Updating workflows/epigenetics/chipseq-sr from 1.0 to 1.1

[gxydevbot]

Hello! This is an automated update of the following workflow: workflows/epigenetics/chipseq-sr. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

• toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.0.1+galaxy2 should be updated to toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.0.1+galaxy3
• toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3 should be updated to toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy4

The workflow release number has been updated from 1.0 to 1.1.

If you want to skip this change, close this PR without deleting the branch. It will be reopened if another change is detected.
Any commit from another author than 'planemo-autoupdate' will prevent more auto-updates.
To ignore manual changes and allow autoupdates, delete the branch.

[github-actions]

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

• ❌ chipseq-sr.ga_0

  Problems:

  • Output with path /tmp/tmp0cp4pa2q/MultiQC on dataset 8, 12, and 21 and collection 5, 10, and 15 Stats__02251a24-ec46-4186-8282-6192da1fac17.tabular different than expected
    Expected line 'Sample	macs2-d	macs2-treatment_redundant_rate	macs2-peak_count	bowtie_2_hisat2-overall_alignment_rate	fastp-pct_duplication	fastp-after_filtering_q30_rate	fastp-after_filtering_q30_bases	fastp-filtering_result_passed_filter_reads	fastp-after_filtering_gc_content	fastp-pct_surviving	fastp-pct_adapter' in output ('Sample	macs2-d	macs2-treatment_redundant_rate	macs2-peak_count	bowtie_2_hisat2-overall_alignment_rate	fastp-after_filtering_q30_rate	fastp-after_filtering_q30_bases	fastp-filtering_result_passed_filter_reads	fastp-after_filtering_gc_content	fastp-pct_surviving	fastp-pct_adapter
    wt_H3K4me3	200.0	0.0	9	98.27	93.5014	2.374989	0.049812999999999996	57.69879999999999	99.626	0.122
    ')
    

  Workflow invocation details

  • Invocation Messages

  • Steps

    • Step 1: SR fastq input:

      • step_state: scheduled

    • Step 2: Adapter sequence:

      • step_state: scheduled

    • Step 11: summary of MACS2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • grep -P -A 0 -B 0 --no-group-separator  -i -- '^#' '/tmp/tmpvu35d199/files/a/2/b/dataset_a2b73ef1-7abf-4d63-a547-18646eec030d.dat' > '/tmp/tmpvu35d199/job_working_directory/000/6/outputs/dataset_df786bc2-2869-45a9-8322-470efc732938.dat'

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"1013c958be0f11f0bb737ced8d805866"
            case_sensitive	"-i"
            chromInfo	"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"
            color	"NOCOLOR"
            dbkey	"mm10"
            invert	""
            lines_after	"0"
            lines_before	"0"
            regex_type	"-P"
            url_paste	"^#"

    • Step 12: Bigwig from MACS2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • grep -v "^track" '/tmp/tmpvu35d199/files/9/9/6/dataset_99619a33-acf0-4a3a-a83e-dc26ec3754cc.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len' '/tmp/tmpvu35d199/job_working_directory/000/7/outputs/dataset_3dcaf337-43c2-4b2f-9e18-625e99f44f09.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"bedgraph"
            __workflow_invocation_uuid__	"1013c958be0f11f0bb737ced8d805866"
            chromInfo	"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"
            dbkey	"mm10"
            settings	{"__current_case__": 0, "settingsType": "preset"}

    • Step 13: MultiQC:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastp_0 &&     ln -s '/tmp/tmpvu35d199/files/e/1/6/dataset_e16322e1-ace9-4166-81d9-2495db3f8cb8.dat' 'multiqc_WDir/fastp_0/wt_H3K4me3fastp.json' && grep -q "report_title" 'multiqc_WDir/fastp_0/wt_H3K4me3fastp.json' || die "'report_title' or 'report_title' not found in the file" &&  mkdir multiqc_WDir/bowtie2_1 &&         grep -Pq '% overall alignment rate' /tmp/tmpvu35d199/files/1/6/1/dataset_1614e786-592a-4ab9-bdd9-6d3e141ff739.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmpvu35d199/files/1/6/1/dataset_1614e786-592a-4ab9-bdd9-6d3e141ff739.dat' 'multiqc_WDir/bowtie2_1/wt_H3K4me3'  &&    mkdir multiqc_WDir/macs2_2 &&    grep -q "# This file is generated by MACS" /tmp/tmpvu35d199/files/a/2/b/dataset_a2b73ef1-7abf-4d63-a547-18646eec030d.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmpvu35d199/files/a/2/b/dataset_a2b73ef1-7abf-4d63-a547-18646eec030d.dat' 'multiqc_WDir/macs2_2/wt_H3K4me3_peaks.xls' &&   multiqc multiqc_WDir --filename 'report'    --export   && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

