DNA to Protein #63
Open
DNA to Protein #63
Conversation
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
sadrasabouri
added
documentation
Codecov ReportAll modified and coverable lines are covered by tests ✅
Additional details and impacted files@@ Coverage Diff @@
## dev #63 +/- ##
=========================================
Coverage 100.00% 100.00%
=========================================
Files 5 5
Lines 222 234 +12
Branches 31 33 +2
=========================================
+ Hits 222 234 +12 ☔ View full report in Codecov by Sentry. 🚀 New features to boost your workflow:
|
There was a problem hiding this comment.
Pull Request Overview
This pull request implements a new method to convert a DNA sequence to its corresponding protein sequence.
- Introduces the to_protein method in Primer (opr/primer.py) and its supporting function, protein_seq_calc, in opr/functions.py.
- Adds a codon-to-amino acid mapping in opr/params.py and several tests in tests/test_operations.py to validate the protein conversion.
- Updates the README and CHANGELOG to document and track the new functionality.
Reviewed Changes
Copilot reviewed 6 out of 6 changed files in this pull request and generated 3 comments.
Show a summary per file
| File | Description |
|---|---|
| tests/test_operations.py | Added tests for the new to_protein method with various frames. |
| opr/primer.py | Added to_protein method integrating the protein_seq_calc function. |
| opr/params.py | Added a CODONS_TO_AMINO_ACIDS table to support protein translation. |
| opr/functions.py | Introduced protein_seq_calc to derive protein sequences from RNA. |
| README.md | Documented the new to_protein functionality with examples. |
| CHANGELOG.md | Updated changelog to include the addition of the to_protein method. |
There was a problem hiding this comment.
Pull Request Overview
This PR adds a new to_protein method to the Primer class to enable conversion of DNA sequences into their corresponding protein sequences.
- Added a new method in opr/primer.py that leverages the new protein_seq_calc function.
- Introduced the CODONS_TO_AMINO_ACIDS mapping in opr/params.py and the protein_seq_calc function in opr/functions.py.
- Updated tests, documentation, and the changelog to reflect these changes.
Reviewed Changes
Copilot reviewed 6 out of 6 changed files in this pull request and generated no comments.
Show a summary per file
| File | Description |
|---|---|
| tests/test_operations.py | Added multiple test cases to validate conversion of DNA to protein with various reading frames. |
| opr/primer.py | Implemented the to_protein method to expose protein conversion functionality. |
| opr/params.py | Introduced the CODONS_TO_AMINO_ACIDS mapping for protein translation. |
| opr/functions.py | Added the protein_seq_calc function to compute protein sequences from RNA. |
| README.md | Documented the to_protein functionality with examples. |
| CHANGELOG.md | Recorded the addition of the to_protein method. |
sepandhaghighi
requested changes
Apr 22, 2025
CHANGELOG.md
Outdated
| @@ -8,6 +8,8 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0. | |||
| ### Changed | |||
| - Test system modified | |||
| - `Python 3.6` support dropped | |||
| ### Added | |||
There was a problem hiding this comment.
### Added
...
### Changed
...
README.md
Outdated
| @@ -154,6 +154,14 @@ | |||
| 'CUGGAGGACGGAAGAGGAAGUAA' | |||
| ``` | |||
|
|
|||
| #### To Protein | |||
| ```pycon | |||
| >>> oprimer_rna = oprimer.to_protein(frame=3) | |||
There was a problem hiding this comment.
oprimer_rna --> oprimer_protein
|
Thanks for the review @sepandhaghighi |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
Reference Issues/PRs
#59
What does this implement/fix? Explain your changes.
This PR adds the
to_proteinmethod so that the OPR object can now have a protein representation.Any other comments?