type: list + description: | + Nextflow CLI positional arguments +output: + - success: + type: boolean + description: | + Dummy output to indicate success +authors: + - "@adamrtalbot" +maintainers: + - "@adamrtalbot" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test new file mode 100644 index 000000000..f117040cb --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test @@ -0,0 +1,126 @@ + +nextflow_function { + + name "Test Functions" + script "../main.nf" + config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "utils_nfcore_pipeline" + tag "subworkflows/utils_nfcore_pipeline" + + test("Test Function checkConfigProvided") { + + function "checkConfigProvided" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function checkProfileProvided") { + + function "checkProfileProvided" + + when { + function { + """ + input[0] = [] + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function without logColours") { + + function "logColours" + + when { + function { + """ + input[0] = true + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function with logColours") { + function "logColours" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function getSingleReport with a single file") { + function "getSingleReport" + + when { + function { + """ + input[0] = file(params.modules_testdata_base_path + '/generic/tsv/test.tsv', checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert function.result.contains("test.tsv") } + ) + } + } + + test("Test Function getSingleReport with multiple files") { + function "getSingleReport" + + when { + function { + """ + input[0] = [ + file(params.modules_testdata_base_path + '/generic/tsv/test.tsv', checkIfExists: true), + file(params.modules_testdata_base_path + '/generic/tsv/network.tsv', checkIfExists: true), + file(params.modules_testdata_base_path + '/generic/tsv/expression.tsv', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert function.result.contains("test.tsv") }, + { assert !function.result.contains("network.tsv") }, + { assert !function.result.contains("expression.tsv") } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap new file mode 100644 index 000000000..02c670141 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap @@ -0,0 +1,136 @@ +{ + "Test Function checkProfileProvided": { + "content": null, + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:03.360873" + }, + "Test Function checkConfigProvided": { + "content": [ + true + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:59.729647" + }, + "Test Function without logColours": { + "content": [ + { + "reset": "", + "bold": "", + "dim": "", + "underlined": "", + "blink": "", + "reverse": "", + "hidden": "", + "black": "", + "red": "", + "green": "", + "yellow": "", + "blue": "", + "purple": "", + "cyan": "", + "white": "", + "bblack": "", + "bred": "", + "bgreen": "", + "byellow": "", + "bblue": "", + "bpurple": "", + "bcyan": "", + "bwhite": "", + "ublack": "", + "ured": "", + "ugreen": "", + "uyellow": "", + "ublue": "", + "upurple": "", + "ucyan": "", + "uwhite": "", + "iblack": "", + "ired": "", + "igreen": "", + "iyellow": "", + "iblue": "", + "ipurple": "", + "icyan": "", + "iwhite": "", + "biblack": "", + "bired": "", + "bigreen": "", + "biyellow": "", + "biblue": "", + "bipurple": "", + "bicyan": "", + "biwhite": "" + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:17.969323" + }, + "Test Function with logColours": { + "content": [ + { + "reset": "\u001b[0m", + "bold": "\u001b[1m", + "dim": "\u001b[2m", + "underlined": "\u001b[4m", + "blink": "\u001b[5m", + "reverse": "\u001b[7m", + "hidden": "\u001b[8m", + "black": "\u001b[0;30m", + "red": "\u001b[0;31m", + "green": "\u001b[0;32m", + "yellow": "\u001b[0;33m", + "blue": "\u001b[0;34m", + "purple": "\u001b[0;35m", + "cyan": "\u001b[0;36m", + "white": "\u001b[0;37m", + "bblack": "\u001b[1;30m", + "bred": "\u001b[1;31m", + "bgreen": "\u001b[1;32m", + "byellow": "\u001b[1;33m", + "bblue": "\u001b[1;34m", + "bpurple": "\u001b[1;35m", + "bcyan": "\u001b[1;36m", + "bwhite": "\u001b[1;37m", + "ublack": "\u001b[4;30m", + "ured": "\u001b[4;31m", + "ugreen": "\u001b[4;32m", + "uyellow": "\u001b[4;33m", + "ublue": "\u001b[4;34m", + "upurple": "\u001b[4;35m", + "ucyan": "\u001b[4;36m", + "uwhite": "\u001b[4;37m", + "iblack": "\u001b[0;90m", + "ired": "\u001b[0;91m", + "igreen": "\u001b[0;92m", + "iyellow": "\u001b[0;93m", + "iblue": "\u001b[0;94m", + "ipurple": "\u001b[0;95m", + "icyan": "\u001b[0;96m", + "iwhite": "\u001b[0;97m", + "biblack": "\u001b[1;90m", + "bired": "\u001b[1;91m", + "bigreen": "\u001b[1;92m", + "biyellow": "\u001b[1;93m", + "biblue": "\u001b[1;94m", + "bipurple": "\u001b[1;95m", + "bicyan": "\u001b[1;96m", + "biwhite": "\u001b[1;97m" + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:21.714424" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test new file mode 100644 index 000000000..8940d32d1 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test @@ -0,0 +1,29 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NFCORE_PIPELINE" + script "../main.nf" + config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" + workflow "UTILS_NFCORE_PIPELINE" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "utils_nfcore_pipeline" + tag "subworkflows/utils_nfcore_pipeline" + + test("Should run without failures") { + + when { + workflow { + """ + input[0] = [] + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap new file mode 100644 index 000000000..859d1030f --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap @@ -0,0 +1,19 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + true + ], + "valid_config": [ + true + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:25.726491" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config new file mode 100644 index 000000000..d0a926bf6 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config @@ -0,0 +1,9 @@ +manifest { + name = 'nextflow_workflow' + author = """nf-core""" + homePage = 'https://127.0.0.1' + description = """Dummy pipeline""" + nextflowVersion = '!>=23.04.0' + version = '9.9.9' + doi = 'https://doi.org/10.5281/zenodo.5070524' +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml new file mode 100644 index 000000000..ac8523c9a --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nfcore_pipeline: + - subworkflows/nf-core/utils_nfcore_pipeline/** diff --git a/subworkflows/nf-core/utils_nfschema_plugin/main.nf b/subworkflows/nf-core/utils_nfschema_plugin/main.nf new file mode 100644 index 000000000..4994303ea --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/main.nf @@ -0,0 +1,46 @@ +// +// Subworkflow that uses the nf-schema plugin to validate parameters and render the parameter summary +// + +include { paramsSummaryLog } from 'plugin/nf-schema' +include { validateParameters } from 'plugin/nf-schema' + +workflow UTILS_NFSCHEMA_PLUGIN { + + take: + input_workflow // workflow: the workflow object used by nf-schema to get metadata from the workflow + validate_params // boolean: validate the parameters + parameters_schema // string: path to the parameters JSON schema. + // this has to be the same as the schema given to `validation.parametersSchema` + // when this input is empty it will automatically use the configured schema or + // "${projectDir}/nextflow_schema.json" as default. This input should not be empty + // for meta pipelines + + main: + + // + // Print parameter summary to stdout. This will display the parameters + // that differ from the default given in the JSON schema + // + if(parameters_schema) { + log.info paramsSummaryLog(input_workflow, parameters_schema:parameters_schema) + } else { + log.info paramsSummaryLog(input_workflow) + } + + // + // Validate the parameters using nextflow_schema.json or the schema + // given via the validation.parametersSchema configuration option + // + if(validate_params) { + if(parameters_schema) { + validateParameters(parameters_schema:parameters_schema) + } else { + validateParameters() + } + } + + emit: + dummy_emit = true +} + diff --git a/subworkflows/nf-core/utils_nfschema_plugin/meta.yml b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml new file mode 100644 index 000000000..f7d9f0288 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml @@ -0,0 +1,35 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "utils_nfschema_plugin" +description: Run nf-schema to validate parameters and create a summary of changed parameters +keywords: + - validation + - JSON schema + - plugin + - parameters + - summary +components: [] +input: + - input_workflow: + type: object + description: | + The workflow object of the used pipeline. + This object contains meta data used to create the params summary log + - validate_params: + type: boolean + description: Validate the parameters and error if invalid. + - parameters_schema: + type: string + description: | + Path to the parameters JSON schema. + This has to be the same as the schema given to the `validation.parametersSchema` config + option. When this input is empty it will automatically use the configured schema or + "${projectDir}/nextflow_schema.json" as default. The schema should not be given in this way + for meta pipelines. +output: + - dummy_emit: + type: boolean + description: Dummy emit to make nf-core subworkflows lint happy +authors: + - "@nvnieuwk" +maintainers: + - "@nvnieuwk" diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test new file mode 100644 index 000000000..8fb301648 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test @@ -0,0 +1,117 @@ +nextflow_workflow { + + name "Test Subworkflow UTILS_NFSCHEMA_PLUGIN" + script "../main.nf" + workflow "UTILS_NFSCHEMA_PLUGIN" + + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/utils_nfschema_plugin" + tag "plugin/nf-schema" + + config "./nextflow.config" + + test("Should run nothing") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params") { + + when { + + params { + test_data = '' + outdir = null + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } + + test("Should run nothing - custom schema") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params - custom schema") { + + when { + + params { + test_data = '' + outdir = null + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config new file mode 100644 index 000000000..0907ac58f --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config @@ -0,0 +1,8 @@ +plugins { + id "nf-schema@2.1.0" +} + +validation { + parametersSchema = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + monochromeLogs = true +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json new file mode 100644 index 000000000..331e0d2f4 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json @@ -0,0 +1,96 @@ +{ + "$schema": "https://json-schema.org/draft/2020-12/schema", + "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", + "title": ". pipeline parameters", + "description": "", + "type": "object", + "$defs": { + "input_output_options": { + "title": "Input/output options", + "type": "object", + "fa_icon": "fas fa-terminal", + "description": "Define where the pipeline should find input data and save output data.", + "required": ["outdir"], + "properties": { + "validate_params": { + "type": "boolean", + "description": "Validate parameters?", + "default": true, + "hidden": true + }, + "outdir": { + "type": "string", + "format": "directory-path", + "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.", + "fa_icon": "fas fa-folder-open" + }, + "test_data_base": { + "type": "string", + "default": "https://raw.githubusercontent.com/nf-core/test-datasets/modules", + "description": "Base for test data directory", + "hidden": true + }, + "test_data": { + "type": "string", + "description": "Fake test data param", + "hidden": true + } + } + }, + "generic_options": { + "title": "Generic options", + "type": "object", + "fa_icon": "fas fa-file-import", + "description": "Less common options for the pipeline, typically set in a config file.", + "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", + "properties": { + "help": { + "type": "boolean", + "description": "Display help text.