Add friendzymes collection - #238
Conversation
This is an initial draft of friendzymes.xlsx for upload. Its contents are near-final but subject to further revision prior to release.
|
@jcahill Can you please run the workflows on your fork? The automation needs to run the build in order to validate whether this can be integrated. |
|
@jakebeal Running |
|
The |
|
After several rounds of trial-and-error with source prefix and ID columns, Blocker 1Build automation rejects non-unique data source IDs, but it's unclear how this value can be meaningful if required to be unique. Blocker 2If the workflow logs are to be trusted, URI expansions are not being generated correctly. No combination of the following in the two relevant columns has generated a correct expansion:
That is, all of the following fail:
LogsUsing the final example from above, wiki namespace path
|
|
With respect to your blockers, there are two key pieces of information that I think will help you:
On a separate note, I would also ask you to consider whether it would be a good idea to split this collection up into more than one package. I see inside of it a number of sub-collections that seem like they might stand on their own, such as the linker subcollection. Most other packages in the distribution are organized around function rather than around source: is that possible to do here, or is this something that needs to be monolithic like the current OpenYeast import from FreeGenes? |
|
Re: 1 and 2, thanks. We'll revise based on these notes. Re: the size/scope of the package: We have had some discussion around handling this. I've re-raised the topic with the team in light of your suggestion. So far, the working model has been to handle the whole collection as a single package, prioritizing the downside risks of confusion and fragmentation likely to stem from introducing an assembly standard of considerable complexity across multiple packages over the downside risks of concentrating too much material in one place. Would grouping the natural classes of parts into libraries nested within the package be a suitable middle-ground? |
|
Ah, if it's got an alternate assembly standard, then it probably does want to be isolated in a single package right now (and that will be a discussion necessary with iGEM HQ). If we had a full implementation of SEP 054, then sub-packages would be the right answer, but at the moment that's not an option. |
|
To clarify, in this collection, all parts that are defined with specified overhangs in uLoop--all promoters, RBSs, CDSs, and terminators--have uLoop overhangs. It is the part types that are not explicitly defined in uLoop--vector backbone subcomponents, recombination sites, ribozymes--where the new overhangs and part definitions come in. So at least for level 0/level 1 assemblies, it's not so much intended to be an alternate assembly standard, as an expansion and extension of the existing iGEM/uLoop assembly standard. Happy to talk more about this on this thread, in Wednesday's meeting or on a call. |
|
@eyesmo Yes, I think a discussion on the Wednesday distribution call would likely be a good thing. |
|
Workflows have run successfully on the fork. |
| - Rec3_Lox66 (recombination_signal_sequence) in | ||
| - Rec3_LoxP (recombination_signal_sequence) in | ||
| - Rec5_Lox71 (recombination_signal_sequence) _<span style="color:red">not included in distribution</span>_ | ||
| - Rec5_LoxP (recombination_signal_sequence) _<span style="color:red">not included in distribution</span>_ |
There was a problem hiding this comment.
Are these two intentionally not included, or do you want to update the build plan?
There was a problem hiding this comment.
I believe this is simply an unnoticed error in porting parts to the spreadsheet.
| Libraries and Composite Parts,Blue text column headers are optional,,,,,,,,,,,,,,,,,,,,,,,,,,, | ||
| ,,,,,,,,,,,,,,,,,,,,,,,,,,,, | ||
| Part/Library Name,Design Notes,Part Description,Final Product,Backbone/locus,Constraints,Part 1,Part 2,Part 3,Part 4,Part 5,Part 6,Part 7,Part 8,Part 9,,,,,,,,,,,,,, | ||
| ,,,False,,,,,,,,,,,,,,,,,,,,,,,,, |
There was a problem hiding this comment.
I see there's nothing in the composites sheet. Everything else is being ordered in a vector (generally pSB1C5). Right now, your sheet says that you want to have things delivered as just linear DNA fragments, which may not be compatible with FreeGenes processes. Is that the intention (in which case a discussion with @vinoo-igem is likely needed)? If it's not the intention, then the build plans should be expressed on this sheet and the "final product" markers on the parts sheet set to false.
There was a problem hiding this comment.
To make sure I understand, you're saying that the Libraries/Composites tab is where we should put information about the cloning/holding vector these parts should be stored in, correct? So currently the sheet implies no cloning vector, just raw DNA?
I think it would be useful to discuss the relative merits of pSB1C5 vs pOpen_v3 vs pOpen_v4. Is there a thread where the engineering committee has covered this? We'd be open to pSB1C5 and would ideally like to use the same standard vector as the new iGEM Distribution; my main (possibly unfounded) concern here is about compatibility with the existing FreeGenes libraries that are going into the Distro (e.g. Open Yeast Collection and the Protein Expression Toolkit), which to my knowledge use pOpen_v3.
There was a problem hiding this comment.
started an issue #244 to open up the discussion
There was a problem hiding this comment.
That's correct: you want to use the "Backbone/locus" column to indicate the vector holding the part. You should also consider whether you need to add flanking sequences, depending on whether the vector comes with them built in already.
Which vectors can be used is a separate discussion with @vinoo-igem
There was a problem hiding this comment.
All FreeGenes parts, including Open Yeast Collection and Open Enzyme Collection, are clone by Twist in pOpen_v3. pOpen_v3 is ampR. All our parts should be cloned by Twist in this vector to make is useful as an AllClo/OYC part for GGA.
| GACCAGGTAGCATAACTTCGTATAATGTATGCTATACGAACGGTAATGATGAGACCGTGC | ||
| AC | ||
| >3_APOSTROPHE_Part_Switch_Linker | ||
| GGTCTCATACTTGTGATGTCTTCGCCTACGGATTGTCTGTCAAGGCATGAGACC |
There was a problem hiding this comment.
These short parts cannot be built by Twist, whose minimum synthesis length is 300bp. They need to have padding and flanking sequences added to them. See the Anderson Promoters package for an example of how this has been done.
There was a problem hiding this comment.
By my count, we have 36 parts under 300bp in length. This is just to note my intention to pad all of those parts.
There was a problem hiding this comment.
Yes, I added ~50%GC hair-pin free random sequence to all of my OYC parts that were under 300bp. I made those parts 310bp total.
|
I think discussing this on our next call will be good! I do want to surface that this is ambitious and will take some effort for review, as this will feed directly into a number of different topics that we need to address this year, primarily what iGEM will be defining as the assembly standard beyond L0 basic parts (which also clearly needs work #236 #214) and vector construction and whether this would constitute testing and/or adoption. |
Very much looking forward to this review/discussion! A core desired outcome of mine is to help move the ball forward on these topics for iGEM |
About
This PR is for inclusion of the Friendzymes Collection.
Description
This collection is aimed at expanding what people are able to do with FreeGenes collections and the iGEM distribution, both in terms of genetic assembly and in terms of biomanufacturing. Friendzymes' primary goals are to democratize strain engineering and recombinant protein manufacturing and purification.
For manufacturing, this collection contains an expansion of the FreeGenes Open Yeast Collection, including target P. pastoris-optimized target enzymes for recombinant production (such as Eco31I, an IP-free BsaI isoschizomer and its cognate methyltransferases), additional purification tags, an anti-His tag antibody for protein blotting and quantification, and additional yeast promoters. Further, this collection contains complements to the FreeGenes Bacillus subtilis Secretion Tag Library Plasmids, for recombinant protein production and secretion from B. subtilis. These include B. subtilis promoters, target proteins for production like Pfu-Sso7d polymerase, and various B. subtilis regulatory elements.
For strain engineering, we include E. coli origins or replication, E. coli, B. subtilis and P. pastoris selection markers, counterselection markers for E. coli, an origin of transfer for conjugation from E. coli to other bacterial species, homology arm pairs for genomic integration into B. subtilis and P. pastoris, and 5' and 3' recombinase site parts for insertion, deletion or inversion of synthetic genetic elements. Many of these parts are not elements of a canonical transcription unit, and do not have clearly defined part types in the MoClo/uLoop assembly standard; moreover, for some parts, their insertion into the transcription unit would require changing the overhangs on the core promoter, RBS, CDS, and/or terminator parts.
To address this challenge, we designed a high-fidelity, backwards-compatible expansion of the MoClo assembly standard, AllClo (https://docs.google.com/spreadsheets/d/1TICnbGYY96myM7TPXWwBsLvyadgSfmtbVTGsUN5iMI8/edit?usp=sharing), all with a single 26-overhang set that includes all uLoop overhangs and the vector assembly overhangs used in the Open Yeast Collection, and whose predicted ligation fidelity in a 26-part assembly is 96%.
We further designed a set of part switching linkers, that take as input canonical uLoop transcription unit components and output those parts with new 5' and 3' overhangs. These part switching reactions enable, for instance, insertion of recombination sites 5' to the promoter and/or 3' to the terminator in a TU, or ribozymes 3' to the promoter and 5' to the RBS/start site. In this way, standard uLoop parts can participate in assembly reactions that construct modular vector backbones, composite 5' and 3' UTRs, and multi-tagged CDSs.
The part switching linkers were designed to proceed in two methods: with an orthogonal, linker-specific Type IIS restriction site (BbsI), or with a conditionally methylatable, idempotent BsaI restriction site (mBsaI), that is suppressed when the linker is cloned inside an E. coli cell expressing HpaII and/or MspI, and becomes active when the part is cloned into an MspI-/HpaII- strain or PCR amplified to remove the methylation sites. These parts and this expanded assembly standard have the potential to enable iGEM teams with tools and a framework to manufacture their own enzymatic reagents and perform their own sophisticated modification of strains' genomic background.
Technical Notes
Thanks,
Friendzymes Contributors