The goal of SeedMatchR is to help users identify potential seed-mediated effects in their RNA-seq data.
These changes in this forked repository is to add the biological target bulges and wobbles in the search space.
This version of SeedMatchR requires R ≥ 4.3.0, but it is recommended to use the latest version of R to avoid issues with annotation retrieval for newer genomes.
You can install the development version of SeedMatchR from GitHub or the stable build from CRAN.
# Install from GitHub
install.packages("devtools")
# Public Repository
devtools::install_github("tacazares/SeedMatchR")This example uses the siRNA sequence, D1, targeting the Ttr gene in rat liver from the publication:
Schlegel MK, Janas MM, Jiang Y, Barry JD, Davis W, Agarwal S, Berman D, Brown CR, Castoreno A, LeBlanc S, Liebow A, Mayo T, Milstein S, Nguyen T, Shulga-Morskaya S, Hyde S, Schofield S, Szeto J, Woods LB, Yilmaz VO, Manoharan M, Egli M, Charissé K, Sepp-Lorenzino L, Haslett P, Fitzgerald K, Jadhav V, Maier MA. From bench to bedside: Improving the clinical safety of GalNAc-siRNA conjugates using seed-pairing destabilization. Nucleic Acids Res. 2022 Jul 8;50(12):6656-6670. doi: 10.1093/nar/gkac539. PMID: 35736224; PMCID: PMC9262600.
The guide sequence of interest is 23 bp long and oriented 5’ -> 3’.
# siRNA sequence of interest targeting a 23 bp region of the Ttr gene
guide.seq = "UUAUAGAGCAAGAACACUGUUUU"We use AnnotationHub to derive the GTF and DNA sequence files for
the species of interest. Once you have derived the annotations, you
could save them as an Rdata object to increase the speed of loading the
data sets. Running this function will take several minutes. Therefore it
might be helpful to save the objects and reload them later if you plan
to use this code in a repeated workflow.
annodb = load_annotations(reference.name = "rnor6", canonical = FALSE, min.feature.width = 8, longest.utr = T)
#> Build AnnotationFilter for transcript features based on the following parameters:
#> Keep only standard chroms: TRUE
#> Remove rows with NA in transcript ID: TRUE
#> Keep only protein coding genes and transcripts: TRUE
#> Filtering for transcripts with support level: FALSE
#> Keep only the ENSEMBL canonical transcript: FALSE
#> Filtering for specific genes: FALSE
#> Filtering for specific transcripts: FALSE
#> Filtering for specific gene symbols: FALSE
#> Filtering for specific entrez id: FALSE
#> Loading annotations from AnnotationHub for rnor6
#> loading from cache
#> require("rtracklayer")
#> loading from cache
#> require("ensembldb")
#> Extracting 3UTR from ensembldb object.
#> Keeping the longest UTR per gene.
#> Extracting sequences for each feature.
#> Keeping sequences that are >= 8The most straightforward way of using SeedMatchR is to search a reference set of transcripts given an input sequence.
res.df = SeedMatchR(seqs = annodb$seqs,
sequence = guide.seq,
seed.name = "mer7m8",
res.format = "granges")res.df = full_search(guide.seq, annodb$seqs, group.name = "Ttr")The test data that is provided with SeedMatchR was derived from the
2022 publication by Schlegel et al. The data set represents a DESeq2
analysis performed on rat liver that had been treated with Ttr targeting
siRNA. We will use this example to explore seed mediated activity.
Notes: >The SeedMatchR function will look for specific column in the
input if using the res argument to map seed matches to differential
expression data. The input must contain the columns gene_id,
log2FoldChange, and padj.
We start by downloading the example data set. This function will download three files from the GEO accession GSE184929. These files represent three samples with different siRNA treatments at two dosages.
get_example_data("sirna")We can load the example data into the environment.
sirna.data = load_example_data("sirna")The DESeq2 results are available through the names
Schlegel_2022_Ttr_D1_30mkg, Schlegel_2022_Ttr_D4_30mkg and
Schlegel_2022_Ttr_D1_10mkg. The data set name is long, so it will be
renamed to res.
res <- sirna.data$Schlegel_2022_Ttr_D1_30mkgThe DESeq2 results file is then filtered. The function filter_res()
can be used to filter a results file by log2FoldChange, padj, baseMean,
and remove NA entries.
# Dimensions before filtering
dim(res) # [1] 32883 8
#> [1] 32883 8
# Filter DESeq2 results for SeedMatchR
res = filter_res(res, fdr_cutoff=1, fc_cutoff=0)
# Dimensions after filtering
dim(res) # [1] 13582 8
#> [1] 8124 8You can perform a seed match for a single seed using the SeedMatchR()
function.
Notes:
The names of the sequences in
seqswill determine if you need to use thetx.id.colargument. If you sequence names are gene IDs, then no additional flags need to be set. If they sequence names are transcripts, then the argumenttx.id.colshould be set toTRUE. This will summarize the transcript matches to the gene level using information in the gtf file.
res = SeedMatchR(res = res,
seqs = annodb$seqs,
sequence = guide.seq,
seed.name = "mer7m8")
head(res, 2)
#> gene_id baseMean log2FoldChange lfcSE stat pvalue
#> 1 ENSRNOG00000016275 2138.0945 -8.164615 NA -23.61818 2.507268e-123
#> 2 ENSRNOG00000000127 437.6342 -1.346927 0.1068629 -12.60425 2.000712e-36
#> padj symbol mer7m8
#> 1 3.405371e-119 Ttr 1
#> 2 1.358683e-32 Kpna6 0Many factors that perturb gene expression, like miRNA, show cumulative changes in their targets gene expression. Cumulative changes in the profile of genes expression can be visualized and tested with the emperical distribution function (ecdf) coupled with a statistical test such as the Kolmogorov-Smirnov test.
SeedMatchR provides functions for comparing the log2(Fold Change) of
two gene sets. The function deseq_fc_ecdf is designed to work directly
with a DESeq2 results data frame.
Required Inputs:
res: DESeq2 results data framegene.lists: A list of lists containing gene names
# Gene set 1
mer7m8.list = res$gene_id[res$mer7m8 >= 1]
# Gene set 2
background.list = res$gene_id[res$mer7m8 == 0]
ecdf.results = deseq_fc_ecdf(res,
list("Background" = background.list,
"mer7m8" = mer7m8.list))
ecdf.results$plot