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "version": { + "type": "boolean", + "description": "Display version and exit.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "logo": { + "type": "boolean", + "default": true, + "description": "Display nf-core logo in console output.", + "fa_icon": "fas fa-image", + "hidden": true + }, + "singularity_pull_docker_container": { + "type": "boolean", + "description": "Pull Singularity container from Docker?", + "hidden": true + }, + "publish_dir_mode": { + "type": "string", + "default": "copy", + "description": "Method used to save pipeline results to output directory.", + "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", + "fa_icon": "fas fa-copy", + "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"], + "hidden": true + }, + "monochrome_logs": { + "type": "boolean", + "description": "Use monochrome_logs", + "hidden": true + } + } + } + }, + "allOf": [ + { + "$ref": "#/$defs/input_output_options" + }, + { + "$ref": "#/$defs/generic_options" + } + ] +} diff --git a/tower.yml b/tower.yml new file mode 100644 index 000000000..787aedfe9 --- /dev/null +++ b/tower.yml @@ -0,0 +1,5 @@ +reports: + multiqc_report.html: + display: "MultiQC HTML report" + samplesheet.csv: + display: "Auto-created samplesheet with collated metadata and FASTQ paths" diff --git a/workflows/circrna/main.nf b/workflows/circrna/main.nf new file mode 100644 index 000000000..e0871ad92 --- /dev/null +++ b/workflows/circrna/main.nf @@ -0,0 +1,220 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + IMPORT MODULES / SUBWORKFLOWS / FUNCTIONS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +include { paramsSummaryMap } from 'plugin/nf-schema' +include { paramsSummaryMultiqc } from '../../subworkflows/nf-core/utils_nfcore_pipeline' + +include { softwareVersionsToYAML } from '../../subworkflows/nf-core/utils_nfcore_pipeline' +include { PREPARE_GENOME } from '../../subworkflows/local/prepare_genome' +include { BSJ_DETECTION } from '../../subworkflows/local/bsj_detection' +include { COMBINE_TRANSCRIPTOMES } from '../../subworkflows/local/combine_transcriptomes' +include { QUANTIFICATION } from '../../subworkflows/local/quantification' +include { MIRNA_PREDICTION } from '../../subworkflows/local/mirna_prediction' +include { STATISTICAL_TESTS } from '../../subworkflows/local/statistical_tests' + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + IMPORT NF-CORE MODULES/SUBWORKFLOWS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +// MODULES: +include { MULTIQC } from '../../modules/nf-core/multiqc/main' +include { CAT_FASTQ } from '../../modules/nf-core/cat/fastq/main' + +// SUBWORKFLOWS: +include { FASTQC_TRIMGALORE } from '../../subworkflows/nf-core/fastqc_trimgalore' +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + RUN MAIN WORKFLOW +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow CIRCRNA { + take: + ch_samplesheet + ch_phenotype + ch_fasta + ch_gtf + ch_mature + ch_annotation + ch_versions + ch_mirna + + main: + + ch_multiqc_files = Channel.empty() + + // + // 1. Pre-processing + // + + // SUBWORKFLOW: + ch_samplesheet + .branch { + meta, fastqs -> + single : fastqs.size() == 1 + return [ meta, fastqs.flatten() ] + multiple: fastqs.size() > 1 + return [ meta, fastqs.flatten() ] + } + .set { ch_fastq } + + // MODULE: + // Concatenate FastQ files from same sample if required + CAT_FASTQ (ch_fastq.multiple) + .reads + .mix( + ch_fastq.single + ) + .set { ch_cat_fastq } + ch_versions = ch_versions.mix(CAT_FASTQ.out.versions) + + // SUBORKFLOW: + // Prepare index files &/or use iGenomes