          Exit Code:

          • 0

          Standard Error:

          • /// MultiQC 🔍 v1.27
            
                 version_check | MultiQC Version v1.32 now available!
                   file_search | Search path: /tmp/tmpvu35d199/job_working_directory/000/8/working/multiqc_WDir
            
                         macs2 | Found 1 logs
                       bowtie2 | Found 1 reports
                         fastp | Found 1 reports
                 write_results | Rendering plots. Export plots to formats png, svg, pdf is requested, so it might take a while. To disable plot export, set `export_plots: false` in config, or remove the `--export-plots` command line flag
            
                 write_results | Data        : report_data
                 write_results | Report      : report.html
                 write_results | Plots       : report_plots
                       multiqc | MultiQC complete
            

          Standard Output:

          • total 396
            -rw-r--r-- 1 1001 1001     88 Nov 10 08:35 bowtie2_se_plot.txt
            -rw-r--r-- 1 1001 1001   1069 Nov 10 08:35 fastp-seq-content-gc-plot_Read_1_After_filtering.txt
            -rw-r--r-- 1 1001 1001   1048 Nov 10 08:35 fastp-seq-content-gc-plot_Read_1_Before_filtering.txt
            -rw-r--r-- 1 1001 1001    723 Nov 10 08:35 fastp-seq-content-n-plot_Read_1_After_filtering.txt
            -rw-r--r-- 1 1001 1001    703 Nov 10 08:35 fastp-seq-content-n-plot_Read_1_Before_filtering.txt
            -rw-r--r-- 1 1001 1001    858 Nov 10 08:35 fastp-seq-quality-plot_Read_1_After_filtering.txt
            -rw-r--r-- 1 1001 1001    863 Nov 10 08:35 fastp-seq-quality-plot_Read_1_Before_filtering.txt
            -rw-r--r-- 1 1001 1001    100 Nov 10 08:35 fastp_filtered_reads_plot.txt
            -rw-r--r-- 1 1001 1001    894 Nov 10 08:35 multiqc.log
            -rw-r--r-- 1 1001 1001    167 Nov 10 08:35 multiqc_bowtie2.txt
            -rw-r--r-- 1 1001 1001    422 Nov 10 08:35 multiqc_citations.txt
            -rw-r--r-- 1 1001 1001 298554 Nov 10 08:35 multiqc_data.json
            -rw-r--r-- 1 1001 1001  42228 Nov 10 08:35 multiqc_fastp.txt
            -rw-r--r-- 1 1001 1001    377 Nov 10 08:35 multiqc_general_stats.txt
            -rw-r--r-- 1 1001 1001    194 Nov 10 08:35 multiqc_macs.txt
            -rw-r--r-- 1 1001 1001     47 Nov 10 08:35 multiqc_software_versions.txt
            -rw-r--r-- 1 1001 1001    413 Nov 10 08:35 multiqc_sources.txt
            

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"1013c958be0f11f0bb737ced8d805866"
            chromInfo	"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"
            comment	""
            dbkey	"mm10"
            export	true
            flat	false
            image_content_input	None
            png_plots	false
            results	[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 6, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 8, "src": "hdca"}]}, "software": "macs2"}}]
            title	""

    • Step 3: Percentage of bad quality bases per read:

      • step_state: scheduled

    • Step 4: Reference genome:

      • step_state: scheduled

    • Step 5: Effective genome size:

      • step_state: scheduled

    • Step 6: Normalize profile:

      • step_state: scheduled

    • Step 7: Fastp (remove adapter and bad quality reads):

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • ln -sf '/tmp/tmpvu35d199/files/b/3/0/dataset_b30a3190-581b-4001-a069-ed1211640fd4.dat' 'wt_H3K4me3.fastqsanger.gz' &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for wt_H3K4me3.fastqsanger.gz'  -i 'wt_H3K4me3.fastqsanger.gz'   -o first.fastqsanger.gz     --adapter_sequence 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'                  -q 30 -u 70              --dont_eval_duplication                  && mv first.fastqsanger.gz '/tmp/tmpvu35d199/job_working_directory/000/2/outputs/dataset_0be09ca4-ea76-408f-a0f2-3d84aad86bda.dat'

          Exit Code:

          • 0

          Standard Error:

          • Read1 before filtering:
            total reads: 50000
            total bases: 2550000
            Q20 bases: 2486726(97.5187%)
            Q30 bases: 2377575(93.2382%)
            Q40 bases: 936574(36.7284%)
            
            Read1 after filtering:
            total reads: 49813
            total bases: 2540057
            Q20 bases: 2482579(97.7371%)
            Q30 bases: 2374989(93.5014%)
            Q40 bases: 936420(36.8661%)
            
            Filtering result:
            reads passed filter: 49813
            reads failed due to low quality: 187
            reads failed due to too many N: 0
            reads failed due to too short: 0
            reads with adapter trimmed: 61
            bases trimmed due to adapters: 406
            
            JSON report: fastp.json
            HTML report: fastp.html
            
            fastp --thread 1 --report_title fastp report for wt_H3K4me3.fastqsanger.gz -i wt_H3K4me3.fastqsanger.gz -o first.fastqsanger.gz --adapter_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -q 30 -u 70 --dont_eval_duplication 
            fastp v1.0.1, time used: 1 seconds
            

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"1013c958be0f11f0bb737ced8d805866"
            chromInfo	"/tmp/tmpvu35d199/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            duplicated_reads	{"handling_options": {"__current_case__": 0, "eval_dups": "--dont_eval_duplication"}}
            filter_options	{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": "30", "unqualified_percent_limit": "70"}}
            output_options	{"report_html": true, "report_json": true}
            overrepresented_sequence_analysis	{"overrepresentation_analysis": false, "overrepresentation_sampling": null}
            read_mod_options	{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_front_select": {"__current_case__": 1, "cut_front": ""}, "cut_right_select": {"__current_case__": 1, "cut_right": ""}, "cut_tail_select": {"__current_case__": 1, "cut_tail": ""}}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": null, "umi_prefix": null}}
            single_paired	{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}

    • Step 8: Bowtie2 map on reference:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmpvu35d199/files/0/b/e/dataset_0be09ca4-ea76-408f-a0f2-3d84aad86bda.dat' input_f.fastq.gz &&   THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi &&   bowtie2  -p "$THREADS"  -x '/cvmfs/data.galaxyproject.org/byhand/mm10/bowtie2_index/mm10'   -U 'input_f.fastq.gz'                 2> >(tee '/tmp/tmpvu35d199/job_working_directory/000/3/outputs/dataset_1614e786-592a-4ab9-bdd9-6d3e141ff739.dat' >&2)  | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmpvu35d199/job_working_directory/000/3/outputs/dataset_17806c29-7319-487b-9dfa-f977587500c1.dat'

          Exit Code:

          • 0

          Standard Error:

          • 49813 reads; of these:
              49813 (100.00%) were unpaired; of these:
                863 (1.73%) aligned 0 times
                44357 (89.05%) aligned exactly 1 time
                4593 (9.22%) aligned >1 times
            98.27% overall alignment rate
            

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __job_resource	{"__current_case__": 0, "__job_resource__select": "no"}
            __workflow_invocation_uuid__	"1013c958be0f11f0bb737ced8d805866"
            analysis_type	{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "no_presets"}
            chromInfo	"/tmp/tmpvu35d199/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            library	{"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false}
            reference_genome	{"__current_case__": 0, "index": "mm10", "source": "indexed"}
            rg	{"__current_case__": 3, "rg_selector": "do_not_set"}
            sam_options	{"__current_case__": 1, "sam_options_selector": "no"}
            save_mapping_stats	true

    • Step 9: filter MAPQ30:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • ln -s '/tmp/tmpvu35d199/files/1/7/8/dataset_17806c29-7319-487b-9dfa-f977587500c1.dat' input.bam && ln -s '/tmp/tmpvu35d199/files/_metadata_files/9/6/2/metadata_962693bf-10e6-46cc-807d-132d26818e9a.dat' input.bai && samtools view -o '/tmp/tmpvu35d199/job_working_directory/000/4/outputs/dataset_90306a18-ce09-433a-830f-704216bd4e8f.dat' -h   -b  -q 30 input.bam

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"bam"
            __workflow_invocation_uuid__	"1013c958be0f11f0bb737ced8d805866"
            bed_file	None
            chromInfo	"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"
            dbkey	"mm10"
            flag	{"__current_case__": 0, "filter": "no"}
            header	"-h"
            library	""
            mapq	"30"
            outputtype	"bam"
            possibly_select_inverse	false
            read_group	""
            regions	""

    • Step 10: Call Peaks with MACS2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmpvu35d199/files/9/0/3/dataset_90306a18-ce09-433a-830f-704216bd4e8f.dat'  --name wt_H3K4me3    --format BAM   --gsize '1870000000'      --SPMR     --call-summits  --keep-dup '1'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '0'  2>&1 > macs2_stderr) && cp wt_H3K4me3_peaks.xls '/tmp/tmpvu35d199/job_working_directory/000/5/outputs/dataset_a2b73ef1-7abf-4d63-a547-18646eec030d.dat'   && ( count=`ls -1 wt_H3K4me3* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmpvu35d199/job_working_directory/000/5/outputs/dataset_aaa15de5-fd9d-42e2-abd0-6a1abee25ba8_files' && cp -r wt_H3K4me3* '/tmp/tmpvu35d199/job_working_directory/000/5/outputs/dataset_aaa15de5-fd9d-42e2-abd0-6a1abee25ba8_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmpvu35d199/job_working_directory/000/5/outputs/dataset_aaa15de5-fd9d-42e2-abd0-6a1abee25ba8_files' macs2_stderr > '/tmp/tmpvu35d199/job_working_directory/000/5/outputs/dataset_aaa15de5-fd9d-42e2-abd0-6a1abee25ba8.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

          Exit Code:

          • 0

          Standard Output:

          • INFO  @ Mon, 10 Nov 2025 08:34:31: 
            # Command line: callpeak -t /tmp/tmpvu35d199/files/9/0/3/dataset_90306a18-ce09-433a-830f-704216bd4e8f.dat --name wt_H3K4me3 --format BAM --gsize 1870000000 --SPMR --call-summits --keep-dup 1 --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift 0
            # ARGUMENTS LIST:
            # name = wt_H3K4me3
            # format = BAM
            # ChIP-seq file = ['/tmp/tmpvu35d199/files/9/0/3/dataset_90306a18-ce09-433a-830f-704216bd4e8f.dat']
            # control file = None
            # effective genome size = 1.87e+09
            # band width = 300
            # model fold = [5, 50]
            # qvalue cutoff = 5.00e-02
            # The maximum gap between significant sites is assigned as the read length/tag size.
            # The minimum length of peaks is assigned as the predicted fragment length "d".
            # Larger dataset will be scaled towards smaller dataset.
            # Range for calculating regional lambda is: 10000 bps
            # Broad region calling is off
            # Paired-End mode is off
            # Searching for subpeak summits is on
            # MACS will save fragment pileup signal per million reads
             
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1 read tag files... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1 read treatment tags... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: 44568 reads have been read. 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1 tag size is determined as 51 bps 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1 tag size = 51.0 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1  total tags in treatment: 44568 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1 user defined the maximum tags... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1 filter out redundant tags at the same location and the same strand by allowing at most 1 tag(s) 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1  tags after filtering in treatment: 44528 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1  Redundant rate of treatment: 0.00 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #1 finished! 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #2 Build Peak Model... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #2 Skipped... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #2 Use 200 as fragment length 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #3 Call peaks... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #3 Going to call summits inside each peak ... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #3 Pre-compute pvalue-qvalue table... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #3 In the peak calling step, the following will be performed simultaneously: 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... wt_H3K4me3_treat_pileup.bdg 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #3   Write bedGraph files for control lambda (after scaling if necessary)... wt_H3K4me3_control_lambda.bdg 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #3   --SPMR is requested, so pileup will be normalized by sequencing depth in million reads. 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #3 Call peaks for each chromosome... 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #4 Write output xls file... wt_H3K4me3_peaks.xls 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #4 Write peak in narrowPeak format file... wt_H3K4me3_peaks.narrowPeak 
            INFO  @ Mon, 10 Nov 2025 08:34:31: #4 Write summits bed file... wt_H3K4me3_summits.bed 
            INFO  @ Mon, 10 Nov 2025 08:34:31: Done! 
            

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"1013c958be0f11f0bb737ced8d805866"
            advanced_options	{"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 1, "keep_dup_options_selector": "1"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": true, "to_large": false}
            chromInfo	"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"
            control	{"__current_case__": 1, "c_select": "No"}
            cutoff_options	{"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}
            dbkey	"mm10"
            effective_genome_size_options	{"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "1870000000"}
            format	"BAM"
            nomodel_type	{"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "0"}
            outputs	["peaks_tabular", "summits", "bdg", "html"]
            treatment	{"__current_case__": 0, "input_treatment_file": {"values": [{"id": 7, "src": "dce"}]}, "t_multi_select": "No"}

  • Other invocation details

    • history_id

      • 50a055e64e17d0e0

    • history_state

      • ok

    • invocation_id

      • 50a055e64e17d0e0

    • invocation_state

      • scheduled

    • workflow_id

      • 50a055e64e17d0e0