Updating workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4 from 0.3.8 to 0.3.9

[gxydevbot]

Hello! This is an automated update of the following workflow: workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

• toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.9+galaxy0

The workflow release number has been updated from 0.3.8 to 0.3.9.

If you want to skip this change, close this PR without deleting the branch. It will be reopened if another change is detected.
Any commit from another author than 'planemo-autoupdate' will prevent more auto-updates.
To ignore manual changes and allow autoupdates, delete the branch.

[github-actions]

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

• ❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0

  Execution Problem:

  • Failed to run workflow, invocation ended in [failed] state.
    

  Workflow invocation details

  • Invocation Messages

  • Steps

    • Step 1: Species Name:

      • step_state: scheduled

    • Step 2: Assembly Name:

      • step_state: scheduled

    • Step 11: Name for Haplotype 2:

      • step_state: scheduled

    • Step 12: Bits for bloom filter:

      • step_state: scheduled

    • Step 13: Homozygous Read Coverage:

      • step_state: scheduled

    • Step 14: Genomescope Model Parameters:

      • step_state: scheduled

    • Step 15: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "Random Name", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 16: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "randName4", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • ln -f -s '/tmp/tmpxdtbt6qb/files/8/a/5/dataset_8a5f9657-36b4-43dc-bc96-b67e34917cce.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 0, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
            other_trimming_options	{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	["report", "json_stats"]
            read_mod_options	{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}

    • Step 18: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is skipped

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"}
            other_trimming_options	{"cut": "5", "cut2": "5", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	None
            read_mod_options	{"length_tag": null, "rename": null, "strip_suffix": null, "zero_cap": false}

    • Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpxdtbt6qb/files/9/9/7/dataset_997cd3e8-a37b-40ac-929c-64b5d145b226.dat' > '/tmp/tmpxdtbt6qb/job_working_directory/000/11/outputs/dataset_b0240ee5-ed98-40ba-a1c6-6cbbaf2c311a.dat'

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            case_sensitive	"-i"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            color	"NOCOLOR"
            dbkey	"?"
            invert	""
            lines_after	"0"
            lines_before	"0"
            regex_type	"-G"
            url_paste	"Haploid"

    • Step 20: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "vertebrata_odb10", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 3: Pacbio Reads:

      • step_state: scheduled

    • Step 21: toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}}

    • Step 22: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            avoid_scientific_notation	false
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            error_handling	{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
            ops	{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}

    • Step 23: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            comment	""
            dbkey	"?"
            export	false
            flat	false
            image_content_input	None
            results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "cutadapt"}}]
            title	""

    • Step 24: Pick forward 2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 9, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 2, "src": "dce"}]}}]}}

        • Job 2:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 10, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 3, "src": "dce"}]}}]}}

    • Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            replacements	[{"__index__": 0, "find_pattern": "bp", "replace_pattern": "", "sed_options": null}, {"__index__": 1, "find_pattern": ",", "replace_pattern": "", "sed_options": null}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2", "sed_options": null}]

    • Step 26: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c7"
            dbkey	"?"
            delimiter	"T"

    • Step 27: Unlabelled step:

      • step_state: new

    • Step 28: Convert characters1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"txt"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            condense	true
            convert_from	"s"
            dbkey	"?"
            strip	true

    • Step 29: Estimated homozygous read coverage:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 30: Unlabelled step:

      • step_state: new

    • Step 4: Trim Hi-C reads?:

      • step_state: scheduled

    • Step 31: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c3"
            dbkey	"?"
            delimiter	"T"

    • Step 32: Homozygous read coverage for Hifiasm:

      • step_state: new

    • Step 33: Collapse forward reads:

      • step_state: new

    • Step 34: Collapse reverse reads:

      • step_state: new

    • Step 35: Estimated genome size:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"658c49f4606e11f08b81000d3a5fb155"
            chromInfo	"/tmp/tmpxdtbt6qb/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 36: Hifiasm:

      • step_state: new

    • Step 37: Raw Unitig Image:

      • step_state: new

    • Step 38: Unlabelled step:

      • step_state: new

    • Step 39: Unlabelled step:

      • step_state: new

    • Step 40: Unlabelled step:

      • step_state: new

    • Step 5: Hi-C reads:

      • step_state: scheduled

    • Step 41: gfastats gfa hap2 no sequences:

      • step_state: new

    • Step 42: Unlabelled step:

      • step_state: new

    • Step 43: gfastats gfa hap1:

      • step_state: new

    • Step 44: gfastats gfa hap2:

      • step_state: new

    • Step 45: Unlabelled step:

      • step_state: new

    • Step 46: gfastats gfa hap1 no sequences:

      • step_state: new

    • Step 47: Unlabelled step:

      • step_state: new

    • Step 48: Unlabelled step:

      • step_state: new

    • Step 49: Unlabelled step:

      • step_state: new

    • Step 50: Data Prep Hap2:

      • step_state: new

      • Subworkflow Steps

    • Step 6: Genomescope Summary:

      • step_state: scheduled

    • Step 51: Data Prep Hap1:

      • step_state: new

      • Subworkflow Steps

    • Step 52: Unlabelled step:

      • step_state: new

    • Step 53: Unlabelled step:

      • step_state: new

    • Step 54: Unlabelled step:

      • step_state: new

    • Step 55: Plot Data:

      • step_state: new

      • Subworkflow Steps

    • Step 56: Busco Hap2:

      • step_state: new

    • Step 57: Compleasm Hap2:

      • step_state: new

    • Step 58: Busco Hap1:

      • step_state: new

    • Step 59: Merqury:

      • step_state: new

    • Step 60: Compleasm Hap1:

      • step_state: new

    • Step 7: Meryl Database:

      • step_state: scheduled

    • Step 61: Unlabelled step:

      • step_state: new

    • Step 62: output_merqury.spectra-cn.fl:

      • step_state: new

    • Step 63: output_merqury.spectra-asm.fl:

      • step_state: new

    • Step 64: merqury_qv:

      • step_state: new

    • Step 65: output_merqury.assembly_01.spectra-cn.fl:

      • step_state: new

    • Step 66: merqury_stats:

      • step_state: new

    • Step 67: output_merqury.assembly_02.spectra-cn.fl:

      • step_state: new

    • Step 68: Unlabelled step:

      • step_state: new

    • Step 69: Unlabelled step:

      • step_state: new

    • Step 8: Database for Busco Lineage:

      • step_state: scheduled

    • Step 9: Lineage:

      • step_state: scheduled

    • Step 10: Name for Haplotype 1:

      • step_state: scheduled
  • Other invocation details

    • error_message

      • Failed to run workflow, invocation ended in [failed] state.

    • history_id

      • d2f827195e418997

    • history_state

      • ok

    • invocation_id

      • d2f827195e418997

    • invocation_state

      • failed

    • workflow_id

      • c671dd8e4d986b15

[github-actions]

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

• ❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0

  Execution Problem:

  • Failed to run workflow, invocation ended in [failed] state.
    

  Workflow invocation details

  • Invocation Messages

  • Steps

    • Step 1: Species Name:

      • step_state: scheduled

    • Step 2: Assembly Name:

      • step_state: scheduled

    • Step 11: Name for Haplotype 2:

      • step_state: scheduled

    • Step 12: Bits for bloom filter:

      • step_state: scheduled

    • Step 13: Homozygous Read Coverage:

      • step_state: scheduled

    • Step 14: Genomescope Model Parameters:

      • step_state: scheduled

    • Step 15: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "Random Name", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 16: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "randName4", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • ln -f -s '/tmp/tmp_w9v7__1/files/5/e/1/dataset_5e105adc-5b04-44f1-b55c-68f2650ea619.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 0, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
            other_trimming_options	{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	["report", "json_stats"]
            read_mod_options	{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}

    • Step 18: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is skipped

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"}
            other_trimming_options	{"cut": "5", "cut2": "5", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	None
            read_mod_options	{"length_tag": null, "rename": null, "strip_suffix": null, "zero_cap": false}

    • Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmp_w9v7__1/files/9/7/9/dataset_979dfa1e-8cfc-48cd-9a6c-91fbfca6e3c6.dat' > '/tmp/tmp_w9v7__1/job_working_directory/000/11/outputs/dataset_73b47820-ff12-4dc4-8eb6-0dc28bad5055.dat'

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            case_sensitive	"-i"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            color	"NOCOLOR"
            dbkey	"?"
            invert	""
            lines_after	"0"
            lines_before	"0"
            regex_type	"-G"
            url_paste	"Haploid"

    • Step 20: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "vertebrata_odb10", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 3: Pacbio Reads:

      • step_state: scheduled

    • Step 21: toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}}

    • Step 22: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            avoid_scientific_notation	false
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            error_handling	{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
            ops	{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}

    • Step 23: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            comment	""
            dbkey	"?"
            export	false
            flat	false
            image_content_input	None
            results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "cutadapt"}}]
            title	""

    • Step 24: Pick forward 2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 9, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 2, "src": "dce"}]}}]}}

        • Job 2:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 10, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 3, "src": "dce"}]}}]}}

    • Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            replacements	[{"__index__": 0, "find_pattern": "bp", "replace_pattern": "", "sed_options": null}, {"__index__": 1, "find_pattern": ",", "replace_pattern": "", "sed_options": null}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2", "sed_options": null}]

    • Step 26: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c7"
            dbkey	"?"
            delimiter	"T"

    • Step 27: Unlabelled step:

      • step_state: new

    • Step 28: Convert characters1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"txt"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            condense	true
            convert_from	"s"
            dbkey	"?"
            strip	true

    • Step 29: Estimated homozygous read coverage:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 30: Unlabelled step:

      • step_state: new

    • Step 4: Trim Hi-C reads?:

      • step_state: scheduled

    • Step 31: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c3"
            dbkey	"?"
            delimiter	"T"

    • Step 32: Homozygous read coverage for Hifiasm:

      • step_state: new

    • Step 33: Collapse forward reads:

      • step_state: new

    • Step 34: Collapse reverse reads:

      • step_state: new

    • Step 35: Estimated genome size:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"f5ac6ebc6e4511f0a03a000d3a3ffd06"
            chromInfo	"/tmp/tmp_w9v7__1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 36: Hifiasm:

      • step_state: new

    • Step 37: Raw Unitig Image:

      • step_state: new

    • Step 38: Unlabelled step:

      • step_state: new

    • Step 39: Unlabelled step:

      • step_state: new

    • Step 40: Unlabelled step:

      • step_state: new

    • Step 5: Hi-C reads:

      • step_state: scheduled

    • Step 41: gfastats gfa hap2 no sequences:

      • step_state: new

    • Step 42: Unlabelled step:

      • step_state: new

    • Step 43: gfastats gfa hap1:

      • step_state: new

    • Step 44: gfastats gfa hap2:

      • step_state: new

    • Step 45: Unlabelled step:

      • step_state: new

    • Step 46: gfastats gfa hap1 no sequences:

      • step_state: new

    • Step 47: Unlabelled step:

      • step_state: new

    • Step 48: Unlabelled step:

      • step_state: new

    • Step 49: Unlabelled step:

      • step_state: new

    • Step 50: Data Prep Hap2:

      • step_state: new

      • Subworkflow Steps

    • Step 6: Genomescope Summary:

      • step_state: scheduled

    • Step 51: Data Prep Hap1:

      • step_state: new

      • Subworkflow Steps

    • Step 52: Unlabelled step:

      • step_state: new

    • Step 53: Unlabelled step:

      • step_state: new

    • Step 54: Unlabelled step:

      • step_state: new

    • Step 55: Plot Data:

      • step_state: new

      • Subworkflow Steps

    • Step 56: Busco Hap2:

      • step_state: new

    • Step 57: Compleasm Hap2:

      • step_state: new

    • Step 58: Busco Hap1:

      • step_state: new

    • Step 59: Merqury:

      • step_state: new

    • Step 60: Compleasm Hap1:

      • step_state: new

    • Step 7: Meryl Database:

      • step_state: scheduled

    • Step 61: Unlabelled step:

      • step_state: new

    • Step 62: output_merqury.spectra-cn.fl:

      • step_state: new

    • Step 63: output_merqury.spectra-asm.fl:

      • step_state: new

    • Step 64: merqury_qv:

      • step_state: new

    • Step 65: output_merqury.assembly_01.spectra-cn.fl:

      • step_state: new

    • Step 66: merqury_stats:

      • step_state: new

    • Step 67: output_merqury.assembly_02.spectra-cn.fl:

      • step_state: new

    • Step 68: Unlabelled step:

      • step_state: new

    • Step 69: Unlabelled step:

      • step_state: new

    • Step 8: Database for Busco Lineage:

      • step_state: scheduled

    • Step 9: Lineage:

      • step_state: scheduled

    • Step 10: Name for Haplotype 1:

      • step_state: scheduled
  • Other invocation details

    • error_message

      • Failed to run workflow, invocation ended in [failed] state.

    • history_id

      • a31a75a836652198

    • history_state

      • ok

    • invocation_id

      • a31a75a836652198

    • invocation_state

      • failed

    • workflow_id

      • 2ac623a7f79615d3

[github-actions]

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

• ❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0

  Execution Problem:

  • Failed to run workflow, invocation ended in [failed] state.
    

  Workflow invocation details

  • Invocation Messages

  • Steps

    • Step 1: Species Name:

      • step_state: scheduled

    • Step 2: Assembly Name:

      • step_state: scheduled

    • Step 11: Name for Haplotype 2:

      • step_state: scheduled

    • Step 12: Bits for bloom filter:

      • step_state: scheduled

    • Step 13: Homozygous Read Coverage:

      • step_state: scheduled

    • Step 14: Genomescope Model Parameters:

      • step_state: scheduled

    • Step 15: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "Random Name", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 16: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "randName4", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • ln -f -s '/tmp/tmpvri1lcnc/files/2/2/1/dataset_22120f67-ddd1-494e-bf95-97fb7f765fc6.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 0, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
            other_trimming_options	{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	["report", "json_stats"]
            read_mod_options	{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}

    • Step 18: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is skipped

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"}
            other_trimming_options	{"cut": "5", "cut2": "5", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	None
            read_mod_options	{"length_tag": null, "rename": null, "strip_suffix": null, "zero_cap": false}

    • Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpvri1lcnc/files/7/7/7/dataset_7770c8b8-58c9-4ace-8312-27e900e2a5a7.dat' > '/tmp/tmpvri1lcnc/job_working_directory/000/11/outputs/dataset_02bb0faf-9e30-4981-b939-68f3c77c33dc.dat'

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            case_sensitive	"-i"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            color	"NOCOLOR"
            dbkey	"?"
            invert	""
            lines_after	"0"
            lines_before	"0"
            regex_type	"-G"
            url_paste	"Haploid"

    • Step 20: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "vertebrata_odb10", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 3: Pacbio Reads:

      • step_state: scheduled

    • Step 21: toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}}

    • Step 22: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            avoid_scientific_notation	false
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            error_handling	{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
            ops	{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}

    • Step 23: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            comment	""
            dbkey	"?"
            export	false
            flat	false
            image_content_input	None
            results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "cutadapt"}}]
            title	""

    • Step 24: Pick forward 2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 9, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 2, "src": "dce"}]}}]}}

        • Job 2:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 10, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 3, "src": "dce"}]}}]}}

    • Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            replacements	[{"__index__": 0, "find_pattern": "bp", "replace_pattern": "", "sed_options": null}, {"__index__": 1, "find_pattern": ",", "replace_pattern": "", "sed_options": null}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2", "sed_options": null}]

    • Step 26: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c7"
            dbkey	"?"
            delimiter	"T"

    • Step 27: Unlabelled step:

      • step_state: new

    • Step 28: Convert characters1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"txt"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            condense	true
            convert_from	"s"
            dbkey	"?"
            strip	true

    • Step 29: Estimated homozygous read coverage:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 30: Unlabelled step:

      • step_state: new

    • Step 4: Trim Hi-C reads?:

      • step_state: scheduled

    • Step 31: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c3"
            dbkey	"?"
            delimiter	"T"

    • Step 32: Homozygous read coverage for Hifiasm:

      • step_state: new

    • Step 33: Collapse forward reads:

      • step_state: new

    • Step 34: Collapse reverse reads:

      • step_state: new

    • Step 35: Estimated genome size:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"53df4c206e4611f0a03a7c1e527b902c"
            chromInfo	"/tmp/tmpvri1lcnc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 36: Hifiasm:

      • step_state: new

    • Step 37: Raw Unitig Image:

      • step_state: new

    • Step 38: Unlabelled step:

      • step_state: new

    • Step 39: Unlabelled step:

      • step_state: new

    • Step 40: Unlabelled step:

      • step_state: new

    • Step 5: Hi-C reads:

      • step_state: scheduled

    • Step 41: gfastats gfa hap2 no sequences:

      • step_state: new

    • Step 42: Unlabelled step:

      • step_state: new

    • Step 43: gfastats gfa hap1:

      • step_state: new

    • Step 44: gfastats gfa hap2:

      • step_state: new

    • Step 45: Unlabelled step:

      • step_state: new

    • Step 46: gfastats gfa hap1 no sequences:

      • step_state: new

    • Step 47: Unlabelled step:

      • step_state: new

    • Step 48: Unlabelled step:

      • step_state: new

    • Step 49: Unlabelled step:

      • step_state: new

    • Step 50: Data Prep Hap2:

      • step_state: new

      • Subworkflow Steps

    • Step 6: Genomescope Summary:

      • step_state: scheduled

    • Step 51: Data Prep Hap1:

      • step_state: new

      • Subworkflow Steps

    • Step 52: Unlabelled step:

      • step_state: new

    • Step 53: Unlabelled step:

      • step_state: new

    • Step 54: Unlabelled step:

      • step_state: new

    • Step 55: Plot Data:

      • step_state: new

      • Subworkflow Steps

    • Step 56: Busco Hap2:

      • step_state: new

    • Step 57: Compleasm Hap2:

      • step_state: new

    • Step 58: Busco Hap1:

      • step_state: new

    • Step 59: Merqury:

      • step_state: new

    • Step 60: Compleasm Hap1:

      • step_state: new

    • Step 7: Meryl Database:

      • step_state: scheduled

    • Step 61: Unlabelled step:

      • step_state: new

    • Step 62: output_merqury.spectra-cn.fl:

      • step_state: new

    • Step 63: output_merqury.spectra-asm.fl:

      • step_state: new

    • Step 64: merqury_qv:

      • step_state: new

    • Step 65: output_merqury.assembly_01.spectra-cn.fl:

      • step_state: new

    • Step 66: merqury_stats:

      • step_state: new

    • Step 67: output_merqury.assembly_02.spectra-cn.fl:

      • step_state: new

    • Step 68: Unlabelled step:

      • step_state: new

    • Step 69: Unlabelled step:

      • step_state: new

    • Step 8: Database for Busco Lineage:

      • step_state: scheduled

    • Step 9: Lineage:

      • step_state: scheduled

    • Step 10: Name for Haplotype 1:

      • step_state: scheduled
  • Other invocation details

    • error_message

      • Failed to run workflow, invocation ended in [failed] state.

    • history_id

      • f442905604a03803

    • history_state

      • ok

    • invocation_id

      • f442905604a03803

    • invocation_state

      • failed

    • workflow_id

      • 104706296e672641

[github-actions]

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

• ❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0

  Execution Problem:

  • Failed to run workflow, invocation ended in [failed] state.
    

  Workflow invocation details

  • Invocation Messages

  • Steps

    • Step 1: Species Name:

      • step_state: scheduled

    • Step 2: Assembly Name:

      • step_state: scheduled

    • Step 11: Name for Haplotype 2:

      • step_state: scheduled

    • Step 12: Bits for bloom filter:

      • step_state: scheduled

    • Step 13: Homozygous Read Coverage:

      • step_state: scheduled

    • Step 14: Genomescope Model Parameters:

      • step_state: scheduled

    • Step 15: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "Random Name", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 16: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "randName4", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • ln -f -s '/tmp/tmph5xc8lzc/files/8/0/0/dataset_800d4f3e-e497-43c0-82a2-d0f2e8e3e8a6.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 0, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
            other_trimming_options	{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	["report", "json_stats"]
            read_mod_options	{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}

    • Step 18: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is skipped

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"}
            other_trimming_options	{"cut": "5", "cut2": "5", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	None
            read_mod_options	{"length_tag": null, "rename": null, "strip_suffix": null, "zero_cap": false}

    • Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmph5xc8lzc/files/6/d/e/dataset_6de2ac42-ff07-4525-9437-d3d227b7e8b1.dat' > '/tmp/tmph5xc8lzc/job_working_directory/000/11/outputs/dataset_999099fa-3e18-4bc1-b999-a81962d461fc.dat'

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            case_sensitive	"-i"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            color	"NOCOLOR"
            dbkey	"?"
            invert	""
            lines_after	"0"
            lines_before	"0"
            regex_type	"-G"
            url_paste	"Haploid"

    • Step 20: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "vertebrata_odb10", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 3: Pacbio Reads:

      • step_state: scheduled

    • Step 21: toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}}

    • Step 22: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            avoid_scientific_notation	false
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            error_handling	{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
            ops	{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}

    • Step 23: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            comment	""
            dbkey	"?"
            export	false
            flat	false
            image_content_input	None
            results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "cutadapt"}}]
            title	""

    • Step 24: Pick forward 2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 9, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 2, "src": "dce"}]}}]}}

        • Job 2:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 10, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 3, "src": "dce"}]}}]}}

    • Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            replacements	[{"__index__": 0, "find_pattern": "bp", "replace_pattern": "", "sed_options": null}, {"__index__": 1, "find_pattern": ",", "replace_pattern": "", "sed_options": null}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2", "sed_options": null}]

    • Step 26: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c7"
            dbkey	"?"
            delimiter	"T"

    • Step 27: Unlabelled step:

      • step_state: new

    • Step 28: Convert characters1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"txt"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            condense	true
            convert_from	"s"
            dbkey	"?"
            strip	true

    • Step 29: Estimated homozygous read coverage:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 30: Unlabelled step:

      • step_state: new

    • Step 4: Trim Hi-C reads?:

      • step_state: scheduled

    • Step 31: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c3"
            dbkey	"?"
            delimiter	"T"

    • Step 32: Homozygous read coverage for Hifiasm:

      • step_state: new

    • Step 33: Collapse forward reads:

      • step_state: new

    • Step 34: Collapse reverse reads:

      • step_state: new

    • Step 35: Estimated genome size:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"95f3e0ae722311f0a03a7ced8d3da7af"
            chromInfo	"/tmp/tmph5xc8lzc/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 36: Hifiasm:

      • step_state: new

    • Step 37: Raw Unitig Image:

      • step_state: new

    • Step 38: Unlabelled step:

      • step_state: new

    • Step 39: Unlabelled step:

      • step_state: new

    • Step 40: Unlabelled step:

      • step_state: new

    • Step 5: Hi-C reads:

      • step_state: scheduled

    • Step 41: gfastats gfa hap2 no sequences:

      • step_state: new

    • Step 42: Unlabelled step:

      • step_state: new

    • Step 43: gfastats gfa hap1:

      • step_state: new

    • Step 44: gfastats gfa hap2:

      • step_state: new

    • Step 45: Unlabelled step:

      • step_state: new

    • Step 46: gfastats gfa hap1 no sequences:

      • step_state: new

    • Step 47: Unlabelled step:

      • step_state: new

    • Step 48: Unlabelled step:

      • step_state: new

    • Step 49: Unlabelled step:

      • step_state: new

    • Step 50: Data Prep Hap2:

      • step_state: new

      • Subworkflow Steps

    • Step 6: Genomescope Summary:

      • step_state: scheduled

    • Step 51: Data Prep Hap1:

      • step_state: new

      • Subworkflow Steps

    • Step 52: Unlabelled step:

      • step_state: new

    • Step 53: Unlabelled step:

      • step_state: new

    • Step 54: Unlabelled step:

      • step_state: new

    • Step 55: Plot Data:

      • step_state: new

      • Subworkflow Steps

    • Step 56: Busco Hap2:

      • step_state: new

    • Step 57: Compleasm Hap2:

      • step_state: new

    • Step 58: Busco Hap1:

      • step_state: new

    • Step 59: Merqury:

      • step_state: new

    • Step 60: Compleasm Hap1:

      • step_state: new

    • Step 7: Meryl Database:

      • step_state: scheduled

    • Step 61: Unlabelled step:

      • step_state: new

    • Step 62: output_merqury.spectra-cn.fl:

      • step_state: new

    • Step 63: output_merqury.spectra-asm.fl:

      • step_state: new

    • Step 64: merqury_qv:

      • step_state: new

    • Step 65: output_merqury.assembly_01.spectra-cn.fl:

      • step_state: new

    • Step 66: merqury_stats:

      • step_state: new

    • Step 67: output_merqury.assembly_02.spectra-cn.fl:

      • step_state: new

    • Step 68: Unlabelled step:

      • step_state: new

    • Step 69: Unlabelled step:

      • step_state: new

    • Step 8: Database for Busco Lineage:

      • step_state: scheduled

    • Step 9: Lineage:

      • step_state: scheduled

    • Step 10: Name for Haplotype 1:

      • step_state: scheduled
  • Other invocation details

    • error_message

      • Failed to run workflow, invocation ended in [failed] state.

    • history_id

      • fd01ead2e2d2fb53

    • history_state

      • ok

    • invocation_id

      • fd01ead2e2d2fb53

    • invocation_state

      • failed

    • workflow_id

      • 9426a2f45f3c76d7

[github-actions]

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

• ❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0

  Execution Problem:

  • Failed to run workflow, invocation ended in [failed] state.
    

  Workflow invocation details

  • Invocation Messages

  • Steps

    • Step 1: Species Name:

      • step_state: scheduled

    • Step 2: Assembly Name:

      • step_state: scheduled

    • Step 11: Name for Haplotype 2:

      • step_state: scheduled

    • Step 12: Bits for bloom filter:

      • step_state: scheduled

    • Step 13: Homozygous Read Coverage:

      • step_state: scheduled

    • Step 14: Genomescope Model Parameters:

      • step_state: scheduled

    • Step 15: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "Random Name", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 16: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "randName4", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • ln -f -s '/tmp/tmp57piyll2/files/c/6/c/dataset_c6c6499e-68ac-4b45-80dc-43320ca78d75.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 0, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
            other_trimming_options	{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	["report", "json_stats"]
            read_mod_options	{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}

    • Step 18: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is skipped

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"}
            other_trimming_options	{"cut": "5", "cut2": "5", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	None
            read_mod_options	{"length_tag": null, "rename": null, "strip_suffix": null, "zero_cap": false}

    • Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmp57piyll2/files/e/f/b/dataset_efbe65c1-98df-4c1b-865e-d4f08b7399af.dat' > '/tmp/tmp57piyll2/job_working_directory/000/11/outputs/dataset_ae1a836e-2d5a-40c0-82ef-d1596bb00f23.dat'

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            case_sensitive	"-i"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            color	"NOCOLOR"
            dbkey	"?"
            invert	""
            lines_after	"0"
            lines_before	"0"
            regex_type	"-G"
            url_paste	"Haploid"

    • Step 20: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "vertebrata_odb10", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 3: Pacbio Reads:

      • step_state: scheduled

    • Step 21: toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}}

    • Step 22: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            avoid_scientific_notation	false
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            error_handling	{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
            ops	{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}

    • Step 23: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            comment	""
            dbkey	"?"
            export	false
            flat	false
            image_content_input	None
            results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "cutadapt"}}]
            title	""

    • Step 24: Pick forward 2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 9, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 2, "src": "dce"}]}}]}}

        • Job 2:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 10, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 3, "src": "dce"}]}}]}}

    • Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            replacements	[{"__index__": 0, "find_pattern": "bp", "replace_pattern": "", "sed_options": null}, {"__index__": 1, "find_pattern": ",", "replace_pattern": "", "sed_options": null}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2", "sed_options": null}]

    • Step 26: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c7"
            dbkey	"?"
            delimiter	"T"

    • Step 27: Unlabelled step:

      • step_state: new

    • Step 28: Convert characters1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"txt"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            condense	true
            convert_from	"s"
            dbkey	"?"
            strip	true

    • Step 29: Estimated homozygous read coverage:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 30: Unlabelled step:

      • step_state: new

    • Step 4: Trim Hi-C reads?:

      • step_state: scheduled

    • Step 31: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c3"
            dbkey	"?"
            delimiter	"T"

    • Step 32: Homozygous read coverage for Hifiasm:

      • step_state: new

    • Step 33: Collapse forward reads:

      • step_state: new

    • Step 34: Collapse reverse reads:

      • step_state: new

    • Step 35: Estimated genome size:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"7b3639cc7c3911f089926045bd07759a"
            chromInfo	"/tmp/tmp57piyll2/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 36: Hifiasm:

      • step_state: new

    • Step 37: Raw Unitig Image:

      • step_state: new

    • Step 38: Unlabelled step:

      • step_state: new

    • Step 39: Unlabelled step:

      • step_state: new

    • Step 40: Unlabelled step:

      • step_state: new

    • Step 5: Hi-C reads:

      • step_state: scheduled

    • Step 41: gfastats gfa hap2 no sequences:

      • step_state: new

    • Step 42: Unlabelled step:

      • step_state: new

    • Step 43: gfastats gfa hap1:

      • step_state: new

    • Step 44: gfastats gfa hap2:

      • step_state: new

    • Step 45: Unlabelled step:

      • step_state: new

    • Step 46: gfastats gfa hap1 no sequences:

      • step_state: new

    • Step 47: Unlabelled step:

      • step_state: new

    • Step 48: Unlabelled step:

      • step_state: new

    • Step 49: Unlabelled step:

      • step_state: new

    • Step 50: Data Prep Hap2:

      • step_state: new

      • Subworkflow Steps

    • Step 6: Genomescope Summary:

      • step_state: scheduled

    • Step 51: Data Prep Hap1:

      • step_state: new

      • Subworkflow Steps

    • Step 52: Unlabelled step:

      • step_state: new

    • Step 53: Unlabelled step:

      • step_state: new

    • Step 54: Unlabelled step:

      • step_state: new

    • Step 55: Plot Data:

      • step_state: new

      • Subworkflow Steps

    • Step 56: Busco Hap2:

      • step_state: new

    • Step 57: Compleasm Hap2:

      • step_state: new

    • Step 58: Busco Hap1:

      • step_state: new

    • Step 59: Merqury:

      • step_state: new

    • Step 60: Compleasm Hap1:

      • step_state: new

    • Step 7: Meryl Database:

      • step_state: scheduled

    • Step 61: Unlabelled step:

      • step_state: new

    • Step 62: output_merqury.spectra-cn.fl:

      • step_state: new

    • Step 63: output_merqury.spectra-asm.fl:

      • step_state: new

    • Step 64: merqury_qv:

      • step_state: new

    • Step 65: output_merqury.assembly_01.spectra-cn.fl:

      • step_state: new

    • Step 66: merqury_stats:

      • step_state: new

    • Step 67: output_merqury.assembly_02.spectra-cn.fl:

      • step_state: new

    • Step 68: Unlabelled step:

      • step_state: new

    • Step 69: Unlabelled step:

      • step_state: new

    • Step 8: Database for Busco Lineage:

      • step_state: scheduled

    • Step 9: Lineage:

      • step_state: scheduled

    • Step 10: Name for Haplotype 1:

      • step_state: scheduled
  • Other invocation details

    • error_message

      • Failed to run workflow, invocation ended in [failed] state.

    • history_id

      • 76defc30f428a796

    • history_state

      • ok

    • invocation_id

      • 76defc30f428a796

    • invocation_state

      • failed

    • workflow_id

      • 59e47544ccdc3cc4