if chosen. + PREPARE_GENOME ( + ch_fasta, + ch_gtf + ) + + ch_gtf = PREPARE_GENOME.out.gtf + bowtie_index = PREPARE_GENOME.out.bowtie + bowtie2_index = PREPARE_GENOME.out.bowtie2 + bwa_index = PREPARE_GENOME.out.bwa + chromosomes = PREPARE_GENOME.out.chromosomes + hisat2_index = PREPARE_GENOME.out.hisat2 + circexplorer2_index = PREPARE_GENOME.out.circexplorer2 + star_index = PREPARE_GENOME.out.star + ch_versions = ch_versions.mix(PREPARE_GENOME.out.versions) + + // MODULE: Run FastQC, trimgalore! + FASTQC_TRIMGALORE ( + ch_cat_fastq, + params.skip_fastqc, + params.skip_trimming + ) + ch_versions = ch_versions.mix(FASTQC_TRIMGALORE.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(FASTQC_TRIMGALORE.out.trim_zip.collect{it[1]}.ifEmpty([])) + ch_multiqc_files = ch_multiqc_files.mix(FASTQC_TRIMGALORE.out.trim_log.collect{it[1]}.ifEmpty([])) + + // + // 2. BSJ Discovery + // + + BSJ_DETECTION( + FASTQC_TRIMGALORE.out.reads, + ch_fasta, + ch_gtf, + ch_annotation, + bowtie_index, + bowtie2_index, + bwa_index, + chromosomes, + hisat2_index, + star_index, + circexplorer2_index, + params.bsj_reads + ) + + ch_multiqc_files = ch_multiqc_files.mix(BSJ_DETECTION.out.multiqc_files) + ch_versions = ch_versions.mix(BSJ_DETECTION.out.versions) + + COMBINE_TRANSCRIPTOMES( + ch_fasta, + ch_gtf, + BSJ_DETECTION.out.gtf + ) + + ch_versions = ch_versions.mix(COMBINE_TRANSCRIPTOMES.out.versions) + + // + // 3. circRNA quantification + // + + QUANTIFICATION( + FASTQC_TRIMGALORE.out.reads, + ch_gtf, + ch_fasta, + COMBINE_TRANSCRIPTOMES.out.fasta, + COMBINE_TRANSCRIPTOMES.out.gtf, + BSJ_DETECTION.out.bed12, + BSJ_DETECTION.out.gtf, + BSJ_DETECTION.out.bed_per_sample_tool, + params.bootstrap_samples, + ch_phenotype, + PREPARE_GENOME.out.faidx, + PREPARE_GENOME.out.bwa, + PREPARE_GENOME.out.hisat2 + ) + + ch_versions = ch_versions.mix(QUANTIFICATION.out.versions) + + // + // 4. miRNA prediction + // + + if (params.mature) { + MIRNA_PREDICTION( + COMBINE_TRANSCRIPTOMES.out.fasta, + BSJ_DETECTION.out.bed12, + ch_mature, + ch_mirna, + QUANTIFICATION.out.circ, + QUANTIFICATION.out.rds + ) + ch_versions = ch_versions.mix(MIRNA_PREDICTION.out.versions) + } + + // + // 5. Statistical tests + // + + STATISTICAL_TESTS( + QUANTIFICATION.out.gene, + QUANTIFICATION.out.circ, + QUANTIFICATION.out.ciriquant, + QUANTIFICATION.out.stringtie, + ch_phenotype + ) + + ch_versions = ch_versions.mix(STATISTICAL_TESTS.out.versions) + + + // + // Collate and save software versions + // + softwareVersionsToYAML(ch_versions) + .collectFile(storeDir: "${params.outdir}/pipeline_info", name: 'nf_core_pipeline_software_mqc_versions.yml', sort: true, newLine: true) + .set { ch_collated_versions } + + // MultiQC + ch_multiqc_config = Channel.fromPath("$projectDir/assets/multiqc_config.yml", checkIfExists: true) + ch_multiqc_custom_config = params.multiqc_config ? Channel.fromPath(params.multiqc_config) : Channel.empty() + ch_multiqc_logo = params.multiqc_logo ? Channel.fromPath(params.multiqc_logo) : Channel.empty() + summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") + ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) + ch_multiqc_files = ch_multiqc_files.mix(ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) + ch_multiqc_files = ch_multiqc_files.mix(ch_collated_versions) + + MULTIQC ( + ch_multiqc_files.collect(), + ch_multiqc_config.toList(), + ch_multiqc_custom_config.toList(), + ch_multiqc_logo.toList(), + [], + [] + ) + + emit: + multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html + versions = ch_versions // channel: [ path(versions.yml) ] +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + THE END +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/
    Process Name \\", + " \\ Software Version
    CUSTOM_DUMPSOFTWAREVERSIONSpython3.11.7
    yaml5.4.1
    TOOL1tool10.11.9
    TOOL2tool21.9
    WorkflowNextflow
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls