Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Buffer dtype mismatch #501

Open
carylyoung opened this issue Nov 1, 2024 · 1 comment
Open

Buffer dtype mismatch #501

carylyoung opened this issue Nov 1, 2024 · 1 comment

Comments

@carylyoung
Copy link

I installed following the directions here #158. I downloaded the base pair example file and ran the command provided from examples but I am getting a error. I already tried updating the numpy package and re-installing crispresso2.

(crispresso2_env) C:\Users\youngc\Desktop\CRISPResso_trial>CRISPResso --fastq_r1 base_editor.fastq.gz --amplicon_seq GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG --guide_seq GAGTCCGAGCAGAAGAAGAA --quantification_window_size 10 --quantification_window_center -10 --base_editor_output

                                               ~~~CRISPResso 2~~~                                                   
                        -Analysis of genome editing outcomes from deep sequencing data-                             
                                                                                                                    
                                                        _                                                           
                                                       '  )                                                         
                                                       .-'                                                          
                                                      (____                                                         
                                                   C)|     \                                                        
                                                     \     /                                                        
                                                      \___/                                                         

                                           [CRISPResso version 2.3.2]                                               

[Note that as of version 2.3.0 FLASh and Trimmomatic have been replaced by fastp for read merging and trimming. Accordingly, the --flash_command and --trimmomatic_command parameters have been replaced with --fastp_command. Also, --trimmomatic_options_string has been replaced with --fastp_options_string.

Also in version 2.3.2, when running CRISPRessoPooled in mixed-mode (amplicon file and genome are provided) the default behavior will be as if the --demultiplex_only_at_amplicons parameter is provided. This change means that reads and amplicons do not need to align to the exact locations.]
[For support contact [email protected] or [email protected]]

WARNING @ Fri, 01 Nov 2024 10:28:15 (0.0% done):
Folder CRISPResso_on_base_editor already exists.

CRITICAL @ Fri, 01 Nov 2024 10:28:15 (0.0% done):
Unexpected error, please check your input.

ERROR: Buffer dtype mismatch, expected 'DTYPE_LONG' but got 'long long'

Debug output
Paste the entire output when you run CRISPResso with the flag --debug.
(crispresso2_env) C:\Users\youngc\Desktop\CRISPResso_trial>CRISPResso --debug

                                               ~~~CRISPResso 2~~~                                                   
                        -Analysis of genome editing outcomes from deep sequencing data-                             
                                                                                                                    
                                                        _                                                           
                                                       '  )                                                         
                                                       .-'                                                          
                                                      (____                                                         
                                                   C)|     \                                                        
                                                     \     /                                                        
                                                      \___/                                                         

                                           [CRISPResso version 2.3.2]                                               

[Note that as of version 2.3.0 FLASh and Trimmomatic have been replaced by fastp for read merging and trimming. Accordingly, the --flash_command and --trimmomatic_command parameters have been replaced with --fastp_command. Also, --trimmomatic_options_string has been replaced with --fastp_options_string.

Also in version 2.3.2, when running CRISPRessoPooled in mixed-mode (amplicon file and genome are provided) the default behavior will be as if the --demultiplex_only_at_amplicons parameter is provided. This change means that reads and amplicons do not need to align to the exact locations.]
[For support contact [email protected] or [email protected]]

INFO @ Fri, 01 Nov 2024 10:56:56 (0.0% done):
Creating Folder CRISPResso_on_None

DEBUG @ Fri, 01 Nov 2024 10:56:56 (0.5% done):
CRISPRessoPro not installed

Traceback (most recent call last):
File "C:\Users\youngc\AppData\Local\anaconda3\envs\crispresso2_env\Lib\site-packages\crispresso2-2.1.3-py3.12-win-amd64.egg\CRISPResso2\CRISPRessoCORE.py", line 1444, in main
aln_matrix = CRISPResso2Align.read_matrix(aln_matrix_loc)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "CRISPResso2/CRISPResso2Align.pyx", line 43, in CRISPResso2.CRISPResso2Align.read_matrix
File "CRISPResso2/CRISPResso2Align.pyx", line 51, in CRISPResso2.CRISPResso2Align.read_matrix
ValueError: Buffer dtype mismatch, expected 'DTYPE_LONG' but got 'long long'
CRITICAL @ Fri, 01 Nov 2024 10:56:56 (0.5% done):
Traceback (most recent call last):
File "C:\Users\youngc\AppData\Local\anaconda3\envs\crispresso2_env\Lib\site-packages\crispresso2-2.1.3-py3.12-win-amd64.egg\CRISPResso2\CRISPRessoCORE.py", line 1444, in main
aln_matrix = CRISPResso2Align.read_matrix(aln_matrix_loc)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "CRISPResso2/CRISPResso2Align.pyx", line 43, in CRISPResso2.CRISPResso2Align.read_matrix
File "CRISPResso2/CRISPResso2Align.pyx", line 51, in CRISPResso2.CRISPResso2Align.read_matrix
ValueError: Buffer dtype mismatch, expected 'DTYPE_LONG' but got 'long long'

CRITICAL @ Fri, 01 Nov 2024 10:56:56 (0.5% done):
Unexpected error, please check your input.

ERROR: Buffer dtype mismatch, expected 'DTYPE_LONG' but got 'long long'

@Colelyman
Copy link
Contributor

Hi @carylyoung,

Thanks for using CRISPResso and sorry to hear that you are running into this issue. Would you mind providing the version of numpy that you are using?

Also, it looks like you are installing CRISPResso on Windows. On Windows we recommend using either WSL or Docker because it can be difficult to install samtools and other dependencies of CRISPResso.

Thank you,
Cole

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

2 participants