Develop into main

.github/workflows/python_linter.yaml

@@ -0,0 +1,51 @@
+name : Python linter Flake8 and Pylint
+
+on:
+  push:
+    path: "**.py"
+  pull_request:
+    path: "**.py"
+
+jobs:
+  Pylint:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Check out source repository
+        uses: actions/checkout@v2
+      - name: Set up Python 3.9
+        uses: actions/setup-python@v2
+        with:
+          python-version: 3.9
+      - name: Install dependencies
+        run: |
+          python -m pip install --upgrade pip
+          pip install -r scripts/requirements.txt
+          pip install pylint
+      - name: set pythonpath
+        run: |
+          echo "PYTHONPATH=." >> $GITHUB_ENV
+      - name: Pylint
+        run: >
+          find . -type f -name "*.py" |
+          xargs pylint
+          --max-line-length=120
+          --disable=C0103,C0114,C0115,C0116,C0201,C0206,C0301,C0303,C0325,C0411
+          --disable=E0611
+          --disable=R0402,R0801,R0903,R0912,R0914,R0915,R1702,R1705,R1720,R1721,R1724
+          --disable=W0212,W0511,W0611,W0612,W0622,W1309,W1203,W1512,W1514
+  Flake8:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Check out source repository
+        uses: actions/checkout@v2
+      - name: Set up Python 3.9
+        uses: actions/setup-python@v2
+        with:
+          python-version: 3.9
+      - name: flake8 lint
+        uses: py-actions/flake8@v2
+        with:
+          path: "."
+          max-line-length: 120
+          update-pip: TRUE
+          ignore: E121,E203,E226,E231,E251,E265,E302,E305,E501,F401,F403,F541,W291,W503

.gitignore

@@ -3,3 +3,4 @@ venv
 __pycache__
 *~
 .DS_Store
+/docs/_build

2A_peptides/views/package.nt

@@ -1,4 +1,3 @@
-
 <https://github.com/iGEM-Engineering/iGEM-distribution/2A_peptides/BasicParts> <http://sbols.org/v3#description> "Collection of 2A peptides for the construction of polycistronic expression cassettes. " .
 <https://github.com/iGEM-Engineering/iGEM-distribution/2A_peptides/BasicParts> <http://sbols.org/v3#displayId> "BasicParts" .
 <https://github.com/iGEM-Engineering/iGEM-distribution/2A_peptides/BasicParts> <http://sbols.org/v3#hasNamespace> <https://github.com/iGEM-Engineering/iGEM-distribution/2A_peptides> .

2A_peptides/views/package_specification.nt

@@ -1,4 +1,3 @@
-
 <https://github.com/iGEM-Engineering/iGEM-distribution/2A_peptides/BasicParts> <http://sbols.org/v3#description> "Collection of 2A peptides for the construction of polycistronic expression cassettes. " .
 <https://github.com/iGEM-Engineering/iGEM-distribution/2A_peptides/BasicParts> <http://sbols.org/v3#displayId> "BasicParts" .
 <https://github.com/iGEM-Engineering/iGEM-distribution/2A_peptides/BasicParts> <http://sbols.org/v3#hasNamespace> <https://github.com/iGEM-Engineering/iGEM-distribution/2A_peptides> .

Anderson Promoters/views/package.nt

@@ -1,4 +1,3 @@
-
 <http://parts.igem.org/D1001> <http://sbols.org/v3#description> "D1001" .
 <http://parts.igem.org/D1001> <http://sbols.org/v3#displayId> "D1001" .
 <http://parts.igem.org/D1001> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .

Anderson Promoters/views/package_specification.nt

@@ -1,4 +1,3 @@
-
 <http://parts.igem.org/D1001> <http://sbols.org/v3#description> "Includes BsaI and fusion site\nL0 Promoter 5' Flanking Region" .
 <http://parts.igem.org/D1001> <http://sbols.org/v3#displayId> "D1001" .
 <http://parts.igem.org/D1001> <http://sbols.org/v3#hasNamespace> <http://parts.igem.org> .

CODE_OF_CONDUCT.md

@@ -0,0 +1,133 @@
+
+# Contributor Covenant Code of Conduct
+
+## Our Pledge
+
+We as members, contributors, and leaders pledge to make participation in our
+community a harassment-free experience for everyone, regardless of age, body
+size, visible or invisible disability, ethnicity, sex characteristics, gender
+identity and expression, level of experience, education, socio-economic status,
+nationality, personal appearance, race, caste, color, religion, or sexual
+identity and orientation.
+
+We pledge to act and interact in ways that contribute to an open, welcoming,
+diverse, inclusive, and healthy community.
+
+## Our Standards
+
+Examples of behavior that contributes to a positive environment for our
+community include:
+
+* Demonstrating empathy and kindness toward other people
+* Being respectful of differing opinions, viewpoints, and experiences
+* Giving and gracefully accepting constructive feedback
+* Accepting responsibility and apologizing to those affected by our mistakes,
+  and learning from the experience
+* Focusing on what is best not just for us as individuals, but for the overall
+  community
+
+Examples of unacceptable behavior include:
+
+* The use of sexualized language or imagery, and sexual attention or advances of
+  any kind
+* Trolling, insulting or derogatory comments, and personal or political attacks
+* Public or private harassment
+* Publishing others' private information, such as a physical or email address,
+  without their explicit permission
+* Other conduct which could reasonably be considered inappropriate in a
+  professional setting
+
+## Enforcement Responsibilities
+
+Community leaders are responsible for clarifying and enforcing our standards of
+acceptable behavior and will take appropriate and fair corrective action in
+response to any behavior that they deem inappropriate, threatening, offensive,
+or harmful.
+
+Community leaders have the right and responsibility to remove, edit, or reject
+comments, commits, code, wiki edits, issues, and other contributions that are
+not aligned to this Code of Conduct, and will communicate reasons for moderation
+decisions when appropriate.
+
+## Scope
+
+This Code of Conduct applies within all community spaces, and also applies when
+an individual is officially representing the community in public spaces.
+Examples of representing our community include using an official e-mail address,
+posting via an official social media account, or acting as an appointed
+representative at an online or offline event.
+
+## Enforcement
+
+Instances of abusive, harassing, or otherwise unacceptable behavior may be
+reported to the community leaders responsible for enforcement at
+[INSERT CONTACT METHOD].
+All complaints will be reviewed and investigated promptly and fairly.
+
+All community leaders are obligated to respect the privacy and security of the
+reporter of any incident.
+
+## Enforcement Guidelines
+
+Community leaders will follow these Community Impact Guidelines in determining
+the consequences for any action they deem in violation of this Code of Conduct:
+
+### 1. Correction
+
+**Community Impact**: Use of inappropriate language or other behavior deemed
+unprofessional or unwelcome in the community.
+
+**Consequence**: A private, written warning from community leaders, providing
+clarity around the nature of the violation and an explanation of why the
+behavior was inappropriate. A public apology may be requested.
+
+### 2. Warning
+
+**Community Impact**: A violation through a single incident or series of
+actions.
+
+**Consequence**: A warning with consequences for continued behavior. No
+interaction with the people involved, including unsolicited interaction with
+those enforcing the Code of Conduct, for a specified period of time. This
+includes avoiding interactions in community spaces as well as external channels
+like social media. Violating these terms may lead to a temporary or permanent
+ban.
+
+### 3. Temporary Ban
+
+**Community Impact**: A serious violation of community standards, including
+sustained inappropriate behavior.
+
+**Consequence**: A temporary ban from any sort of interaction or public
+communication with the community for a specified period of time. No public or
+private interaction with the people involved, including unsolicited interaction
+with those enforcing the Code of Conduct, is allowed during this period.
+Violating these terms may lead to a permanent ban.
+
+### 4. Permanent Ban
+
+**Community Impact**: Demonstrating a pattern of violation of community
+standards, including sustained inappropriate behavior, harassment of an
+individual, or aggression toward or disparagement of classes of individuals.
+
+**Consequence**: A permanent ban from any sort of public interaction within the
+community.
+
+## Attribution
+
+This Code of Conduct is adapted from the [Contributor Covenant][homepage],
+version 2.1, available at
+[https://www.contributor-covenant.org/version/2/1/code_of_conduct.html][v2.1].
+
+Community Impact Guidelines were inspired by
+[Mozilla's code of conduct enforcement ladder][Mozilla CoC].
+
+For answers to common questions about this code of conduct, see the FAQ at
+[https://www.contributor-covenant.org/faq][FAQ]. Translations are available at
+[https://www.contributor-covenant.org/translations][translations].
+
+[homepage]: https://www.contributor-covenant.org
+[v2.1]: https://www.contributor-covenant.org/version/2/1/code_of_conduct.html
+[Mozilla CoC]: https://github.com/mozilla/diversity
+[FAQ]: https://www.contributor-covenant.org/faq
+[translations]: https://www.contributor-covenant.org/translations

CONTRIBUTING.md

@@ -0,0 +1,3 @@
+## How to contribute to the iGEM Distribution 
+
+This page is a WIP, for more information on contributing see [our documentation site](https://igem-distribution.readthedocs.io/).

CRISPR-Cas/AcrIIA2_bacterial.gb

@@ -1,8 +1,14 @@
-LOCUS       AcrIIA2_bacterial        372 bp ds-DNA     linear       02-FEB-2022
+LOCUS       AcrIIA2_bacterial        372 bp ds-DNA     linear       09-MAR-2022
 DEFINITION  .
 FEATURES             Location/Qualifiers
      CDS             1..372
                      /label="AcrIIA2_bacterial"
+                     /ApEinfo_revcolor=#c6c9d1
+                     /ApEinfo_fwdcolor=#c6c9d1
+     source          1..372
+                     /label="color: #ffffff"
+                     /ApEinfo_revcolor=#85dae9
+                     /ApEinfo_fwdcolor=#85dae9
      exon            1..372
                      /label="Translation 1-372"
 ORIGIN

CRISPR-Cas/AcrIIA4_bacterial.gb

@@ -1,16 +1,20 @@
-LOCUS       AcrIIA4_bacterial        372 bp ds-DNA     linear       02-FEB-2022
+LOCUS       AcrIIA4_bacterial        264 bp ds-DNA     linear       09-MAR-2022
 DEFINITION  .
 FEATURES             Location/Qualifiers
-     CDS             1..372
-                     /label="AcrIIA2_bacterial"
-     exon            1..372
-                     /label="Translation 1-372"
+     CDS             1..264
+                     /label="AcrIIA4_bacterial"
+                     /ApEinfo_revcolor=#9eafd2
+                     /ApEinfo_fwdcolor=#9eafd2
+     source          1..264
+                     /label="color: #ffffff"
+                     /ApEinfo_revcolor=#c6c9d1
+                     /ApEinfo_fwdcolor=#c6c9d1
+     exon            1..264
+                     /label="Translation 1-264"
 ORIGIN
-        1 atgacattaa caagagcaca aaaaaagtat gcagaagcga tgcacgagtt tataaatatg
-       61 gtggatgact ttgaagagtc tacaccggat tttgcaaagg aagttctaca tgattctgac
-      121 tatgtagtta ttacaaaaaa tgaaaaatat gcagtagctc tttgctctct tagcactgat
-      181 gaatgtgaat atgatactaa cttatactta gatgaaaaat tggttgatta ctcaacagtt
-      241 gacgtaaacg gtgtgacata ctacatcaac attgttgaaa ctaacgatat cgatgattta
-      301 gaaatcgcta cggatgaaga tgagatgaaa agtggcaacc aagaaattat tttaaaaagt
-      361 gagttgaagt aa
+        1 atgaatatta atgacttaat tagagaaatc aaaaacaaag attacacagt gaaattgagt
+       61 ggtacggata gcaatagtat cacacagcta attattcgcg ttaataatga tggcaacgag
+      121 tatgtaattt ctgaaagtga aaatgaatca atcgttgaaa aattcatctc tgcattcaaa
+      181 aacggttgga atcaagaata cgaggatgaa gaagaatttt ataatgacat gcaaacaatc
+      241 accttaaaaa gtgagttgaa ctaa
 //

CRISPR-Cas/AcrIIA4_mammalian.gb

@@ -1,16 +1,21 @@
-LOCUS       AcrIIA4_mammalian        372 bp ds-DNA     linear       02-FEB-2022
+LOCUS       AcrIIA4_mammalian        321 bp ds-DNA     linear       09-MAR-2022
 DEFINITION  .
 FEATURES             Location/Qualifiers
-     CDS             1..372
-                     /label="AcrIIA2_bacterial"
-     exon            1..372
-                     /label="Translation 1-372"
+     source          1..321
+                     /label="color: #ffffff"
+                     /ApEinfo_revcolor=#b4abac
+                     /ApEinfo_fwdcolor=#b4abac
+     CDS             1..321
+                     /label="AcrIIA4_mammalian"
+                     /ApEinfo_revcolor=#85dae9
+                     /ApEinfo_fwdcolor=#85dae9
+     exon            1..321
+                     /label="Translation 1-321"
 ORIGIN
-        1 atgacattaa caagagcaca aaaaaagtat gcagaagcga tgcacgagtt tataaatatg
-       61 gtggatgact ttgaagagtc tacaccggat tttgcaaagg aagttctaca tgattctgac
-      121 tatgtagtta ttacaaaaaa tgaaaaatat gcagtagctc tttgctctct tagcactgat
-      181 gaatgtgaat atgatactaa cttatactta gatgaaaaat tggttgatta ctcaacagtt
-      241 gacgtaaacg gtgtgacata ctacatcaac attgttgaaa ctaacgatat cgatgattta
-      301 gaaatcgcta cggatgaaga tgagatgaaa agtggcaacc aagaaattat tttaaaaagt
-      361 gagttgaagt aa
+        1 atgaacatta acgacctcat acgagagatt aagaacaaag attacaccgt caaactgtca
+       61 ggaactgata gtaactcaat cacccagctt attatcaggg taaacaatga tgggaatgaa
+      121 tatgtgatat ctgagagcga aaacgagtct atcgtcgaga aattcatttc cgcttttaag
+      181 aacgggtgga atcaggaata tgaggatgaa gaagaatttt acaatgacat gcagacgatc
+      241 acgttgaaaa gtgaactgaa ctaagaattc tgcagatatc cagcacagtg gcggccgctc
+      301 gagtctagag ggcccgttta a
 //

CRISPR-Cas/iGEM_raw_imports.fasta

@@ -8,8 +8,6 @@ atggataagaaatactcaataggcttagctatcggcacaaatagcgtcggatgggcggtgatcactgatgaatataaggt
 taatttctactaagtgtagat
 > K2323010
 atgaaagtcactaaagtcgatggtattagccataagaagtatattgaagaagggaagttagttaaatcaacttcagaagaaaaccgcacgtcagaacgtctgtcggagctgctttcaattcgcctggatatctacattaagaatccggacaacgcgagtgaagaggaaaatcgtattcgtcgcgagaaccttaagaaatttttctcgaacaaggtcttacacctgaaagatagtgtcctgtacctgaaaaaccgtaaagagaaaaacgcggtgcaggacaagaactactctgaagaagacatttccgagtacgatcttaagaacaaaaatagcttttcggtgcttaaaaaaattctgttaaacgaggatgtgaactcagaggagttggaaattttccgcaaggacgtagaagcaaaactgaataagattaatagcttgaaatactctttcgaagagaacaaggcaaactaccaaaaaatcaatgagaataatgtggaaaaggttggcggcaagtctaagcgtaatatcatctacgattactatcgcgaaagtgcgaagcgcaatgattacattaataacgtccaggaggcttttgataagctttacaagaaggaagacatcgaaaaacttttcttcttgatcgaaaattctaagaaacatgagaaatataaaatccgtgaatattaccacaagattattggccgtaagaatgataaagagaactttgcaaaaatcatttatgaggaaatccaaaacgtaaacaatatcaaagaacttattgaaaaaattccggatatgagcgaacttaagaagtcacaagtattttacaagtattatttagacaaggaagaactgaatgacaaaaacattaaatacgccttttgccacttcgttgaaatcgagatgtcccagttgttgaaaaattatgtgtacaaacgtttgagtaatattagcaacgataaaattaaacgtatctttgagtaccaaaacctgaaaaagttgattgaaaataagttgttaaacaagctggatacctacgtgcgtaactgtggaaaatataattattatttacaggtcggagagatcgccactagcgactttatcgcgcgtaaccgtcagaatgaagcatttctgcgcaacatcatcggcgtatctagtgtagcctatttcagtctgcgtaatatcttagaaacggagaatgaaaacgggatcacggggcgcatgcgcggaaaaaccgtgaagaataataagggtgaggaaaagtatgtcagcggggaggtagataagatctataacgaaaataaacaaaacgaagttaaggagaacctgaagatgttttattcgtatgattttaatatggacaataaaaatgagatcgaggatttcttcgccaacatcgacgaagcaattagtagtatccgccacggtatcgtgcatttcaatttagaattggagggtaaggacatcttcgcgtttaaaaatatcgcgccttctgaaatctcaaagaagatgttccaaaatgaaatcaacgaaaaaaagttaaagttgaaaattttcaagcagttaaacagtgctaacgtttttaattactatgaaaaggatgtgatcatcaaatatttgaaaaatacaaagttcaatttcgtgaacaagaatattccctttgtcccgtcttttacgaaattgtacaataagattgaagacttacgcaacacactgaaatttttttggtcggtccccaaagataaagaggagaaggacgcgcaaatctacctgttgaagaatatttactatggggagttcctgaataagtttgtgaagaactctaaggtgttcttcaaaattaccaacgaagtgattaagatcaacaagcagcgtaaccagaagacagggcactataagtatcaaaagtttgagaatattgagaaaactgttcccgtggaatacttagctattatccaaagtcgtgaaatgattaacaatcaggacaaggaggagaagaacacgtatattgactttatccaacaaatctttttaaaagggttcatcgattatttaaataaaaataacttgaaatatattgagagcaacaataataatgataataacgatatttttagcaaaattaagattaagaaagataacaaggagaaatacgataaaattttgaaaaattatgagaaacacaatcgtaacaaggagatcccgcacgaaattaacgaatttgtgcgcgagatcaagcttgggaagattcttaagtatactgaaaacctgaatatgttttatttgattcttaaattacttaaccataaggaactgactaaccttaaaggtagcctggagaagtatcaatcagcgaacaaagaggagaccttcagtgatgagttagaattgattaatttacttaatttggacaataatcgcgtgactgaagacttcgagctggaggctaatgaaatcggcaaattcttagattttaatgagaataagatcaaagaccgtaaggagctgaaaaagttcgatacaaacaaaatctatttcgacggtgaaaacattatcaaacatcgcgctttttataatatcaagaaatatggcatgcttaaccttctggaaaagattgccgataaagctaaatataaaatttccttaaaggaactgaaggaatattcgaataagaaaaatgagatcgaaaagaactatacgatgcagcagaatcttcatcgcaaatatgcacgccccaaaaaagatgaaaagtttaatgacgaagattacaaagagtatgaaaaggctatcggcaacattcaaaagtacacgcacttaaagaataaagtagagtttaatgagttgaatctgttgcaaggtttactgctgaaaatccttcatcgcttagtgggttatacgtctatctgggaacgtgacttgcgttttcgtttaaagggggagttcccagaaaatcattatatcgaggagatcttcaattttgataattcgaaaaatgttaaatacaaatctggtcagatcgtagagaaatatatcaacttctataaggaactgtataaagacaatgtagagaaacgttcaatctactccgacaagaaggtcaagaagttaaagcaagaaaaaaaggatttgtatatccgcaattacattgcacatttcaactatatcccccatgcagagatcagcttattggaagtccttgagaaccttcgcaaactgctttcctatgatcgcaaattaaaaaatgcgattatgaagtctatcgtggatatcctgaaagaatacggctttgttgcgacatttaaaatcggggcggataaaaagattgaaattcaaacattagaatcagagaaaattgtacacctgaagaatttaaaaaaaaagaaattgatgacagatcgtaacagcgaggaactttgcgaacttgtgaaagtgatgtttgaatacaaagccttggaagccgctgctttggaagcccgtaaagaagccgagttggcggcagcgacagcggagcagtaa
-> pSB1C5
-tccggcaaaaaagggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgttatgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagctcgaggcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagcgagctcgatatcaaattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgcccgatcaactcgagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg
 > D1005
 ggtctcga
 > D1006